The Mitochondrial Antioxidant SS-31 Modulates Oxidative Stress, Endoplasmic Reticulum Stress, and Autophagy in Type 2 Diabetes
Abstract
:1. Introduction
2. Experimental Section
2.1. Human Subjects
2.2. Sample Collection
2.3. Laboratory Tests
2.4. Leukocyte Isolation
2.5. PMN-Endothelium Interaction Assay
2.6. Quantitative Fluorescence Microscopy
2.7. Flow Cytometry
2.8. Western Blotting (WB)
2.9. Quantitative RT-PCR (qRT-PCR)
2.10. Statistical Analysis
3. Results
3.1. Clinical and Endocrine Parameters
3.2. Leukocyte Function
3.3. Oxidative Stress: ROS Production
3.4. Calcium Levels
3.5. Regulation of UPR Signalling
3.6. Autophagy Assessment
3.7. Analysis of Pharmacologically Induced ER Stress and Autophagy
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Giacco, F.; Brownlee, M. Oxidative stress and diabetic complications. Circ. Res. 2010, 107, 1058–1070. [Google Scholar] [CrossRef] [PubMed]
- Akash, M.S.; Rehman, K.; Chen, S. Role of inflammatory mechanisms in pathogenesis of type 2 diabetes mellitus. J. Cell. Biochem. 2013, 114, 525–531. [Google Scholar] [CrossRef] [PubMed]
- Higa, A.; Chevet, E. Redox signaling loops in the unfolded protein response. Cell. Signal. 2012, 24, 1548–1555. [Google Scholar] [CrossRef] [PubMed]
- Klausner, R.D.; Sitia, R. Protein degradation in the endoplasmic reticulum. Cell 1990, 62, 611–614. [Google Scholar] [CrossRef]
- Shamu, C.E.; Cox, J.S.; Walter, P. The unfolded-protein-response pathway in yeast. Trends Cell Biol. 1994, 4, 56–60. [Google Scholar] [CrossRef]
- Hotamisligil, G.S. Inflammation and endoplasmic reticulum stress in obesity and diabetes. Int. J. Obes. 2008, 32, 52. [Google Scholar] [CrossRef] [PubMed]
- Ron, D.; Walter, P. Signal integration in the endoplasmic reticulum unfolded protein response. Nat. Rev. Mol. Cell Biol. 2007, 8, 519–529. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.; Kaufman, R.J. The impact of the unfolded protein response on human disease. J. Cell. Biol. 2012, 197, 857–867. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Meusser, B.; Hirsch, C.; Jarosch, E.; Sommer, T. ERAD: The long road to destruction. Nat. Cell Biol. 2005, 7, 766–772. [Google Scholar] [CrossRef] [PubMed]
- Tanida, I. Autophagosome formation and molecular mechanism of autophagy. Antioxid. Redox. Signal. 2011, 14, 2201–2214. [Google Scholar] [CrossRef]
- Yin, J.J.; Li, Y.B.; Wang, Y.; Liu, G.D.; Wang, J.; Zhu, X.O.; Pan, S.H. The role of autophagy in endoplasmic reticulum stress-induced pancreatic beta cell death. Autophagy 2012, 8, 158–164. [Google Scholar] [CrossRef] [PubMed]
- Su, J.; Zhou, L.; Kong, X.; Yang, X.; Xiang, X.; Zhang, Y.; Li, X.; Sun, L. Endoplasmic reticulum is at the crossroads of autophagy, inflammation, and apoptosis signaling pathways and participates in the pathogenesis of diabetes mellitus. J. Diabetes Res. 2013, 2013, 193461. [Google Scholar] [CrossRef] [PubMed]
- Demirtas, L.; Guclu, A.; Erdur, F.M.; Akbas, E.M.; Ozcicek, A.; Onk, D.; Turkmen, K. Apoptosis, autophagy & endoplasmic reticulum stress in diabetes mellitus. Indian J. Med. Res. 2016, 144, 515–524. [Google Scholar] [CrossRef] [PubMed]
