Association of CTLA4 Gene Polymorphism with Transfusion Reaction after Infusion of Leukoreduced Blood Component
Abstract
1. Introduction
2. Experimental Section
2.1. Study Subjects
2.2. DNA Extraction
2.3. PCR Amplification
2.4. Purifying and SNPs Analysis
2.5. Statistical Analysis
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Tsai, A.G.; Hofmann, A.; Cabrales, P.; Intaglietta, M. Perfusion vs. oxygen delivery in transfusion with “fresh” and “old” red blood cells: The experimental evidence. Transfus. Apher. Sci. 2010, 43, 69–78. [Google Scholar] [CrossRef] [PubMed]
 - Suddock, J.T.; Crookston, K.P. Transfusion Reactions. StatPearls [Internet]. 2019. Available online: https://www.ncbi.nlm.nih.gov/books/NBK482202/ (accessed on 23 July 2019).
 - Sahu, S.; Hemlata, A.V. Adverse events related to blood transfusion. Indian J. Anaesth. 2014, 58, 543–551. [Google Scholar] [CrossRef] [PubMed]
 - Popovsky, M.A. Transfusion Reactions, 4th ed.; AABB: Bethesda, MD, USA, 2012. [Google Scholar]
 - Heddle, N.M.; Klama, L.; Singer, J.; Richards, C.; Fedak, P.; Walker, I.; Kelton, J.G. The role of the plasma from platelet concentrates in transfusion reactions. N. Eng. J. Med. 1994, 331, 625–628. [Google Scholar] [CrossRef] [PubMed]
 - Brown, C.J.; Navarrete, C.V. Clinical relevance of the HLA system in blood transfusion. Vox Sang. 2011, 101, 93–105. [Google Scholar] [CrossRef] [PubMed]
 - Ortolano, G.A.; Russell, R.L.; Angelbeck, J.A.; Schaffer, J.; Wenz, B. Contamination control in nursing with filtration: Part 2: Emerging rationale for bedside (final) filtration of prestorage leukocyte-reduced blood products. J. Infus. Nurs. 2004, 27, 157–165. [Google Scholar] [CrossRef]
 - Mempel, W.; Böck, M. Substitution of thrombocyte concentrates in polytransfused patients. Beitr. Infusionsther. 1993, 31, 81–85. [Google Scholar]
 - Lichtiger, B.; Leparc, G.F. Leukocyte-poor blood components: Issues and indications. Crit. Rev. Clin. Lab. Sci. 1991, 28, 387–403. [Google Scholar] [CrossRef]
 - Chang, C.C.; Lee, T.C.; Su, M.J.; Lin, H.C.; Cheng, F.Y.; Chen, Y.T.; Yen, T.H.; Chu, F.Y. Transfusion-associated adverse reactions (TAARs) and cytokine accumulations in the stored blood components: The impact of prestorage versus poststorage leukoreduction. Oncotarget 2018, 9, 4385–4394. [Google Scholar] [CrossRef]
 - van de Watering, L.M.; Hermans, J.; Houbiers, J.G.; van den Broek, P.J.; Bouter, H.; Boer, F.; Harvey, M.S.; Huysmans, H.A.; Brand, A. Beneficial effects of leukocyte depletion of transfused blood on postoperative complications in patients undergoing cardiac surgery: A randomized clinical trial. Circulation 1998, 97, 562–568. [Google Scholar] [CrossRef]
 - Rajesh, K.; Harsh, S.; Amarjit, K. Effects of Prestorage Leukoreduction on the Rate of Febrile Nonhemolytic Transfusion Reactions to Red Blood Cells in a Tertiary Care Hospital. Ann. Med. Health Sci. Res. 2015, 5, 185–188. [Google Scholar] [CrossRef]
