DNA Methyltransferase Expression (DNMT1, DNMT3a, and DNMT3b) as a Potential Biomarker in Age-Related Macular Degeneration
Abstract
:1. Introduction
2. Materials and Methods
2.1. Study Design and Setting
2.2. Patient Recruitment and Classification
2.3. Sample Collection and Epigenetic Profile
2.4. Workflow Overview
2.5. Statistical Analysis
3. Results
4. Discussion
4.1. DNA Methyltransferase Expression in Patients with Early/Intermediate AMD vs. Late AMD
4.2. DNA Methyltransferase Expression Across Different AMD Stages
4.3. Biological Significance of Differential DNMT Expression and Clinical Implications
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Wong, W.L.; Su, X.; Li, X.; Cheung, C.M.G.; Klein, R.; Cheng, C.Y.; Wong, T.Y. Global prevalence of age-related macular degeneration and disease burden projection for 2020 and 2040: A systematic review and meta-analysis. Lancet Glob. Health 2014, 2, e106-16. [Google Scholar] [CrossRef] [PubMed]
- Sitnilska, V.; Enders, P.; Cursiefen, C.; Fauser, S.; Altay, L. Association of imaging biomarkers and local activation of complement in aqueous humor of patients with early forms of age-related macular degeneration. Graefe’s Arch. Clin. Exp. Ophthalmol. 2021, 259, 623–632. [Google Scholar] [CrossRef] [PubMed]
- Corradetti, G.; Corvi, F.; Nittala, M.G.; Nassisi, M.; Alagorie, A.R.; Scharf, J.; Lee, M.Y.; Sadda, S.R.; Sarraf, D. Natural history of incomplete retinal pigment epithelial and outer retinal atrophy in age-related macular degeneration. Can. J. Ophthalmol. 2021, 56, 325–334. [Google Scholar] [CrossRef]
- More, P.; Almuhtaseb, H.; Smith, D.; Fraser, S.; Lotery, A.J. Socio-economic status and outcomes for patients with age-related macular degeneration. Eye 2019, 33, 1224–1231. [Google Scholar] [CrossRef]
- Thiele, S.; Nadal, J.; Pfau, M.; Saßmannshausen, M.; von der Emde, L.; Fleckenstein, M.; Holz, F.G.; Schmid, M.; Schmitz-Valckenberg, S. Prognostic Value of Retinal Layers in Comparison with Other Risk Factors for Conversion of Intermediate Age-related Macular Degeneration. Ophthalmol. Retin. 2020, 4, 31–40. [Google Scholar] [CrossRef]
- Coscas, F.; Lupidi, M.; Boulet, J.F.; Sellam, A.; Cabral, D.; Serra, R.; Français, C.; Souied, E.H.; Coscas, G. Optical coherence tomography angiography in exudative age-related macular degeneration: A predictive model for treatment decisions. Br. J. Ophthalmol. 2019, 103, 1342–1356. [Google Scholar] [CrossRef]
- Khachigian, L.M.; Liew, G.; Teo, K.Y.C.; Wong, T.Y.; Mitchell, P. Emerging therapeutic strategies for unmet need in neovascular age-related macular degeneration. J. Transl. Med. 2023, 21, 133. [Google Scholar] [CrossRef]
- Waldstein, S.M.; Vogl, W.D.; Bogunovic, H.; Sadeghipour, A.; Riedl, S.; Schmidt-Erfurth, U. Characterization of Drusen and Hyperreflective Foci as Biomarkers for Disease Progression in Age-Related Macular Degeneration Using Artificial Intelligence in Optical Coherence Tomography. JAMA Ophthalmol. 2020, 138, 740–747. [Google Scholar] [CrossRef]