- Cadenas, E.; Davies, K.J. Mitochondrial free radical generation, oxidative stress, and aging. Free Radic. Biol. Med. 2000, 29, 222–230. [Google Scholar] [CrossRef]
- Murphy, M.P. How mitochondria produce reactive oxygen species. Biochem. J. 2009, 417, 1–13. [Google Scholar] [CrossRef]
- Szeto, H.H. First-in-class cardiolipin-protective compound as a therapeutic agent to restore mitochondrial bioenergetics. Br. J. Pharmacol. 2014, 171, 2029–2050. [Google Scholar] [CrossRef] [Green Version]
- Birk, A.V.; Liu, S.; Soong, Y.; Mills, W.; Singh, P.; Warren, J.D.; Seshan, S.V.; Pardee, J.D.; Szeto, H.H. The mitochondrial-targeted compound SS-31 re-energizes ischemic mitochondria by interacting with cardiolipin. J. Am. Soc. Nephrol. 2013, 24, 1250–1261. [Google Scholar] [CrossRef]
- Szeto, H.H.; Liu, S.; Soong, Y.; Wu, D.; Darrah, S.F.; Cheng, F.Y.; Zhao, Z.; Ganger, M.; Tow, C.Y.; Seshan, S.V. Mitochondria-targeted peptide accelerates ATP recovery and reduces ischemic kidney injury. J. Am. Soc. Nephrol. 2011, 22, 1041–1052. [Google Scholar] [CrossRef]
- Zhao, K.; Zhao, G.M.; Wu, D.; Soong, Y.; Birk, A.V.; Schiller, P.W.; Szeto, H.H. Cell-permeable peptide antioxidants targeted to inner mitochondrial membrane inhibit mitochondrial swelling, oxidative cell death, and reperfusion injury. J. Biol. Chem. 2004, 279, 34682–34690. [Google Scholar] [CrossRef]
- Escribano-López, I.; Díaz-Morales, N.; Iannantuoni, F.; López-Domènech, S.; de Marañón, A.M.; Abad-Jiménez, Z.; Bañuls, C.; Rovira-Llopis, S.; Herance, J.R.; Rocha, M.; et al. The mitochondrial antioxidant SS-31 increases Sirt-1 levels and ameliorates inflammation, oxidative stress and leukocyte-endothelium interactions in type 2 diabetes. Sci. Rep. 2018, 8, 15862. [Google Scholar] [CrossRef]
- Pitozzi, V.; Giovanelli, L.; Bardini, G.; Rotella, C.M.; Dolara, P. Oxidative DNA damage in peripheral blood cells in type 2 diabetes mellitus; higher vulnerability of polymorphonuclear leukocytes. Mutat. Res. 2003, 529, 129–133. [Google Scholar] [CrossRef]
- Bir, S.C.; Kevil, C.G. Diabetic neutrophil mitochondrial dysfunction: an inflammatory situation? Free Radic. Biol. Med. 2011, 50, 1213–1214. [Google Scholar] [CrossRef] [PubMed]
- Zozulinska, D.; Wierusz-Wysocka, B. Type 2 diabetes mellitus as inflammatory disease. Diabetes Res. Clin. Pract. 2006, 74, S12–S16. [Google Scholar] [CrossRef]
- Shurtz-Swirski, R.; Sela, S.; Herskovits, A.T.; Shasha, S.M.; Shapiro, G.; Nasser, L.; Kristal, B. Involvement of Peripheral Polymorphonuclear Leukocytes in Oxidative Stress and Inflammation in Type 2 Diabetic Patients. Diabetes Care 2001, 24, 104–110. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pettersson, U.S.; Christoffersson, G.; Massena, S.; Ahl, D.; Jansson, L.; Henriksnäs, J.; Phillipson, M. Increased Recruitment but Impaired Function of Leukocytes during Inflammation in Mouse Models of Type 1 and Type 2 Diabetes. PLoS ONE 2011, 6, e22480. [Google Scholar] [CrossRef] [PubMed]