 - Chen, D.P.; Wen, Y.H.; Lu, J.J.; Tseng, C.P.; Chen, W.L.; Chang, S.W. Human platelet antigens are associated with febrile non-hemolytic transfusion reactions. Clin. Chim. Acta 2017, 474, 120–123. [Google Scholar] [CrossRef] [PubMed]
 - Hawley, R.G.; Ramezani, A.; Hawley, T.S. Hematopoietic Stem Cells. Methods Enzym. 2006, 419, 149–179. [Google Scholar]
 - Li, X.C.; Rothstein, D.M.; Sayegh, M.H. Costimulatory pathways in transplantation: Challenges and new developments. Immunol. Rev. 2009, 229, 271–293. [Google Scholar] [CrossRef] [PubMed]
 - Iravani-Saadi, M.; Karimi, M.H.; Yaghobi, R.; Geramizadeh, B.; Ramzi, M.; Niknam, A.; Pourfathollah, A. Polymorphism of costimulatory molecules (CTLA4, ICOS, PD.1 and CD28) and allogeneic hematopoietic stem cell transplantation in Iranian patients. Immunol. Investig. 2014, 43, 391–404. [Google Scholar] [CrossRef]
 - Wu, J.; Tang, J.L.; Wu, S.J.; Lio, H.Y.; Yang, Y.C. Functional polymorphism of CTLA-4 and ICOS genes in allogeneic hematopoietic stem cell transplantation. Clin. Chim. Acta 2009, 403, 229–233. [Google Scholar] [CrossRef]
 - Sellami, M.H.; Bani, M.; Torjemane, L.; Kaabi, H.; Ladeb, S.; Othmane, T.B.; Hmida, S. Effect of donor CTLA-4 alleles and haplotypes on graft-versus-host disease occurrence in Tunisian patients receiving a human leukocyte antigen-identical sibling hematopoietic stem cell transplant. Hum. Immunol. 2011, 72, 139–143. [Google Scholar] [CrossRef]
 - Bosch-Vizcaya, A.; Pérez-García, A.; Brunet, S.; Solano, C.; Buño, I.; Guillem, V.; Martínez-Laperche, C.; Sanz, G.; Barrenetxea, C.; Martínez, C.; et al. Donor CTLA-4 Genotype Influences Clinical Outcome after T Cell-Depleted Allogeneic Hematopoietic Stem Cell Transplantation from HLA-Identical Sibling Donors. Biol. Blood Marrow Transplant. 2011, 18, 100–105. [Google Scholar] [CrossRef]
 - Vannucchi, A.M.; Guidi, S.; Guglielmelli, P.; Glinz, S.; Lombardini, L.; Busca, A.; Locatelli, F.; Dall’Omo, A.M.; Bosi, A. Significance of CTLA-4 and CD14 genetic polymorphisms in clinical outcome after allogeneic stem cell transplantation. Bone Marrow Transplant. 2007, 40, 1001–1002. [Google Scholar] [CrossRef]
 - Pérez-García, A.; De la Cámara, R.; Román-Gómez, J.; Jiménez-Velasco, A.; Encuentra, M.; Nieto, J.B.; de la Rubia, J.; Urbano-Ispizúa, A.; Brunet, S.; Iriondo, A.; et al. CTLA-4 polymorphisms and clinical outcome after allogeneic stem cell transplantation from HLA identical sibling donors. Blood J. Am. Soc. Hematol. 2007, 110, 461–467. [Google Scholar]
 - Azarian, M.; Busson, M.; Lepage, V.; Charron, D.; Toubert, A.; Loiseau, P.; de Latour, R.P.; Rocha, V.; Socié, G. Donor CTLA-4 +49 A/G*GG genotype is associated with chronic GVHD after HLA-identical haematopoietic stem-cell transplantations. Blood 2007, 11, 4623–4624. [Google Scholar] [CrossRef]
 - NHSN Manual: Biovigilance Component Protocol [Internet]. April 2018. Available online: https://www.cdc.gov/nhsn/pdfs/biovigilance/bv-hv-protocol-current.pdf (accessed on 2 August 2019).