- Camacho, P.; Dutra-Medeiros, M.; Cabral, D.; Silva, R. Outer Retina and Choroidal Thickness in Intermediate Age-Related Macular Degeneration: Reticular Pseudodrusen Findings. Ophthalmic. Res. 2018, 59, 212–220. [Google Scholar] [CrossRef]
- Cabral, D.; Fradinho, A.C.; Zhang, Y.; Zhou, H.; Ramtohul, P.; Ramakrishnan, M.S.; Pereira, T.; Wang, R.K.; Freund, K.B. Quantitative assessment of choriocapillaris flow deficits and type 1 macular neovascularization growth in age-related macular degeneration. Sci. Rep. 2023, 13, 8572. [Google Scholar] [CrossRef]
- Al-Sheikh, M.; Iafe, N.A.; Phasukkijwatana, N.; Sadda, S.R.; Sarraf, D. Biomarkers of Neovascular Activity in Age-Related Macular Degeneration Using Optical Coherence Tomography Angiography. Retina 2018, 38, 220–230. [Google Scholar] [CrossRef] [PubMed]
- Bui, P.T.A.; Reiter, G.S.; Fabianska, M.; Waldstein, S.M.; Grechenig, C.; Bogunovic, H.; Arikan, M.; Schmidt-Erfurth, U. Fundus autofluorescence and optical coherence tomography biomarkers associated with the progression of geographic atrophy secondary to age-related macular degeneration. Eye 2021, 36, 2013–2019. [Google Scholar] [CrossRef] [PubMed]
- Van Leeuwen, E.M.; Emri, E.; Merle, B.M.J.; Colijn, J.M.; Kersten, E.; Cougnard-Gregoire, A.; Dammeier, S.; Meester-Smoor, M.; Pool, F.M.; de Jong, E.K.; et al. A new perspective on lipid research in age-related macular degeneration. Prog. Retin. Eye Res. 2018, 67, 56–86. [Google Scholar] [CrossRef]
- Kersten, E.; Paun, C.C.; Schellevis, R.L.; Hoyng, C.B.; Delcourt, C.; Lengyel, I.; Peto, T.; Ueffing, M.; Klaver, C.C.; Dammeier, S.; et al. Systemic and ocular fluid compounds as potential biomarkers in age-related macular degeneration. Surv. Ophthalmol. 2018, 63, 9–39. [Google Scholar] [CrossRef]
- Riaz, N.; Wolden, S.L.; Gelblum, D.Y.; Eric, J. A large genome-wide association study of age-related macular degeneration highlights contributions of rare and common variants. Nat. Genet. 2016, 118, 6072–6078. [Google Scholar]
- Acar, İ.E.; Lores-Motta, L.; Colijn, J.M.; Meester-Smoor, M.A.; Verzijden, T.; Cougnard-Gregoire, A.; Ajana, S.; Merle, B.M.J.; de Breuk, A.; Heesterbeek, T.J.; et al. Integrating Metabolomics, Genomics, and Disease Pathways in Age-Related Macular Degeneration: The EYE-RISK Consortium. Ophthalmology 2020, 127, 1693–1709. [Google Scholar] [CrossRef]
- Chao de la Barca, J.M.; Rondet-Courbis, B.; Ferré, M.; Muller, J.; Buisset, A.; Leruez, S.; Plubeau, G.; Macé, T.; Moureauzeau, L.; Chupin, S.; et al. A Plasma Metabolomic Profiling of Exudative Age-Related Macular Degeneration Showing Carnosine and Mitochondrial Deficiencies. J. Clin. Med. 2020, 9, 631. [Google Scholar] [CrossRef]
- Fritsche, L.G.; Fariss, R.N.; Stambolian, D.; Abecasis, G.R.; Curcio, C.A.; Swaroop, A. Age-Related Macular Degeneration: Genetics and Biology Coming Together. Annu. Rev. Genom. Human Genet. 2014, 15, 151–171. [Google Scholar] [CrossRef]