- Guan, Y.; Zhou, L.; Zhang, Y.; Tian, H.; Li, A.; Han, X. Effects of PP2A/Nrf2 on experimental diabetes mellitus-related cardiomyopathy by regulation of autophagy and apoptosis through ROS dependent pathway. Cell. Signal. 2019, 62, 109339. [Google Scholar] [CrossRef] [PubMed]
- Tampakakis, E.; Tabit, C.E.; Holbrook, M.; Linder, E.A.; Berk, B.D.; Frame, A.A.; Bretón-Romero, R.; Fetterman, J.L.; Gokce, N.; Vita, J.A.; et al. Intravenous lipid infusion induces endoplasmic reticulum stress in endothelial cells and blood mononuclear cells of healthy adults. J. Am. Heart Assoc. 2016, 5, e002574. [Google Scholar] [CrossRef]
- RostamiRad, A.; Ebrahimi, S.S.S.; Sadeghi, A.; Taghikhani, M.; Meshkani, R. Palmitate-induced impairment of autophagy turnover leads to increased apoptosis and inflammation in peripheral blood mononuclear cells. Immunobiology 2018, 223, 269–278. [Google Scholar] [CrossRef]
- Mozzini, C.; Garbin, U.; Stranieri, C.; Pasini, A.; Solani, E.; Tinelli, I.A.; Cominacini, L.; Fratta-Pasini, A.M. Endoplasmic reticulum stress and Nrf2 repression in circulating cells of type 2 diabetic patients without the recommended glycemic goals. Free Radic. Res. 2015, 49, 244–252. [Google Scholar] [CrossRef]
- Rovira-Llopis, S.; Bañuls, C.; Apostolova, N.; Morillas, C.; Hernandez-Mijares, A.; Rocha, M.; Victor, V.M. Is glycemic control modulating endoplasmic reticulum stress in leukocytes of type2 diabetic patients? Antioxid. Redox. Signal. 2014, 21, 1759–1765. [Google Scholar] [CrossRef]
- Szpigel, A.; Hainault, I.; Carlier, A.; Venteclef, N.; Batto, A.F.; Hajduch, E.; Bernard, C.; Ktorza, A.; Gautier, J.F.; Ferré, P.; et al. Lipid environment induces ER stress, TXNIP expression and inflammation in immune cells of individuals with type 2 diabetes. Diabetologia 2018, 61, 399–412. [Google Scholar] [CrossRef] [PubMed]
- Sindhu, S.; Akhter, N.; Kochumon, S.; Thomas, R.; Wilson, A.; Shenouda, S.; Tuomilehto, J.; Ahmad, R. Increased expression of the innate immune receptor TLR10 in obesity and type-2 diabetes: Association with ROS-mediated oxidative stress. Cell. Physiol. Biochem. 2018, 45, 572–590. [Google Scholar] [CrossRef] [PubMed]
- Bañuls, C.; Rovira-Llopis, S.; Lopez-Domenech, S.; Diaz-Morales, N.; Blas-Garcia, A.; Veses, S.; Morillas, C.; Victor, V.M.; Rocha, M.; Hernandez-Mijares, A. Oxidative and endoplasmic reticulum stress is impaired in leukocytes from metabolically unhealthy vs healthy obese individuals. Int. J. Obes. 2017, 41, 1556–1563. [Google Scholar]
- Restaino, R.M.; Deo, S.H.; Parrish, A.R.; Fadel, P.J.; Padilla, J. Increased monocyte-derived reactive oxygen species in type 2 diabetes: Role of endoplasmic reticulum stress. Exp. Physiol. 2017, 102, 139–153. [Google Scholar] [CrossRef] [PubMed]
- Rovira-Llopis, S.; Díaz-Morales, N.; Bañuls, C.; Blas-García, A.; Polo, M.; López-Domenech, S.; Jover, A.; Rocha, M.; Hernández-Mijares, A.; Víctor, V.M. Is Autophagy Altered in the Leukocytes of Type 2 Diabetic Patients? Antioxid. Redox. Signal. 2015, 23, 1050–1056. [Google Scholar] [CrossRef]