 - Teft, W.A.; Kirchhof, M.G.; Madrenas, J. A molecular perspective of CTLA-4 function. Annu. Rev. Immunol. 2006, 24, 65–97. [Google Scholar] [CrossRef] [PubMed]
 - Mikhaylichenko, O.; Bondarenko, V.; Harnett, D.; Schor, I.E.; Males, M.; Viales, R.R.; Furlong, E.E. The degree of enhancer or promoter activity is reflected by the levels and directionality of eRNA transcription. Genes Dev. 2018, 32, 42–57. [Google Scholar] [CrossRef] [PubMed]
 - Kolar, P.; Knieke, K.; Hegel, J.K.E.; Quandt, D.; Burmester, G.R.; Hoff, H.; Brunner-Weinzierl, M.C. CTLA-4 (CD152) controls homeostasis and suppressive capacity of regulatory T cells in mice. Arthritis Rheum. 2009, 60, 123–132. [Google Scholar] [CrossRef] [PubMed]
 - Wang, X.B.; Pirskanen, R.; Giscombe, R.; Lefvert, A.K. Two SNPs in the promoter region of the CTLA-4 gene affect binding of transcription factors and are associated with human myasthenia gravis. J. Intern. Med. 2008, 263, 61–69. [Google Scholar] [CrossRef]
 - Ligers, A.; Teleshova, N.; Masterman, T.; Huang, W.X.; Hillert, J. CTLA-4 gene expression is influenced by promoter and exon 1 polymorphisms. Genes Immun. 2001, 2, 145–152. [Google Scholar] [CrossRef]
 - Pawlak-Adamska, E.; Frydecka, I.; Bolanowski, M.; Tomkiewicz, A.; Jonkisz, A.; Karabon, L.; Partyka, A.; Nowak, O.; Szalinski, M.; Daroszewski, J. CD28/CTLA-4/ICOS haplotypes confers susceptibility to Graves’ disease and modulates clinical phenotype of disease. Endocrine 2017, 55, 186–199. [Google Scholar] [CrossRef]
 - Guo, Y.; Gao, J.; Gao, S.; Shang, M.; Guo, F. Effect of CTLA-4 gene polymorphisms on long-term kidney allograft function in Han Chinese recipients. Oncotarget 2016, 26, 23088–23095. [Google Scholar] [CrossRef]
 - Guo, Y.; Guo, F.; Wei, C.; Qiu, J.; Liu, Y.; Fang, Y.; Gao, J. CTLA4 gene polymorphisms influence the incidence of infection after renal transplantation in Chinese recipients. PLoS ONE 2013, 8, e70824. [Google Scholar] [CrossRef]
 - Fang, M.; Huang, W.; Mo, D.; Zhao, W.; Huang, R. Association of Five Snps in Cytotoxic T-Lymphocyte Antigen 4 and Cancer Susceptibility: Evidence from 67 Studies. Cell. Physiol. Biochem. 2018, 47, 414–427. [Google Scholar] [CrossRef]
 - Zou, C.; Qiu, H.; Tang, W.; Wang, Y.; Lan, B.; Chen, Y. CTLA4 tagging polymorphisms and risk of colorectal cancer: A case–control study involving 2,306 subjects. Onco Targets Ther. 2018, 11, 4609–4619. [Google Scholar] [CrossRef]
 - Tang, W.; Wang, Y.; Chen, S.; Lin, J.; Chen, B.; Yu, S.; Chen, Y.; Gu, H.; Kang, M. Investigation of Cytotoxic T-lymphocyte antigen 4 Polymorphisms in Gastric Cardia Adenocarcinoma. Scand. J. Immunol. 2016, 83, 212–218. [Google Scholar]