- Booth, L.N.; Brunet, A. The Aging Epigenome. Mol. Cell 2016, 62, 728–744. [Google Scholar] [CrossRef]
- Wu, J.; Liu, L.-L.; Cao, M.; Hu, A.; Hu, D.; Luo, Y.; Wang, H.; Zhong, J.-N. DNA methylation plays important roles in retinal development and diseases. Exp. Eye Res. 2021, 211, 108733. [Google Scholar] [CrossRef]
- Gemenetzi, M.; Lotery, A.J. Epigenetics in age-related macular degeneration: New discoveries and future perspectives. Cell. Mol. Life Sci. 2020, 77, 807–818. [Google Scholar] [CrossRef] [PubMed]
- Hunter, A.; Spechler, P.A.; Cwanger, A.; Song, Y.; Zhang, Z.; Ying, G.S.; Hunter, A.K.; Dezoeten, E.; Dunaief, J.L. DNA methylation is associated with altered gene expression in AMD. Investig. Ophthalmol. Vis. Sci. 2012, 53, 2089–2105. [Google Scholar] [CrossRef] [PubMed]
- Oliver, V.F.; Jaffe, A.E.; Song, J.; Wang, G.; Zhang, P.; Branham, K.E.; Swaroop, A.; Eberhart, C.G.; Zack, D.J.; Qian, J.; et al. Differential DNA methylation identified in the blood and retina of AMD patients. Epigenetics 2015, 10, 698–707. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.; Huang, Y.; Chu, F.; Liao, K.; Cui, Z.; Chen, J.; Tang, S. Integrated Analysis of DNA methylation and transcriptome profile to identify key features of age-related macular degeneration. Bioengineered 2021, 12, 7061–7078. [Google Scholar] [CrossRef] [PubMed]
- Lewandowski, D.; Sander, C.L.; Tworak, A.; Gao, F.; Xu, Q.; Skowronska-Krawczyk, D. Dynamic lipid turnover in photoreceptors and retinal pigment epithelium throughout life. Prog. Retin. Eye Res. 2022, 89, 101037. [Google Scholar] [CrossRef]
- Anderson, D.M.G.; Kotnala, A.; Migas, L.G.; Patterson, N.H.; Tideman, L.E.M.; Cao, D.; Adhikari, B.; Messinger, J.D.; Ach, T.; Tortorella, S.; et al. Lysolipids are prominent in subretinal drusenoid deposits, a high-risk phenotype in age-related macular degeneration. Front. Ophthalmol. 2023, 3, 1258734. [Google Scholar] [CrossRef]
- Flaxel, C.J.; Adelman, R.A.; Bailey, S.T.; Fawzi, A.; Lim, J.I.; Vemulakonda, G.A.; Ying, G. Age-Related Macular Degeneration Preferred Practice Pattern®. Ophthalmology 2020, 127, 1–65. Available online: https://linkinghub.elsevier.com/retrieve/pii/S0161642019320913 (accessed on 13 January 2025).
- Ferris, F.L.; Wilkinson, C.P.; Bird, A.; Chakravarthy, U.; Chew, E.; Csaky, K.; Sadda, S.R. Clinical classification of age-related macular degeneration. Ophthalmology 2013, 120, 844–851. [Google Scholar] [CrossRef]
- Wei, L.; Liu, B.; Tuo, J.; Shen, D.; Chen, P.; Li, Z.; Liu, X.; Ni, J.; Dagur, P.; Sen, H.N.; et al. Hypomethylation of the IL17RC Promoter Associates with Age-Related Macular Degeneration. Cell Rep. 2012, 2, 1151–1158. [Google Scholar] [CrossRef]
- Wei, L.; Chen, P.; Lee, J.H.; Nussenblatt, R.B. Genetic and Epigenetic Regulation in Age-Related Macular Degeneration. Asia-Pac. J. Ophthalmol. 2013, 2, 269–274. [Google Scholar] [CrossRef]