- Riek, A.; Oh, J.; Sprague, J.; Timpson, A.; de las Fuentes, L.; Bernal-Mizrachi, L.; Schechtman, K.; Bernal-Mizrachi, C. Vitamin D Suppression of Endoplasmic Reticulum Stress Promotes an Antiatherogenic Monocyte/Macrophage Phenotype in Type 2 Diabetic Patients. J. Biol. Chem. 2012, 287, 38482–38484. [Google Scholar] [CrossRef] [PubMed]
- Lenin, R.; Maria, M.S.; Agrawal, M.; Balasubramanyam, J.; Mohan, V.; Balasubramanyam, M. Amelioration of glucolipotoxicity-induced endoplasmic reticulum stress by a “chemical chaperone” in human THP-1 monocytes. Exp. Diabetes Res. 2012, 356487. [Google Scholar] [CrossRef]
- Mehrzadi, S.; Yousefi, B.; Hosseinzadeh, A.; Reiter, R.J.; Safa, M.; Ghaznavi, H.; Naseripour, M. Diabetic retinopathy pathogenesis and the ameliorating effects of melatonin; involvement of autophagy, inflammation and oxidative stress. Life Sci. 2018, 193, 20–33. [Google Scholar] [CrossRef]
- Diaz-Morales, N.; Iannantuoni, F.; Escribano-Lopez, I.; Bañuls, C.; Rovira-Llopis, S.; Sola, E.; Rocha, M.; Hernandez-Mijares, A.; Victor, V.M. Does Metformin Modulate Endoplasmic Reticulum Stress and Autophagy in Type 2 Diabetic Peripheral Blood Mononuclear Cells? Antioxid. Redox. Signal. 2018, 28, 1562–1569. [Google Scholar] [CrossRef]
- Streitz, M.; Miloud, T.; Kapinsky, M.; Reed, M.R.; Magari, R.; Geissler, E.K.; Hutchinson, J.A.; Vogt, K.; Schickeisler, S.; Kverneland, A.H.; et al. Standarization of whole blood immune phenotype monitoring for clinical trials: Panels and methods for the ONE study. Transplant. Res. 2013, 2, 17. [Google Scholar] [CrossRef]
- Fujimoto, H.; Sakata, T.; Hamaguchi, Y.; Shiga, S.; Tohyama, K.; Ichiyama, S.; Wang, F.S.; Houwen, B. Flow cytometric method for enumeration and classification of reactive immature granulocyte populations. Cytommetry 2000, 42, 371–378. [Google Scholar] [CrossRef]
- Fato, R.; Bergamini, C.; Bortolus, M.; Maniero, A.L.; Leoni, S.; Ohnishi, T.; Lenaz, G. Differential effects of mitochondrial Complex I inhibitors on production of reactive oxygen species. Biochim. Biophys. Acta 2009, 1787, 384–392. [Google Scholar] [CrossRef]
- Lytton, J.; Westlin, M.; Hanley, M.R. Thapsigargin inhibits the sarcoplasmic or endoplasmic reticulum Ca-ATPase family of calcium pumps. J. Biol. Chem. 1991, 266, 17067–17071. [Google Scholar]
- Hou, Y.; Li, S.; Wu, M.; Wei, J.; Ren, Y.; Du, C.; Wu, H.; Han, C.; Duan, H.; Shi, Y. Mitochondria-targeted peptide SS-31 attenuates renal injury via an antioxidant effect in diabetic nephropathy. Am. J. Physiol. Renal Physiol. 2016, 310, 547. [Google Scholar] [CrossRef]
- Zhu, L.L.; Li, M.Q.; He, F.; Zhou, S.B.; Jiang, W. Mitochondria Targeted Peptide Attenuates Mitochondrial Dysfunction, Controls Inflammation and Protects Against Spinal Cord Injury-Induced Lung Injury. Cell. Physiol. Biochem. 2017, 44, 388–400. [Google Scholar] [CrossRef] [PubMed]
- Leahy, J.L. Pathogenesis of type 2 diabetes mellitus. Arch. Med. Res. 2005, 36, 197–209. [Google Scholar]
