Association of rs699947 (−2578 C/A) and rs2010963 (−634 G/C) Single Nucleotide Polymorphisms of the VEGF Gene, VEGF-A and Leptin Serum Level, and Cardiovascular Risk in Patients with Excess Body Mass: A Case–Control Study
Abstract
1. Introduction
2. Experimental Section
2.1. Study Design
2.2. Study Participants
2.3. Anthropometric Measurements
2.4. Circulatory Parameters
2.5. Blood Sample Collection
2.6. Biochemical Analysis
2.7. Genotyping
2.8. Statistical Analysis
3. Results
4. Discussion
4.1. Study Limitations
4.2. Study Strong Points
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Finucane, M.M.; Stevens, G.A.; Cowan, M.; Danaei, G.; Lin, J.K.; Paciorek, C.J.; Singh, G.M.; Gutierrez, H.R.; Lu, Y.; Bahalim, A.N.; et al. National, regional, and global trends in body mass index since 1980: Systematic analysis of health examination surveys and epidemiological studies with 960 country-years and 9.1 million participants. Lancet 2011, 377, 557. [Google Scholar] [CrossRef] [Scilit]
- Eurostat. Eurostat Regional Yearbook, 2017 ed.; Publications Office of the European Union: Luxembourg, 2017. [Google Scholar] [CrossRef]
- Nguyen, D.M.; El-Serag, H.B. The Epidemiology of Obesity. Gastroenterol. Clin. N. Am. 2010, 39, 1–7. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Finkelstein, E.A.; Trogdon, J.G.; Cohen, J.W.; Dietz, W. Annual medical spending attributable to obesity: Payer-and service-specific estimates. Health Aff. 2009, 28, w822–w831. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, H.; Wang, Q.; Venugopal, J.; Wang, J.; Kleiman, K.; Guo, C.; Eitzman, D.T. Obesity-induced Endothelial Dysfunction is Prevented by Neutrophil Extracellular Trap Inhibition. Sci. Rep. 2018, 8, 1–7. [Google Scholar] [CrossRef] [Scilit]
- Chen, J.; Fu, Y.; Day, D.S.; Sun, Y.; Wang, S.; Liang, X.; Gu, F.; Zhang, F.; Stevens, S.M.; Zhou, P.; et al. VEGF amplifies transcription through ETS1 acetylation to enable angiogenesis /631/136/16 /631/337/572 article. Nat. Commun. 2017, 8, 1–13. [Google Scholar] [CrossRef] [Scilit]
- Ferrara, N. Vascular endothelial growth factor: Basic science and clinical progress. Endocr. Rev. 2004, 25, 581–611. [Google Scholar] [CrossRef] [Scilit]
- Du, X.; Ou, X.; Song, T.; Zhang, W.; Cong, F.; Zhang, S.; Xiong, Y. Adenosine A2B receptor stimulates angiogenesis by inducing VEGF and eNOS in human microvascular endothelial cells. Exp. Biol. Med. 2015, 240, 1472–1479. [Google Scholar] [CrossRef] [Scilit]
- Ray, D.; Mishra, M.; Ralph, S.; Read, I.; Davies, R.; Brenchley, P. Association of the VEGF Gene with Proliferative Diabetic Retinopathy but Not Proteinuria in Diabetes. Diabetes 2004, 53, 861–864. [Google Scholar] [CrossRef] [Scilit]
- Inoue, M.; Itoh, H.; Ueda, M.; Naruko, T.; Kojima, A.; Komatsu, R.; Doi, K.; Ogawa, Y.; Tamura, N.; Takaya, K.; et al. Vascular endothelial growth factor (VEGF) expression in human coronary atherosclerotic lesions: Possible pathophysiological significance of VEGF in progression of atherosclerosis. Circulation 1998, 98, 2108–2116. [Google Scholar] [CrossRef] [Scilit]