- Seddon, J.M.; Reynolds, R.; Shah, H.R.; Rosner, B. Smoking, Dietary Betaine, Methionine, and Vitamin D in Monozygotic Twins with Discordant Macular Degeneration: Epigenetic Implications. Ophthalmology 2011, 118, 1386–1394. [Google Scholar] [CrossRef]
- Camacho, P.; Ribeiro, E.; Pereira, B.; Varandas, T.; Nascimento, J.; Henriques, J.; Dutra-Medeiros, M.; Delgadinho, M.; Oliveira, K.; Silva, C.; et al. DNA methyltransferase expression (DNMT1, DNMT3a and DNMT3b) as a potential biomarker for anti-VEGF diabetic macular edema response. Eur. J. Ophthalmol. 2023, 33, 2267–2274. [Google Scholar] [CrossRef] [PubMed]
- Peng, C.H.; Cherng, J.Y.; Chiou, G.Y.; Chen, Y.C.; Chien, C.H.; Kao, C.L.; Chang, Y.L.; Chien, Y.; Chen, L.K.; Liu, J.-H.; et al. Delivery of Oct4 and SirT1 with cationic polyurethanes-short branch PEI to aged retinal pigment epithelium. Biomaterials 2011, 32, 9077–9088. [Google Scholar] [CrossRef] [PubMed]
- Advani, J.; Mehta, P.A.; Hamel, A.R.; Mehrotra, S.; Kiel, C.; Strunz, T.; Corso-Díaz, X.; Kwicklis, M.; van Asten, F.; Ratnapriya, R.; et al. QTL mapping of human retina DNA methylation identifies 87 gene-epigenome interactions in age-related macular degeneration. Nat Commun. 2024, 15, 1972. [Google Scholar] [CrossRef]
- Mallik, S.; Grodstein, F.; Bennett, D.A.; Vavvas, D.G.; Lemos, B. Novel Epigenetic Clock Biomarkers of Age-Related Macular Degeneration. Front Med. 2022, 16, 9–856853. [Google Scholar] [CrossRef]
- Corso-Díaz, X.; Gentry, J.; Rebernick, R.; Jaeger, C.; Brooks, M.J.; van Asten, F.; Kooragayala, K.; Gieser, L.; Nellissery, J.; Covian, R.; et al. Genome-wide Profiling Identifies DNA Methylation Signatures of Aging in Rod Photoreceptors Associated with Alterations in Energy Metabolism. Cell Rep. 2020, 31, 107525. [Google Scholar] [CrossRef]
- Marin, A.I.; Poppelaars, F.; Wagner, B.D.; Palestine, A.G.; Patnaik, J.L.; Holers, V.M.; Frazer-Abel, A.A.; Mathias, M.T.; Manoharan, N.; Fonteh, C.N.; et al. Sex and Age-Related Differences in Complement Factors Among Patients with Intermediate Age-Related Macular Degeneration. Transl. Vis. Sci. Technol. 2022, 11, 22. [Google Scholar] [CrossRef]
- Maugeri, A.; Barchitta, M.; Mazzone, M.G.; Giuliano, F.; Basile, G.; Agodi, A. Resveratrol modulates SIRT1 and DNMT functions and restores LINE-1 methylation levels in ARPE-19 cells under oxidative stress and inflammation. Int. J. Mol. Sci. 2018, 19, 2118. [Google Scholar] [CrossRef]
- Fleckenstein, M.; Keenan, T.D.L.; Guymer, R.H.; Chakravarthy, U.; Schmitz-Valckenberg, S.; Klaver, C.C.; Wong, W.T.; Chew, E.Y. Age-related macular degeneration. Nat. Rev. Dis. Prim. 2021, 7. [Google Scholar] [CrossRef]
- Orozco, L.D.; Owen, L.A.; Hofmann, J.; Stockwell, A.D.; Tao, J.; Haller, S.; Mukundan, V.T.; Clarke, C.; Lund, J.; Sridhar, A.; et al. A systems biology approach uncovers novel disease mechanisms in age-related macular degeneration. Cell Genom. 2023, 3, 100302. [Google Scholar] [CrossRef]