 - Yao, L.; Liu, B.; Jiang, L.; Zhou, L.; Liu, X. Association of cytotoxic T-lymphocyte antigen 4 gene with immune thrombocytopenia in Chinese Han children. Hematology 2019, 24, 123–128. [Google Scholar] [CrossRef] [PubMed]
 - Schubert, D.; Bode, C.; Kenefeck, R.; Hou, T.Z.; Wing, J.B.; Kennedy, A.; Bulashevska, A.; Petersen, B.S.; Schäffer, A.A.; Grüning, B.A.; et al. Autosomal dominant immune dysregulation syndrome in humans with CTLA4 mutations. Nat. Med. 2014, 20, 1410–1416. [Google Scholar] [CrossRef] [PubMed]
 - Hammrich, J.; Wittig, S.; Ernst, T.; Gruhn, B. CTLA-4 polymorphisms: Influence on transplant-related mortality and survival in children undergoing allogeneic hematopoietic stem cell transplantation. J. Cancer Res. Clin. Oncol. 2018, 144, 587–592. [Google Scholar] [CrossRef]
 - Mayr, C. What Are 3′ UTRs Doing? Cold Spring Harb. Perspect. Biol. 2018, 11, a034728. [Google Scholar] [CrossRef]
 
| Primers | Sequence | 
|---|---|
| pF | 5′ GGCAACAGAGACCCCACCGTT 3′ | 
| pR | 5′ GAGGACCTTCCTTAAATCTGGAGAG 3′ | 
| E1F | 5′ CTCTCCAGATTTAAGGAAGGTCCTC 3′ | 
| E1R | 5′ GGAATACAGAGCCAGCCAAGCC 3′ | 
| Patients, No. (%) | Controls, No. (%) | |
|---|---|---|
| Median age of patients | 51 (range, 2–88 years old) | 22.8 (range, 22–24 years old) | 
| Gender | ||
| Male | 4 (21) | 5 (20) | 
| Female | 15 (79) | 15 (80) | 
| Type of blood transfusion | ||
| Leukocyte-poor platelet | 10 (53) | |
| Leukocyte-poor RBC | 9 (47) | |
| Type of transfusion-associated adverse reactions | ||
| Allergic reaction | 4 (21) | |
| Febrile non-hemolytic transfusion reaction | 15 (79) | 
| SNP | Position | Allele | Minor Allele Frequency | HWE p Value | Odds Ratio | p Value | |
|---|---|---|---|---|---|---|---|
| Patient | Control | (95%CI) | |||||
| rs11571315 | 203866178 | C/T | 0.211 | 0.300 | 0.696 | 1.607 (0.572–4.512) | 0.366 | 
| rs733618 | 203866221 | T/C | 0.474 | 0.475 | 0.900 | 1.228 (0.505–2.988) | 0.651 | 
| rs4553808 | 203866282 | A/G | 0 | 0.150 | 0.732 | 2.118 (1.659–2.703) | 0.026 * | 
| rs11571316 | 203866366 | A/G | 0.211 | 0.150 | 0.628 | 1.511 (0.470–4.853) | 0.486 | 
| rs62182595 | 203866465 | A/G | 0 | 0.150 | 0.732 | 2.118 (1.659–2.703) | 0.026 * | 
| rs16840252 | 203866796 | C/T | 0 | 0.175 | 0.638 | 2.152 (1.676–2.762) | 0.012 * | 
| rs5742909 | 203867624 | C/T | 0 | 0.150 | 0.732 | 2.118 (1.659–2.703) | 0.026 * | 
| rs231775 | 203867991 | A/G | 0.263 | 0.300 | 0.696 | 1.200 (0.446–3.227) | 0.718 | 
| SNP | Genotype | Genotype Frequency | Odds Ratio | p Value | |
|---|---|---|---|---|---|
| Patient (n) | Control (n) | (95%CI) | |||
| rs11571315 | CC | 3 | 1 | 3.563 (0.337–37.687) | 0.342 | 
| CT | 2 | 10 | 0.118 (0.021–0.649) | 0.008 * | |