- Fleisch, M.; Billinger, M.; Eberli, F.R.; Garachemani, A.R.; Meier, B.; Seiler, C. Physiologically assessed coronary collateral flow and intracoronary growth factor concentrations in patients with 1- to 3-vessel coronary artery disease. Circulation 1999, 100, 1945–1950. [Google Scholar] [CrossRef] [Scilit]
- Celletti, F.L.; Waugh, J.M.; Amabile, P.G.; Brendolan, A.; Hilfiker, P.R.; Dake, M.D. Vascular endothelial growth factor enhances atherosclerotic plaque progression. Nat. Med. 2001, 7, 425–429. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Van Belle, E.; Maillard, L.; Tio, F.O.; Isner, J.M. Accelerated endothelialization by local delivery of recombinant human vascular endothelial growth factor reduces in-stent intimal formation. Biochem. Biophys. Res. Commun. 1997, 235, 311–316. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Van Belle, E.; Tio, F.O.; Couffinhal, T.; Maillard, L.; Passeri, J.; Isner, J.M. Stent endothelialization: Time course, impact of local catheter delivery, feasibility of recombinant protein administration, and response to cytokine expedition. Circulation 1997, 95, 438–448. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Moradzadegan, A.; Vaisi-Raygani, A.; Nikzamir, A.; Rahimi, Z. Angiotensin converting enzyme insertion/deletion (I/D) (rs4646994) and Vegf polymorphism (+405G/C; rs2010963) in type II diabetic patients: Association with the risk of coronary artery disease. J. Renin Angiotensin Aldosterone Syst. 2015, 16, 672–680. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Howell, W.M.; Ali, S.; Rose-Zerilli, M.J.; Ye, S. VEGF polymorphisms and severity of atherosclerosis. J. Med. Genet. 2005, 42, 485–490. [Google Scholar] [CrossRef] [Scilit]
- Awata, T.; Kurihara, S.; Takata, N.; Neda, T.; Iizuka, H.; Ohkubo, T.; Osaki, M.; Watanabe, M.; Nakashima, Y.; Inukai, K.; et al. Functional VEGF C-634G polymorphism is associated with development of diabetic macular edema and correlated with macular retinal thickness in type 2 diabetes. Biochem. Biophys. Res. Commun. 2005, 333, 679–685. [Google Scholar] [CrossRef] [Scilit]
- Shahbazi, M.; Fryer, A.A.; Pravica, V.; Brogan, I.J.; Ramsay, H.M.; Hutchinson, I.V.; Harden, P.N. Vascular endothelial growth factor gene polymorphisms are associated with acute renal allograft rejection. J. Am. Soc. Nephrol. 2002, 13, 260–264. [Google Scholar]
- Mateo, I.; Llorca, J.; Infante, J.; Rodríguez-Rodríguez, E.; Sánchez-Quintana, C.; Sánchez-Juan, P.; Berciano, J.; Combarros, O. Case-control study of vascular endothelial growth factor (VEGF) genetic variability in Alzheimer’s disease. Neurosci. Lett. 2006, 401, 171–173. [Google Scholar] [CrossRef] [Scilit]