- Mizukami, H.; Takahashi, K.; Inaba, W.; Tsuboi, K.; Osonoi, S.; Yoshida, T.; Yagihashi, S. Involvement of oxidative stress-induced DNA damage, endoplasmic reticulum stress, and autophagy deficits in the decline of beta-cell mass in Japanese type 2 diabetic patients. Diabetes Care 2014, 37, 1966–1974. [Google Scholar] [CrossRef] [PubMed]
- Lo, M.C.; Chen, M.H.; Lee, W.S.; Lu, C.I.; Chang, C.R.; Kao, S.H.; Lee, H.M. Nepsilon-(carboxymethyl) lysine-induced mitochondrial fission and mitophagy cause decreased insulin secretion from beta-cells. Am. J. Physiol. Endocrinol. Metab. 2015, 309, 829. [Google Scholar] [CrossRef] [PubMed]
- Hernandez-Mijares, A.; Rocha, M.; Rovira-Llopis, S.; Bañuls, C.; Bellod, L.; de Pablo, C.; Alvarez, A.; Roldan-Torres, I.; Sola-Izquierdo, E.; Victor, V.M. Human leukocyte/endothelial cell interactions and mitochondrial dysfunction in type 2 diabetic patients and their association with silent myocardial ischemia. Diabetes Care 2013, 36, 1695–1702. [Google Scholar] [CrossRef] [PubMed]
- Whiteman, M.; Spencer, J.P.; Szeto, H.H.; Armstrong, J.S. Do mitochondriotropic antioxidants prevent chlorinative stress-induced mitochondrial and cellular injury? Antioxid. Redox. Signal. 2008, 10, 641–650. [Google Scholar] [CrossRef] [PubMed]
- Petersen, K.F.; Dufour, S.; Befroy, D.; Garcia, R.; Shulman, G.I. Impaired mitochondrial activity in the insulin-resistant offspring of patients with type 2 diabetes. N. Engl. J. Med. 2004, 350, 664–671. [Google Scholar] [CrossRef] [PubMed]
- Kelley, D.E.; He, J.; Menshikova, E.V.; Ritov, V.B. Dysfunction of mitochondria in human skeletal muscle in type 2 diabetes. Diabetes 2002, 51, 2944–2950. [Google Scholar] [CrossRef] [PubMed]
- Komura, T.; Sakai, Y.; Honda, M.; Takamura, T.; Matsushima, K.; Kaneko, S. CD14+ monocytes are vulnerable and functionally impaired under endoplasmic reticulum stress in patients with type 2 diabetes. Diabetes 2010, 59, 634–643. [Google Scholar] [CrossRef] [PubMed]
- Sage, A.T.; Holtby-Ottenhof, S.; Shi, Y.; Damjanovic, S.; Sharma, A.M.; Werstuck, G.H. Metabolic syndrome and acute hyperglycemia are associated with endoplasmic reticulum stress in human mononuclear cells. Obesity 2012, 20, 748–755. [Google Scholar] [CrossRef] [PubMed]
- Gonzalez, C.D.; Lee, M.S.; Marchetti, P.; Pietropaolo, M.; Towns, R.; Vaccaro, M.I.; Watada, H.; Wiley, J.W. The emerging role of autophagy in the pathophysiology of diabetes mellitus. Autophagy 2011, 7, 2–11. [Google Scholar] [CrossRef] [PubMed]
- Liu, H.; Yin, J.J.; Cao, M.M.; Liu, G.D.; Su, Y.; Li, Y.B. Endoplasmic reticulum stress induced by lipopolysaccharide is involved in the association between inflammation and autophagy in INS1 cells. Mol. Med. Rep. 2017, 16, 5787–5792. [Google Scholar] [CrossRef] [PubMed]
- Dudek, J. Role of Cardiolipin in Mitochodnrial signaling pathways. Front. Cell Dev. Biol. 2017, 5, 90. [Google Scholar] [CrossRef] [PubMed]
- Hwang, M.S.; Schwall, C.T.; Pazarentzos, E.; Datler, C.; Alder, N.N.; Grimm, S. Mitochondrial calcium ibnflux targets cardiolipin to disintegrate respiratory chain complex II for cell death induction. Cell Death Differ. 2014, 21, 1733–1745. [Google Scholar] [CrossRef] [PubMed]