| TT | 14 | 9 | 3.422 (0.888–13.183) | 0.069 | |
| rs733618 | CC | 6 | 4 | 1.846 (0.428–7.962) | 0.480 | 
| CT | 8 | 11 | 0.595 (0.168–2.113) | 0.421 | |
| TT | 5 | 5 | 1.071 (0.254–4.512) | 1 | |
| rs4553808 | AA | 19 | 14 | 2.357(1.584–3.508) | 0.020 * | 
| AG | 0 | 6 | 0.424(0.285–0.631) | 0.020 * | |
| GG | 0 | 0 | NA | NA | |
| rs11571316 | GG | 14 | 15 | 0.933 (0.222–3.930) | 0.342 | 
| AG | 2 | 4 | 0.471 (0.086–2.932) | 1 | |
| AA | 3 | 1 | 3.563 (0.337–37.687) | 0.648 | |
| rs62182595 | GG | 19 | 14 | 2.357 (1.584–3.508) | 0.020 * | 
| AG | 0 | 6 | 0.424 (0.285–0.631) | 0.020 * | |
| AA | 0 | 0 | NA | NA | |
| rs16840252 | CC | 19 | 13 | 2.462 (1.619–3.742) | 0.008 * | 
| CT | 0 | 7 | 0.406 (0.267–0.618) | 0.008 * | |
| TT | 0 | 0 | NA | NA | |
| rs5742909 | CC | 19 | 14 | 2.357 (1.584–3.508) | 0.020 * | 
| CT | 0 | 6 | 0.424 (0.25–0.631) | 0.020 * | |
| TT | 0 | 0 | NA | NA | |
| rs231775 | GG | 12 | 9 | 2.095 (0.581–7.555) | 0.256 | 
| AG | 4 | 10 | 0.267 (0.065–1.091) | 0.062 | |
| AA | 3 | 1 | 3.563 (0.337–37.687) | 0.342 | |
| SNP | Clinical Condition | Reference | 
|---|---|---|
| rs5742909 | Grave’s disease | [29] | 
| long-term kidney allograft function | [30] | |
| cancer predisposition | [32] | |
| rs4553808 | viral infection in kidney transplantation | [31] | 
| long-term kidney allograft function | [30] | |
| cancer predisposition | [32] | |
| rs16840252 | colorectal cancer | [33] | 
| gastric adenocarcinoma | [34] | |
| rs11571315 | immune thrombocytopenia | [35] | 
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wen, Y.-H.; Lin, W.-T.; Wang, W.-T.; Chiueh, T.-S.; Chen, D.-P. Association of CTLA4 Gene Polymorphism with Transfusion Reaction after Infusion of Leukoreduced Blood Component. J. Clin. Med. 2019, 8, 1961. https://doi.org/10.3390/jcm8111961
Wen Y-H, Lin W-T, Wang W-T, Chiueh T-S, Chen D-P. Association of CTLA4 Gene Polymorphism with Transfusion Reaction after Infusion of Leukoreduced Blood Component. Journal of Clinical Medicine. 2019; 8(11):1961. https://doi.org/10.3390/jcm8111961
Chicago/Turabian StyleWen, Ying-Hao, Wei-Tzu Lin, Wei-Ting Wang, Tzong-Shi Chiueh, and Ding-Ping Chen. 2019. "Association of CTLA4 Gene Polymorphism with Transfusion Reaction after Infusion of Leukoreduced Blood Component" Journal of Clinical Medicine 8, no. 11: 1961. https://doi.org/10.3390/jcm8111961
APA StyleWen, Y.-H., Lin, W.-T., Wang, W.-T., Chiueh, T.-S., & Chen, D.-P. (2019). Association of CTLA4 Gene Polymorphism with Transfusion Reaction after Infusion of Leukoreduced Blood Component. Journal of Clinical Medicine, 8(11), 1961. https://doi.org/10.3390/jcm8111961
        