- Awata, T.; Inoue, K.; Kurihara, S.; Ohkubo, T.; Watanabe, M.; Inukai, K.; Inoue, I.; Katayama, S. A common polymorphism in the 5′-untranslated region of the VEGF gene is associated with diabetic retinopathy in type 2 diabetes. Diabetes 2002, 51, 1635–1639. [Google Scholar] [CrossRef] [Scilit]
- Lambrechts, D.; Storkebaum, E.; Morimoto, M.; Del-Favero, J.; Desmet, F.; Marklund, S.L.; Wyns, S.; Thijs, V.; Andersson, J.; Van Marion, I.; et al. VEGF is a modifier of amyotrophic lateral sclerosis in mice and humans and protects motoneurons against ischemic death. Nat. Genet. 2003, 34, 383–394. [Google Scholar] [CrossRef] [Scilit]
- Izquierdo, A.G.; Crujeiras, A.B.; Casanueva, F.F.; Carreira, M.C. Leptin, obesity, and leptin resistance: Where are we 25 years later? Nutrients 2019, 11, 2704. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Korda, M.; Kubant, R.; Patton, S.; Malinski, T. Leptin-induced endothelial dysfunction in obesity. Am. J. Physiol. Heart Circ. Physiol. 2008, 295, H1514–H1521. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gonzalez-Perez, R.R.; Xu, Y.; Guo, S.; Watters, A.; Zhou, W.; Leibovich, S.J. Leptin upregulates VEGF in breast cancer via canonic and non-canonical signalling pathways and NFkappaB/HIF-1alpha activation. Cell. Signal. 2010, 22, 1350–1362. [Google Scholar] [CrossRef] [Scilit]
- Guo, S.; Gonzalez-Perez, R.R. Notch, IL-1 and Leptin Crosstalk Outcome (NILCO) Is Critical for Leptin-Induced Proliferation, Migration and VEGF/VEGFR-2 Expression in Breast Cancer. PLoS ONE 2011, 6, e21467. [Google Scholar] [CrossRef] [Scilit]
- Yang, W.H.; Chang, A.C.; Wang, S.W.; Wang, S.J.; Chang, Y.S.; Chang, T.M.; Hsu, S.K.; Fong, Y.C.; Tang, C.H. Leptin promotes VEGF-C production and induces lymphangiogenesis by suppressing miR-27b in human chondrosarcoma cells. Sci. Rep. 2016, 6, 28647. [Google Scholar] [CrossRef] [Scilit]
- Yumuk, V.; Tsigos, C.; Fried, M.; Schindler, K.; Busetto, L.; Micic, D.; Toplak, H. European Guidelines for Obesity Management in Adults. Obes. Facts 2015, 8, 402–424. [Google Scholar] [CrossRef] [Scilit]
- Wilk, B.; Marek, W. Ocena sztywności tętnic na podstawie analizy falkowej sygnału fotopletyzmograficznego—Pomiary Automatyka Kontrola—Tom R. 59, nr 12 (2013)—BazTech—Yadda. PAK 2013, 59, 1301–1303. [Google Scholar]
- Friedewald, W.T.; Levy, R.I.; Fredrickson, D.S. Estimation of the concentration of low-density lipoprotein cholesterol in plasma, without use of the preparative ultracentrifuge. Clin. Chem. 1972, 18, 499–502. [Google Scholar] [CrossRef] [Scilit]
- National Kidney Foundation. K/DOQI clinical practice guidelines for chronic kidney disease: Evaluation, classification, and stratification. Am. J. Kidney Dis. 2002, 39, S1–S266. [Google Scholar]
- Stanisz, A. The Accessible Course of Statistics with Use the STATISTICA PL for Medicine Examples; StatSoft Polska: Kraków, Poland, 2007. [Google Scholar]
- Klisić, A.; Kavarić, N.; Bjelaković, B.; Jovanović, M.; Zvrko, E.; Stanišic, V.; Ninić, A.; Šcepanović, A. Cardiovascular risk assessed by reynolds risk score in relation to waist circumference in apparently healthy middle-aged population in Montenegro. Acta Clin. Croat. 2018, 57, 22–30. [Google Scholar] [CrossRef] [Scilit]