- Voigt, A.P.; Mullin, N.K.; Mulfaul, K.; Lozano, L.P.; Wiley, L.A.; Flamme-Wiese, M.J.; Boese, E.A.; Han, I.C.; Scheetz, T.E.; Stone, E.M.; et al. Choroidal endothelial and macrophage gene expression in atrophic and neovascular macular degeneration. Hum. Mol. Gen. 2022, 31, 2406–2423. [Google Scholar] [CrossRef]
- Wu, X.; Yang, X.; Dai, X.; Chen, X.; Shen, M.; Dai, J.; Yuan, F.; Wang, L.; Yuan, Y.; Feng, Y. 5-Aza-2′-Deoxycytidine Ameliorates Choroidal Neovascularization by Inhibiting the Wnt/β-Catenin Signaling Pathway. Investig. Opthalmol. Vis. Sci. 2024, 65, 23. [Google Scholar] [CrossRef] [PubMed]
- Kumar-Singh, R. The role of complement membrane attack complex in dry and wet AMD—From hypothesis to clinical trials. Exp. Eye Res. 2019, 184, 266–277. [Google Scholar] [CrossRef]
- Corso-Díaz, X.; Jaeger, C.; Chaitankar, V.; Swaroop, A. Epigenetic control of gene regulation during development and disease: A view from the retina. Prog. Retin. Eye Res. 2018, 65, 1–27. [Google Scholar] [CrossRef]
- Lu, C.F.; Zhou, Y.N.; Zhang, J.; Su, S.; Liu, Y.; Peng, G.H.; Zang, W.; Cao, J. The role of epigenetic methylation/demethylation in the regulation of retinal photoreceptors. Front. Cell Dev. Biol. 2023, 11, 1149132. [Google Scholar] [CrossRef]
- Chao, D.L.; Skowronska-Krawczyk, D. ELOVL2: Not just a biomarker of aging. Transl. Med. Aging 2020, 4, 78–80. [Google Scholar] [CrossRef]
- SanGiovanni, J.P.; Agrón, E.; Meleth, A.D.; Reed, G.F.; Sperduto, R.D.; Clemons, T.E.; Chew, E.Y. ω-3 long-chain polyunsaturated fatty acid intake and 12-y incidence of neovascular age-related macular degeneration and central geographic atrophy: AREDS report 30, a prospective cohort study from the Age-Related Eye Disease Study. Am. J. Clin. Nutr. 2009, 90, 1601–1607. [Google Scholar] [CrossRef]
- Chen, D.; Chao, D.L.; Rocha, L.; Kolar, M.; Nguyen Huu, V.A.; Krawczyk, M.; Dasyani, M.; Wang, T.; Jafari, M.; Jabari, M.; et al. The lipid elongation enzyme ELOVL2 is a molecular regulator of aging in the retina. Aging Cell. 2020, 19, e13100. [Google Scholar] [CrossRef]
Genes | Accession Number * | Forward Primer (5′→3′) | Reverse PRIMER (3′→5′) | Product Length (bp) |
---|---|---|---|---|
GAPDH | NM_002046.7 | GAGTCAACGGATTTGGTCGTA | GCAGAGATGATGACCCTTTTG | 245 |
DNMT1 | NM_001379.4 | CCTCCAAAAACCCAGCCAAC | TCCAGGACCCTGGGGATTTC | 101 |
DNMT3A | NM_022552.5 | CCAACATCGAATCCATGAAA | CTTGCGCTTGCTGATGTAGT | 140 |
DNMT3B | NM_175850.3 | CGAATTTTACCACCTGCTGAATT | AGAACGGCCGGTCATCAC | 59 |
Early/Intermediate AMD (n = 18) | Late AMD (n = 20) | p-Value | |
---|---|---|---|
Age (years) Mean (SD) | 81.6 (3.8) | 83.9 (6.0) | 0.105 a |
Sex M/F n (%) | 6 (33.3%) 12 (66.7%) | 11 (55.0%) 9 (45.0%) | 0.169 b |
Study eye RE/LE n (%) | 8 (44.4%) 10 (55.6%) | 10 (50.0%) 10 (50.0%) | 0.732 b |
BCVA Mean (SD) | 74.7 (8.6) | 49.9 (20.7) | <0.001 c |