- Paradies, G.; Petrosillo, G.; Paradies, V.; Ruggiero, F.M. Role of cardiolipin peroxidation and calcium in mitochondrial dysfunction and disease. Cell Calcium 2009, 45, 643–650. [Google Scholar] [CrossRef] [PubMed]
- Petrosillo, G.; Ruggiero, F.M.; Pistolese, M.; Paradies, G. Calcium-induced Reactive Oxigen Species production promotes Cytocrome C release from rat liver mitochodnria via Mitochondrial Permeability Transition (MPT)-dependent and MPT-independent mechanisms. J. Biol. Chem. 2004, 279, 53103–53108. [Google Scholar] [CrossRef] [PubMed]
- Martinvalet, D. The role of the mitochondria and the rendoplasmic reticulum contact sites in the development of the immune responses. Cell Death Dis. 2018, 9, 336. [Google Scholar] [CrossRef] [PubMed]
- Prahrtana, J.D.; Sullivan, D.P.; Muller, W.A. Exploring the role of calmodulin and calcium signaling in leukocyte transmigration. FASEB J. 2018, 32, 280. [Google Scholar]
- Pal, S.; Ghosh, M.; Ghosh, S.; Bhattacharyya, S.; Sil, P.C. Atorvastatin induced hepatic oxidative stress and apoptotic damage via MAPKs, mitochondria, calpain and caspase 12 dependent pathways. Food Chem. Toxicol. 2015, 83, 36–47. [Google Scholar] [CrossRef] [PubMed]
- Godoy, J.C.; Niesman, I.R.; Busija, A.R.; Kassan, A.; Schilling, J.M.; Schwarz, A.; Alvarez, E.A.; Dalton, N.D.; Drummond, J.C.; Roth, D.M.; et al. Atorvastatin, but not pravastatin, inhibits cardiac Akt/mTOR signaling and disturbs mitochondrial ultrastructure in cardiac myocytes. FASEB J. 2019, 33, 1209–1225. [Google Scholar] [CrossRef] [PubMed]
- Ghavami, S.; Sharma, P.; Yeganeh, B.; Ojo, O.O.; Jha, A.; Mutawe, M.M.; Kashani, H.H.; Los, M.J.; Klonisch, T.; Unruh, H.; et al. Airway mesenchymal cell death by mevalonate cascade inhibition: Integration of autophagy, unfolded protein response and apoptosis focusing on Bcl2 family proteins. Biochim. Biophys. Acta 2014, 1843, 1259–1271. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Schirris, T.J.; Renkema, G.H.; Ritschel, T.; Voermans, N.C.; Bilos, A.; van Engelen, B.G.; Brandt, U.; Koopman, W.J.; Beyrath, J.D.; Rodenburg, R.J.; et al. Statin-Induced Myopathy Is Associated with Mitochondrial Complex III Inhibition. Cell Metab. 2015, 22, 399–407. [Google Scholar] [CrossRef] [Green Version]
- Costa, S.; Reina-Couto, M.; Albino-Teixeira, A.; Sousa, T. Statins and oxidative stress in chronic heart failure. Rev. Port. Cardiol. 2016, 35, 41–57. [Google Scholar] [CrossRef] [PubMed]
- Escudero, P.; Martinez de Marañón, A.; Collado, A.; Gonzalez-Navarro, H.; Hermenegildo, C.; Peiró, C.; Piqueras, L.; Sanz, M.J. Combined sub-optimal doses of rosuvastatin and bexarotene impair angiotensin II-induced arterial mononuclear cell adhesion through inhibition of Nox5 signaling pathways and increased RXR/PPARα and RXR/PPARγ interactions. Antiox. Redox. Sign. 2015, 22, 901–920. [Google Scholar] [CrossRef]
- Whitehead, N.P. Enhanced autophagy as a potential mechanism for the improved physiological function by simvastatin in muscular dystrophy. Autophagy 2016, 12, 705–706. [Google Scholar] [CrossRef] [Green Version]