- Gronewold, J.; Kropp, R.; Lehmann, N.; Stang, A.; Mahabadi, A.A.; Kälsch, H.; Weimar, C.; Dichgans, M.; Budde, T.; Moebus, S.; et al. Cardiovascular Risk and Atherosclerosis Progression in Hypertensive Persons Treated to Blood Pressure Targets. Hypertension 2019, 74, 1436–1447. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Peters, S.A.E.; Singhateh, Y.; Mackay, D.; Huxley, R.R.; Woodward, M. Total cholesterol as a risk factor for coronary heart disease and stroke in women compared with men: A systematic review and meta-analysis. Atherosclerosis 2016, 248, 123–131. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kong, A.P.S.; Choi, K.C.; Cockram, C.S.; Ho, C.S.; Chan, M.H.M.; Ozaki, R.; Wong, G.W.K.; Ko, G.T.C.; So, W.Y.; Tong, P.C.Y.; et al. Independent associations of alanine aminotransferase (ALT) levels with cardiovascular risk factor clustering in Chinese adolescents. J. Hepatol. 2008, 49, 115–122. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sun, G.Z.; Wang, H.Y.; Chen, Y.T.; Sun, Y.X. Serum uric acid levels positively correlates with 10-year cardiovascular risk score in the general population from China. Int. J. Cardiol. 2018, 266, 259. [Google Scholar] [CrossRef] [Scilit]
- Park, S.M.; Seo, H.S.; Lim, H.E.; Shin, S.H.; Park, C.G.; Oh, D.J.; Ro, Y.M. Assessment of arterial stiffness index as a clinical parameter for atherosclerotic coronary artery disease. Circ. J. 2005, 69, 1218–1222. [Google Scholar] [CrossRef] [Scilit]
- Cabrera-Rego, J.O.; Navarro-Despaigne, D.; Staroushik-Morel, L.; Díaz-Reyes, K.; Lima-Martínez, M.M.; Iacobellis, G. Association between endothelial dysfunction, epicardial fat and subclinical atherosclerosis during menopause. Clin. Investig. Arterioscler. 2018, 30, 21–27. [Google Scholar] [CrossRef] [Scilit]
- Yuan, Y.; Huang, F.; Lin, F.; Lin, M.; Zhu, P. Association of High Serum Uric Acid and Increased Arterial Stiffness is Dependent on Cardiovascular Risk Factors in Female Population. Horm. Metab. Res. 2019, 51, 367–374. [Google Scholar] [CrossRef] [Scilit]
- Elias, I.; Franckhauser, S.; Bosch, F. New insights into adipose tissue VEGF-A actions in the control of obesity and insulin resistance. Adipocyte 2013, 2, 109–112. [Google Scholar] [CrossRef] [Scilit]
- Larsen, A.I. The pulse; from adagio to prestissimo; the prognostic importance of heart rate increase and its associations with cardiovascular risk factors. Eur. J. Prev. Cardiol. 2019. [Google Scholar] [CrossRef] [Scilit]
- Baena-Díez, J.M.; Bermúdez-Chillida, N.; García-Lareo, M.; Byram, A.O.; Vidal-Solsona, M.; Vilató-García, M.; Gómez-Fernández, C.; Vásquez-Lazo, J.E. Papel de la presión de pulso, presión arterial sistólica y presión arterial diastólica en la predicción del riesgo cardiovascular. Estudio de cohortes. Med. Clin. 2008, 130, 361–365. [Google Scholar] [CrossRef] [Scilit]