IOP (mmHg) Mean (SD) | 14.7 (2.4) | 14.8 (3.1) | 0.718 a |
SE Mean (SD) | 0.26 (0.89) | 0.23 (0.77) | 0.992 a |
Hypertension Yes/no (%) | 11 (61.1%) 7 (38.9%) | 13 (65.7%) 7 (35.0%) | 0.804 b |
DM Yes/no (%) | 8 (44.4%) 10 (55.6%) | 6 (30.0%) 14 (70.0%) | 0.357 b |
CRT Mean (SD) | 281.3 (38.3) | 299.8 (124) | 0.874 a |
CFT Mean (SD) | 217.7 (27.5) | 204.2 (73.8) | 0.443 c |
Early AMD (n = 2) | Intermediate AMD (n = 16) | Atrophic AMD (n = 6) | Neovascular AMD (n = 14) | p-Value | |
---|---|---|---|---|---|
Age (years) Mean (SD) | 84.0 (8.5) | 81.4 (3.3) | 81.0 (6.5) | 85.2 (5.6) | 0.164 a |
Sex M/F n (%) | 2 (100) 0 (0) | 4 (25) 12 (75) | 8 (57.1) 6 (42.9) | 8 (57.1) 6 (42.9) | n/a |
Study eye RE/LE n (%) | 0 (0) 2 (100) | 8 (50) 8 (50) | 7 (50) 7 (50) | 7 (50) 7 (50) | n/a |
BCVA Mean (SD) | 77 (9.9) | 74.4 (8.8) | 44.7 (14.7) | 44.8 (23.3) | <0.001 a |
IOP (mmHg) Mean (SD) | 13.5 (0.7) | 14.4 (2.6) | 15.3 (1.5) | 14.6 (3.5) | 0.547 b |
SE Mean (SD) | 0.87 (0.5) | 0.19 (0.9) | 0.17 (0.7) | 0.27 (0.8) | 0.650 b |
Hypertension Yes/no n (%) | 1 (50) 1 (50) | 10 (62.5) 6 (37.5) | 4 (66.7) 2 (33.3) | 9 (64.3) 5 (35.7) | n/a |
DM Yes/no n (%) | 0 (0) 2 (100) | 8 (50) 8 (50) | 2 (33.3) 4 (66.7) | 4 (28.6) 10 (71.4) | n/a |
CRT Mean (SD) | 255.5 (36.1) | 284.6 (38.4) | 222.3 (51.3) | 332.9 (132.7) | 0.059 b |
CFT Mean (SD) | 223.0 (24) | 217.0 (28.6) | 172 (79.3) | 217.9 (69.8) | 0.354 a |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Camacho, P.; Ribeiro, E.; Pereira, B.; Nascimento, J.; Caldeira Rosa, P.; Henriques, J.; Barrão, S.; Sadio, S.; Quendera, B.; Delgadinho, M.; et al. DNA Methyltransferase Expression (DNMT1, DNMT3a, and DNMT3b) as a Potential Biomarker in Age-Related Macular Degeneration. J. Clin. Med. 2025, 14, 559. https://doi.org/10.3390/jcm14020559
Camacho P, Ribeiro E, Pereira B, Nascimento J, Caldeira Rosa P, Henriques J, Barrão S, Sadio S, Quendera B, Delgadinho M, et al. DNA Methyltransferase Expression (DNMT1, DNMT3a, and DNMT3b) as a Potential Biomarker in Age-Related Macular Degeneration. Journal of Clinical Medicine. 2025; 14(2):559. https://doi.org/10.3390/jcm14020559
Chicago/Turabian StyleCamacho, Pedro, Edna Ribeiro, Bruno Pereira, João Nascimento, Paulo Caldeira Rosa, José Henriques, Sandra Barrão, Silvia Sadio, Bruno Quendera, Mariana Delgadinho, and et al. 2025. "DNA Methyltransferase Expression (DNMT1, DNMT3a, and DNMT3b) as a Potential Biomarker in Age-Related Macular Degeneration" Journal of Clinical Medicine 14, no. 2: 559. https://doi.org/10.3390/jcm14020559
APA StyleCamacho, P., Ribeiro, E., Pereira, B., Nascimento, J., Caldeira Rosa, P., Henriques, J., Barrão, S., Sadio, S., Quendera, B., Delgadinho, M., Ginete, C., Silva, C., & Brito, M. (2025). DNA Methyltransferase Expression (DNMT1, DNMT3a, and DNMT3b) as a Potential Biomarker in Age-Related Macular Degeneration. Journal of Clinical Medicine, 14(2), 559. https://doi.org/10.3390/jcm14020559