- Chen, Y.H.; Chen, Y.C.; Liu, C.S.; Hsieh, M.C. The Different Effects of Atorvastatin and Pravastatin on Cell Death and PARP Activity in Pancreatic NIT-1 Cells. J. Diabetes Res. 2016, 1828071. [Google Scholar] [CrossRef]
- Zhang, T.; Lu, D.; Yang, W.; Shi, C.; Zang, J.; Shen, L.; Mai, H.; Xu, A. HMG-CoA Reductase Inhibitors Relieve Endoplasmic Reticulum Stress by Autophagy Inhibition in Rats With Permanent Brain Ischemia. Front. Neurosci. 2018, 12, 405. [Google Scholar] [CrossRef] [PubMed]
- Xu, J.Z.; Chai, Y.L.; Zhang, Y.L. Effect of rosuvastatin on high glucose-induced endoplasmic reticulum stress in human umbilical vein endothelial cells. Genet. Mol. Res. 2016, 15. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Lu, G.; Sun, D.; Zuo, H.; Wang, D.W.; Yan, J. Inhibition of endoplasmic reticulum stress signaling pathway: A new mechanism of statins to suppress the development of abdominal aortic aneurysm. PloS ONE 2017, 12, e0174821. [Google Scholar] [CrossRef] [PubMed]
- Kojanian, H.; Szafran-Swietlik, A.; Onstead-Haas, L.M.; Haas, M.J.; Mooradian, A.D. Statins prevent dextrose-induced endoplasmic reticulum stress and oxidative stress in endothelial and HepG2 cells. Am. J. Ther. 2016, 23, e1456–e1463. [Google Scholar] [CrossRef] [PubMed]
- Wu, Z.H.; Chen, Y.Q.; Zhao, S.P. Simvastatin inhibits ox-LDL-induced inflammatory adipokines secretion via amelioration of ER stress in 3T3-L1 adipocyte. Biochem. Biophys. Res. Commun. 2013, 432, 365–369. [Google Scholar] [CrossRef] [PubMed]
- Li, L.; Wang, Y.; Xu, Y.; Chen, L.; Fang, Q.; Yan, X. Atorvastatin inhibits CD68 expression in aortic root through a GRP78-involved pathway. Cardiovasc. Drugs Ther. 2014, 28, 523–532. [Google Scholar] [CrossRef] [PubMed]
- Alaarg, A.; Zheng, K.H.; van der Valk, F.M.; da Silva, A.E.; Versloot, M.; van Ufford, L.C.; Schulte, D.M.; Storm, G.; Metselaar, J.M.; Stroes, E.S.; et al. Multiple pathway assessment to predict anti-atherogenic efficacy of drugs targeting macrophages in atherosclerotic plaques. Vascul. Pharmacol. 2016, 82, 51–59. [Google Scholar] [CrossRef] [PubMed]
- Szeto, H.H.; Schiller, P.W. Novel therapies targeting inner mitochondrial membrane—From discovery to clinical development. Pharm. Res. 2011, 28, 2669–2679. [Google Scholar] [CrossRef] [PubMed]
- Szeto, H.H. Cell-permeable, mitochondrial-targeted, peptide antioxidants. AAPS J. 2006, 8, 277. [Google Scholar] [CrossRef]
- Kelso, G.F.; Porteous, C.M.; Coulter, C.V.; Hughes, G.; Porteous, W.K.; Ledgerwood, E.C.; Smith, R.A.; Murphy, M.P. Selective targeting of a redox-active ubiquinone to mitochondria within cells: Antioxidant and antiapoptotic properties. J. Biol. Chem. 2001, 276, 4588–4596. [Google Scholar] [CrossRef]
qRT-PCR Protocol | ||||
Temperature | 95 °C | 95 °C | 60 °C | Melting |
Time | 10 min | 10 s | 30 s | Curve |
No. of Cycles | 1 | 40 | ||
Primers | ||||
Target | Direction | Sequence (5′–3′) | ||
BECN1 | Forward | CCCCAGAACAGTATAACGGCA | ||
Reverse | AGACTGTGTTGCTGCTCCAT | |||