- Rader, D.J.; Hovingh, G.K. HDL and cardiovascular disease. Lancet 2014, 384, 618–625. [Google Scholar] [CrossRef] [Scilit]
- Mathisen, U.D.; Melsom, T.; Ingebretsen, O.C.; Jenssen, T.; Njølstad, I.; Solbu, M.D.; Toft, I.; Eriksen, B.O. Estimated GFR associates with cardiovascular risk factors independently of measured GFR. J. Am. Soc. Nephrol. 2011, 22, 927–937. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Iaresko, M.; Kolesnikova, E. The Role of Polymorphism—634 G/C (Rs 2010963) of Vegf-A Gene in the Development of Hypertension and Obesity in Premenopausal Women. Georgian Med. News 2016, 100, 33–37. [Google Scholar] [CrossRef] [Scilit]
- Lu, X.; Ji, Y.; Zhang, L.; Zhang, Y.; Zhang, S.; An, Y.; Liu, P.; Zheng, Y. Resistance to obesity by repression of VEGF gene expression through induction of brown-like adipocyte differentiation. Endocrinology 2012, 153, 3123–3132. [Google Scholar] [CrossRef] [Scilit]
- Jamroz-Wiśniewska, A.; Gertler, A.; Solomon, G.; Wood, M.E.; Whiteman, M.; Beltowski, J. Leptin-induced endothelium-dependent vasorelaxation of peripheral arteries in lean and obese rats: Role of nitric oxide and hydrogen sulfide. PLoS ONE 2014, 9, e86744. [Google Scholar] [CrossRef] [Scilit]
| rs No. | Chromosome Location a | Alleles | Primers for PCR Amplification (5′–3′) | PCR Product Length (bp) | Annealing Temp. (°C) | Melt. Temp. Range (°C) |
|---|---|---|---|---|---|---|
| rs699947 | chr6:43768652 | A/C | F: ATTCTCAGTCCATGCCTCCA | 79 | 52 | 80–95 |
| R: CAGTCTGATTATCCACCCAGA | ||||||
| rs2010963 | chr6:43770613 | C/G | F: GTGGATTTTGGAAACCAGCA | 142 | 52 | 80–95 |
| R: AAAGCAGGTCACTCACTTTGC | analysis without and with spiking DNA |
| Parameter | Group A | Group B | p-Value | ||
|---|---|---|---|---|---|
| n | Mean ± SD | n | Mean ± SD | ||
| Body mass [kg] | 212 | 88.06 ± 15.40 | 145 | 62.80 ± 8.77 | <0.0001 |
| Height [cm] | 212 | 164.14 ± 12.56 | 145 | 167.25 ± 8.20 | <0.05 |
| BMI [kg/m2] | 212 | 32.08 ± 4.15 | 145 | 22.28 ± 1.84 | <0.0001 |
| WC [cm] | 212 | 105.22 ± 12.06 | 145 | 79.81 ± 9.82 | <0.0001 |
| NC [cm] | 212 | 38.70 ± 5.13 | 145 | 33.57 ± 2.76 | <0.0001 |
| SI | 172 | 8.61 ± 4.87 | 68 | 6.66 ± 2.12 | <0.0001 |
| PPT [ms] | 172 | 225.33 ± 69.34 | 68 | 262.09 ± 65.85 | <0.0001 |
| RI [%] | 172 | 54.60 ± 20.33 | 68 | 53.80 ± 30.13 | NS * |
| SBP [mmHg] | 212 | 142.12 ± 18.86 | 144 | 121.83 ± 16.89 | <0.0001 |
| DBP [mmHg] | 212 | 84.38 ± 12.39 | 144 | 75.99 ± 8.29 | <0.0001 |
| HR [BPM] | 172 | 76.56 ± 13.33 | 140 | 78.16 ± 13.22 | NS * |
| VEGF-A [pg/mL] | 212 | 218.94 ± 197.80 | 145 | 322.40 ± 314.94 | <0.05 |
| Leptin [ng/mL] | 212 | 26.55 ± 21.35 | 145 | 14.03 ± 12.66 | <0.0001 |
| GLU [mg/dL] | 211 | 101.30 ± 33.10 | 145 | 88.66 ± 16.20 | <0.0001 |
| TCH [mg/dL] | 208 | 201.58 ± 42.79 | 141 | 191.29 ± 35.72 | <0.05 |
| HDL [mg/dL] | 208 | 58.44 ± 14.51 | 142 | 70.42 ± 17.41 | <0.0001 |
| LDL [mg/dL] | 199 | 111.95 ± 50.20 | 141 | 104.26 ± 47.75 | NS * |