GRP78 | Forward | AAGAACCAGCTCACCTCCAACCC | ||
Reverse | TTCAACCACCTTGAACGGCAA | |||
DDIT3/CHOP | Forward | AGAACCAGGAAACGGAAACAGA | ||
Reverse | TCTCCTTCATGCGCTGCTTT | |||
GAPDH | Forward | CGCATCTTCTTTTGCGTCG | ||
Reverse | TTGAGGTCAATGAAGGGGTCA | |||
SQSTM/P62 | Forward | GATTCGCCGCTTCAGCTTCTG | ||
Reverse | CTGGAAAAGGCAACCAAGTCC |
Control | Type 2 Diabetes | p-Value | BMI-Adjusted p-Value | |
---|---|---|---|---|
N | 53 | 61 | - | - |
Male (%) | 47.2 | 52.5 | ns | ns |
Age (years) | 51.7 ± 9.3 | 55.1 ± 10.2 | ns | ns |
Weight (Kg) | 72.9 ± 18.8 | 85.6 ± 15.5 | p < 0.001 | p < 0.001 |
BMI (kg/m2) | 25.8 ± 5.4 | 31.4 ± 5.6 | p < 0.001 | - |
Waist circumference (cm) | 85.8 ± 13.2 | 104.0 ± 11.9 | p < 0.001 | p < 0.01 |
SBP (mmHg) | 23.3 ± 19.7 | 145.8 ± 14.8 | p < 0.001 | p < 0.001 |
DBP (mmHg) | 73.6 ± 10.9 | 74.2 ± 25.6 | ns | ns |
Glucose (mg/dL) | 95.6 ± 13.6 | 154.0 ± 49.8 | p < 0.001 | p < 0.001 |
Insulin (µUI/mL) | 7.56 ± 3.55 | 16.27 ± 9.09 | p < 0.001 | p < 0.01 |
HOMA-IR | 1.71 ± 0.95 | 6.23 ± 4.64 | p < 0.001 | p < 0.001 |
HbA1c (%) | 5.32 ± 0.36 | 7.42 ± 1.57 | p < 0.001 | p < 0.001 |
Total cholesterol (mg/dL) | 198.8 ± 35.5 | 168.0 ± 37.7 | p < 0.001 | p < 0.001 |
HDL-c (mg/dL) | 57.3 ± 19.9 | 43.1 ± 9.2 | p < 0.001 | p < 0.001 |
LDL-c (mg/dL) | 122.1 ± 28.9 | 93.7 ± 30.6 | p < 0.001 | p < 0.001 |
Triglycerides (mg/dL) | 93.0 (26.5–150.5) | 133.0 (94.0–170.0) | p < 0.01 | p < 0.01 |
hs-CRP (mg/L) | 1.17 (0.46–2.40) | 2.92 (1.88–6.39) | p < 0.001 | p < 0.001 |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Escribano-López, I.; de Marañon, A.M.; Iannantuoni, F.; López-Domènech, S.; Abad-Jiménez, Z.; Díaz, P.; Solá, E.; Apostolova, N.; Rocha, M.; Víctor, V.M. The Mitochondrial Antioxidant SS-31 Modulates Oxidative Stress, Endoplasmic Reticulum Stress, and Autophagy in Type 2 Diabetes. J. Clin. Med. 2019, 8, 1322. https://doi.org/10.3390/jcm8091322
Escribano-López I, de Marañon AM, Iannantuoni F, López-Domènech S, Abad-Jiménez Z, Díaz P, Solá E, Apostolova N, Rocha M, Víctor VM. The Mitochondrial Antioxidant SS-31 Modulates Oxidative Stress, Endoplasmic Reticulum Stress, and Autophagy in Type 2 Diabetes. Journal of Clinical Medicine. 2019; 8(9):1322. https://doi.org/10.3390/jcm8091322
Chicago/Turabian StyleEscribano-López, Irene, Aranzazu M de Marañon, Francesca Iannantuoni, Sandra López-Domènech, Zaida Abad-Jiménez, Pedro Díaz, Eva Solá, Nadezda Apostolova, Milagros Rocha, and Víctor M Víctor. 2019. "The Mitochondrial Antioxidant SS-31 Modulates Oxidative Stress, Endoplasmic Reticulum Stress, and Autophagy in Type 2 Diabetes" Journal of Clinical Medicine 8, no. 9: 1322. https://doi.org/10.3390/jcm8091322
APA StyleEscribano-López, I., de Marañon, A. M., Iannantuoni, F., López-Domènech, S., Abad-Jiménez, Z., Díaz, P., Solá, E., Apostolova, N., Rocha, M., & Víctor, V. M. (2019). The Mitochondrial Antioxidant SS-31 Modulates Oxidative Stress, Endoplasmic Reticulum Stress, and Autophagy in Type 2 Diabetes. Journal of Clinical Medicine, 8(9), 1322. https://doi.org/10.3390/jcm8091322