| TG [mg/dL] | 208 | 185.68 ± 106.50 | 142 | 112.61 ± 76.45 | <0.0001 |
| Creat [mg/dL] | 208 | 0.80 ± 2.70 | 142 | 0.71 ± 0.14 | <0.0001 |
| eGFR [ml/min/m2] | 204 | 59.49 ± 1.33 | 141 | 60.00 ± 0.03 | <0.05 |
| AST [U/L] | 208 | 29.41 ± 11.58 | 142 | 25.04 ± 6.62 | <0.0001 |
| ALT [U/L] | 208 | 36.49 ± 21.55 | 142 | 22.97 ± 10.05 | <0.0001 |
| UA [g/dl] | 208 | 5.77 ± 1.33 | 142 | 4.28 ± 0.99 | <0.0001 |
| CRP [mg/l] | 208 | 5.05 ± 2.87 | 141 | 4.17 ± 1.11 | <0.001 |
| rs699947 (−2578 C/A) Variant | Total | Women | Men | |||
|---|---|---|---|---|---|---|
| Group A (n = 212) | Group B (n = 145) | Group A (n = 140) | Group B (n = 113) | Group A (n = 72) | Group B (n = 32) | |
| AA | 50 | 44 | 36 | 34 | 14 | 10 |
| % of column | 24% | 30.5% | 25.5% | 30% | 19% | 31% |
| AC | 111 | 70 | 68 | 52 | 43 | 18 |
| % of column | 52% | 48% | 49% | 46% | 60% | 56% |
| CC | 51 | 31 | 36 | 27 | 15 | 4 |
| % of column | 24% | 21.5% | 25.5% | 24% | 21% | 13% |
| Chi2; p-value | Chi2 = 2.05; p = 0.3595 | Chi2 = 0.60; p = 0.7402 | Chi2 = 2.23; p = 0.3286 | |||
| rs2010963 (−634 G/C) Variant | Total | Women | Men | |||
|---|---|---|---|---|---|---|
| Group A (n = 212) | Group B (n = 145) | Group A (n = 140) | Group B (n = 113) | Group A (n = 72) | Group B (n = 32) | |
| GG | 118 | 88 | 79 | 70 | 39 | 18 |
| % of column | 56% | 61% | 57% | 62% | 54% | 56% |
| CG | 77 | 48 | 48 | 34 | 29 | 14 |
| % of column | 36% | 33% | 34% | 30% | 40% | 44% |
| CC | 17 | 9 | 13 | 9 | 4 | 0 |
| % of column | 8% | 6% | 9% | 8% | 6% | 0% |
| Chi2; p-value | Chi2 = 1.02; p = 0.6004 | Chi2 = 0.78; p = 0.6741 | Chi2 = 1.86; p = 0.3946 | |||
| Serum Concentration/VEGF Gene Variant | Total | Group A | Group B | |||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Genotype | n | Mean ± SD | p K-W | n | Mean ± SD | p K-W | n | Mean ± SD | p K-W | |
| VEGF-A [pg/mL]/rs699947 (−2578 C/A) | AA | 94 | 253.02 ± 227.07 | 0.397 | 50 | 175.22 ± 95.71 | 0.2529 | 44 | 341.43 ± 293.32 | 0.6066 |
| AC | 181 | 266.45 ± 290.53 | 111 | 232.38 ± 241.17 | 70 | 320.48 ± 350.21 | ||||
| CC | 82 | 257.97 ± 206.65 | 51 | 232.58 ± 160.20 | 31 | 299.74 ± 263.86 | ||||
| VEGF-A [pg/mL]/rs2010963 (−634 G/C) | GG | 206 | 259.27 ± 242.70 | 0.8416 | 118 | 219.19 ± 204.95 | 0.6815 | 88 | 313.01 ± 277.86 | 0.9972 |
| CG | 125 | 267.43 ± 292.37 | 77 | 215.54 ± 195.55 | 48 | 350.68 ± 390.13 | ||||
| CC | 26 | 243.32 ± 175.67 | 17 | 232.66 ± 164.02* | 8 | 263.45 ± 204.78* | ||||
| Leptin [ng/mL]/rs699947 (−2578 C/A) | AA | 94 | 21.92 ± 22.58 | 0.4918 | 50 | 29.31 ± 27.13 | 0.7902 | 44 | 13.53 ± 11.36 | 0.9739 |
| AC | 181 | 21.31 ± 19.30 | 111 | 25.86 ± 21.13 | 70 | 14.09 ± 13.17 | ||||
| CC | 82 | 21.29 ± 15.03 | 51 | 25.34 ± 14.52 | 31 | 14.62 ± 13.57 | ||||
| Leptin [ng/mL]/rs2010963 (−634 G/C) | GG | 206 | 21.54 ± 19.90 | 0.9769 | 118 | 27.78 ± 23.01 | 0.937 | 88 | 13.18 ± 9.87 | 0.5805 |
| CG | 125 | 21.73 ± 19.24 | 77 | 25.32 ± 20.09 | 48 | 15.98 ± 16.41 | ||||
| CC | 26 | 19.55 ± 14.91 | 17 | 23.52 ± 14.01 | 9 | 12.04 ± 14.32 | ||||
| rs699947 (−2578C/A) Polymorphism | Total | Group A | Group B | |||
|---|---|---|---|---|---|---|
| Below Median (n = 177) | Above Median (n = 180) | Below Median (n = 114) | Above Median (n = 98) | Below Median (n = 63) | Above Median (n = 82) | |
| AA | 46 | 48 | 29 | 21 | 17 | 27 |
| % of column | 26% | 26.5% | 25.44% | 21.43% | 26.98% | 32.93% |
| AC | 97 | 84 | 63 | 48 | 34 | 36 |
| % of column | 55% | 47% | 55.26% | 48.98% | 53.97% | 43.90% |
| CC | 34 | 48 | 22 | 29 | 12 | 19 |
| % of column | 19% | 26.5% | 19.30% | 29.59% | 19.05% | 23.17% |
| Chi2; p-value | Chi2 = 3.34; p = 0.1881 | Chi2 = 3.08; p = 0.2146 | Chi2 = 1.44; p = 0.4854 | |||
| rs2010963 (−634 G/C) Polymorphism | Below median (n = 177) | Above median (n = 180) | Below median (n = 114) | Above median (n = 98) | Below median (n = 63) | Above median (n = 82) |
| GG | 102 | 104 | 64 | 54 | 38 | 50 |
| % of column | 57.5% | 58% | 56% | 55% | 60% | 61% |
| CG | 67 | 58 | 45 | 32 | 22 | 26 |
| % of column | 38% | 32% | 39.5% | 33% | 35% | 32% |
| CC | 8 | 18 | 5 | 12 | 3 | 6 |
| % of column | 4.5% | 10% | 4.5% | 12% | 5% | 7% |
| Chi2; p-value | Chi2 = 4.49; p = 0.1060 | Chi2 = 4.74; p = 0.0933 | Chi2 = 0.49; p = 0.7833 | |||
| rs699947 (−2578 C/A) Polymorphism | Total | Group A | Group B | |||
|---|---|---|---|---|---|---|
| Below Median (n = 181) | Above Median (n = 176) | Below Median (n = 83) | Above Median (n = 129) | Below Median (n = 98) | Above Median (n = 47) | |
| AA | 52 | 42 | 22 | 28 | 30 | 14 |
| % of column | 29% | 24% | 27% | 22% | 31% | 30% |
| AC | 91 | 90 | 44 | 67 | 47 | 23 |
| % of column | 50% | 51% | 53% | 52% | 48% | 49% |
| CC | 38 | 44 | 17 | 34 | 21 | 10 |
| % of column | 21% | 25% | 20% | 26% | 21% | 21% |
| Chi2; p-value | Chi2 = 1.44; p = 0.4871 | Chi2 = 1.23; p = 0.9932 | Chi2 = 0.14; p = 0.9932 | |||
| rs2010963 (−634 G/C) polymorphism | Below median (n = 181) | Above median (n = 176) | Below median (n = 83) | Above median (n = 129) | Below median (n = 98) | Above median (n = 47) |
| GG | 108 | 98 | 48 | 70 | 60 | 28 |
| % of column | 59.5% | 56% | 58% | 54% | 61% | 60% |
| CG | 61 | 64 | 30 | 47 | 31 | 17 |
| % of column | 34% | 36% | 36% | 37% | 32% | 36% |
| CC | 12 | 14 | 5 | 12 | 7 | 2 |
| % of column | 6.5% | 8% | 6% | 9% | 7% | 4% |
| Chi2; p-value | Chi2=0.64; p = 0.7257 | Chi2 = 0.79; p = 0.6725 | Chi2 = 0.63; p = 0.7170 | |||
| Correlations of VEGF-A Serum Concentration | |||||||
|---|---|---|---|---|---|---|---|
| Parameter | Genotype | Group | R | Parameter | Genotype | Group | R |
| eGFR | GG | A | −0.19 | DBP | CC | A | 0.49 |
| RI | CG | B | −0.48 | eGFR | CC | A | −0.52 |
| HR | CC | A + B | 0.45 | HDL | CC | A + B | 0.46 |
| HR | CC | A | 0.61 | HDL | CC | A | 0.59 |
| Correlations of Leptin Serum Concentration | |||||||
| Parameter | Genotype | Group | R | Parameter | Genotype | Group | R |
| Height | GG | A + B | −0.33 | HDL | GG | A | 0.31 |
| Height | GG | A | −0.38 | Height | CG | A + B | −0.29 |
| Height | GG | B | −0.22 | Height | CG | A | −0.24 |
| NC | GG | A | −0.26 | SI | CG | B | −0.46 |
| NC | GG | B | −0.22 | PPT | CG | B | 0.48 |
| HR | GG | A | 0.23 | RI | CG | A | −0.38 |
| CRP | GG | A | 0.20 | ALT | CG | A | −0.31 |
| Correlations of VEGF-A Serum Concentration | |||||||
|---|---|---|---|---|---|---|---|
| Parameter | Genotype | Group | R | Parameter | Genotype | Group | R |
| GLU | AA | A + B | 0.34 | Leptin | CC | A | 0.30 |
| GLU | AA | A | 0.46 | NC | CC | A | −0.31 |
| GLU | AA | B | 0.45 | SI | CC | A + B | −0.29 |
| SI | AA | A | 0.37 | PPT | CC | A + B | 0.31 |
| PPT | AA | A | −0.36 | HR | CC | B | 0.40 |
| TCH | AA | B | −0.33 | ALT | CC | A | −0.30 |
| LDL | AA | B | −0.33 | HDL | CC | A | 0.33 |
| Correlations of Leptin Serum Concentration | |||||||
| Parameter | Genotype | Group | R | Parameter | Genotype | Group | R |
| HR | AA | A + B | 0.32 | SI | AC | A | −0.29 |
| HR | AA | A | 0.33 | PPT | AC | A | 0.28 |
| HR | AA | B | 0.33 | RI | AC | A | −0.42 |
| Height | AC | A + B | −0.42 | CRP | AC | A | 0.26 |
| Height | AC | A | −0.43 | VEGF−A | CC | A | 0.30 |
| Height | AC | B | −0.42 | ALT | CC | A | −0.33 |
| NC | AC | A | −0.26 | TCH | CC | B | −0.42 |
| NC | AC | B | −0.38 | HDL | CC | A | 0.32 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Skrypnik, D.; Mostowska, A.; Jagodziński, P.P.; Bogdański, P. Association of rs699947 (−2578 C/A) and rs2010963 (−634 G/C) Single Nucleotide Polymorphisms of the VEGF Gene, VEGF-A and Leptin Serum Level, and Cardiovascular Risk in Patients with Excess Body Mass: A Case–Control Study. J. Clin. Med. 2020, 9, 469. https://doi.org/10.3390/jcm9020469
Skrypnik D, Mostowska A, Jagodziński PP, Bogdański P. Association of rs699947 (−2578 C/A) and rs2010963 (−634 G/C) Single Nucleotide Polymorphisms of the VEGF Gene, VEGF-A and Leptin Serum Level, and Cardiovascular Risk in Patients with Excess Body Mass: A Case–Control Study. Journal of Clinical Medicine. 2020; 9(2):469. https://doi.org/10.3390/jcm9020469
Chicago/Turabian StyleSkrypnik, Damian, Adrianna Mostowska, Paweł Piotr Jagodziński, and Paweł Bogdański. 2020. "Association of rs699947 (−2578 C/A) and rs2010963 (−634 G/C) Single Nucleotide Polymorphisms of the VEGF Gene, VEGF-A and Leptin Serum Level, and Cardiovascular Risk in Patients with Excess Body Mass: A Case–Control Study" Journal of Clinical Medicine 9, no. 2: 469. https://doi.org/10.3390/jcm9020469
APA StyleSkrypnik, D., Mostowska, A., Jagodziński, P. P., & Bogdański, P. (2020). Association of rs699947 (−2578 C/A) and rs2010963 (−634 G/C) Single Nucleotide Polymorphisms of the VEGF Gene, VEGF-A and Leptin Serum Level, and Cardiovascular Risk in Patients with Excess Body Mass: A Case–Control Study. Journal of Clinical Medicine, 9(2), 469. https://doi.org/10.3390/jcm9020469

