Role of CES1 and ABCB1 Genetic Polymorphisms on Functional Response to Dabigatran in Patients with Atrial Fibrillation
Abstract
1. Introduction
2. Methods
2.1. Ethics
2.2. Study Population
2.3. Determination of Blood Coagulation Parameters and Plasma Concentration of Dabigatran
2.4. Genotyping
- AGATCAAAAAGTGACCA CAGCCCC[G/T]GGTGAGCGATGCAGCTTCTCCAGCC
- TACAAACAATATATTACATCATAAT[A/G]CTTTACCATCTAAAATACTGATAGT
- AGGGTTGAGGGGAGGAACTAAAACC[C/T]GTCAGCCAAAAACAGGTCAGCTAGT
2.5. Endpoints
- -
- Evaluation of peak and trough dTT values based on CES1 SNP rs2244613, using both doses of dabigatran (110 mg and 150 mg BID);
- -
- Evaluation of peak and trough dTT values based on CES1 SNP rs8192935, using both doses of dabigatran;
- -
- Evaluation of peak and trough dTT values based on ABCB1 SNP rs4148738, using both doses of dabigatran.
2.6. Statistical Analysis
3. Results
3.1. CES1 rs2244613 Polymorphism
3.2. CES1 rs8192935 Polymorphism
3.3. ABCB1 rs4148738 Polymorphism
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Virani, S.S.; Alonso, A.; Benjamin, E.J.; Bittencourt, M.S.; Callaway, C.W.; Carson, A.P.; Chamberlain, A.M.; Chang, A.R.; Cheng, S.; Delling, F.N.; et al. Heart disease and stroke Statistics-2020 Update: A report from the American heart association. Circulation 2020, 141, e139–e596. [Google Scholar] [PubMed]
- Hart, R.G.; Pearce, L.A.; Aguilar, M.I. Meta-analysis: Antithrombotic therapy to prevent stroke in patients who have nonvalvular atrial fibrillation. Ann. Intern. Med. 2007, 146, 857–867. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Van Ganse, E.; Danchin, N.; Mahé, I.; Hanon, O.; Jacoud, F.; Nolin, M.; Dalon, F.; Lefevre, C.; Cotté, F.E.; Gollety, S.; et al. Comparative safety and Effectiveness of oral anticoagulants in nonvalvular atrial fibrillation: The NAXOS study. Stroke 2020, 51, 2066–2075. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Antonijevic, N.M.; Zivkovic, I.D.; Jovanovic, L.M.; Matic, D.M.; Kocica, M.J.; Mrdovic, I.B.; Kanjuh, V.I.; Culafic, M.D. Dabigatran-metabolism, pharmacologic properties and drug interactions. Curr. Drug Metab. 2017, 18, 622–635. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, Y.; Yang, C.; Qi, W.; Pei, Z.; Xue, W.; Zhu, H.; Dong, M.; Guo, Y.; Cong, D.; Wang, F. The impact of ABCB1 and CES1 polymorphisms on dabigatran pharmacokinetics in healthy chinese subjects. Pharmgenom. Pers. Med. 2021, 14, 477–485. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liesenfeld, K.; Lehr, T.; Dansirikul, C.; Reilly, P.A.; Connolly, S.J.; Ezekowitz, M.D.; Yusuf, S.; Wallentin, L.; Haertter, S.; Staab, A. Population pharmacokinetic analysis of the oral thrombin inhibitor dabigatran etexilate in patients with non-valvular atrial fibrillation from the RE-LY trial. J. Thromb. Haemost. 2011, 9, 2168–2175. [Google Scholar] [CrossRef] [Scilit]
- Paré, G.; Eriksson, N.; Lehr, T.; Connolly, S.; Eikelboom, J.; Ezekowitz, M.D.; Axelsson, T.; Haertter, S.; Oldgren, J.; Reilly, P.; et al. Genetic determinants of dabigatran plasma levels and their relation to bleeding. Circulation 2013, 127, 1404–1412. [Google Scholar] [CrossRef] [Scilit]
- Roşian, A.N.; Roşian, Ş.H.; Kiss, B.; Ştefan, M.G.; Trifa, A.P.; Ober, C.D.; Bangău, V.; Mada, C.; Gocan, C.P.; Niţă, T.; et al. Genotype-phenotype correlation for dabigatran in patients with non- valvular atrial fibrillation (a single centre research). Hum. Vet. Med. 2020, 12, 123–129. [Google Scholar]
- Shi, J.; Wang, X.; Nguyen, J.H.; Bleske, B.E.; Liang, Y.; Liu, L.; Zhu, H.-J. Dabigatran etexilate activation is affected by the CES1 genetic polymorphism G143E (rs71647871) and gender. Biochem. Pharmacol. 2016, 119, 76–84. [Google Scholar] [CrossRef] [Scilit]
- Stangier, J.; Rathgen, K.; Stähle, H.; Gansser, D.; Roth, W. The pharmacokinetics, pharmacodynamics and tolerability of dabigatran etexilate, a new oral direct thrombin inhibitor, in healthy male subjects. Br. J. Clin. Pharmacol. 2007, 64, 292–303. [Google Scholar] [CrossRef] [Scilit]
- Van Ryn, J.; Stangier, J.; Haertter, S.; Liesenfeld, K.H.; Wienen, W.; Feuring, M.; Clemens, A. Dabigatran etexilate—A novel, reversible, oral direct thrombin inhibitor: Interpretation of coagulation assays and reversal of anticoagulant activity. Thromb. Haemost. 2010, 103, 1116–1127. [Google Scholar]
- Renda, G.; De Caterina, R. The new oral anticoagulants in atrial fibrillation: Once daily or twice daily? Vascul. Pharmacol. 2013, 59, 53–62. [Google Scholar] [CrossRef] [Scilit]
- Antovic, J.P.; Skeppholm, M.; Eintrei, J.; Boija, E.E.; Söderblom, L.; Norberg, E.-M.; Onelöv, L.; Rönquist-Nii, Y.; Pohanka, A.; Beck, O.; et al. Evaluation of coagulation assays versus LC-MS/MS for determinations of dabigatran concentrations in plasma. Eur. J. Clin. Pharmacol. 2013, 69, 1875–1881. [Google Scholar] [CrossRef] [Scilit]
- Geshi, E.; Kimura, T.; Yoshimura, M.; Suzuki, H.; Koba, S.; Sakai, T.; Saito, T.; Koga, A.; Muramatsu, M.; Katagiri, T. A single nucleotide polymorphism in the carboxylesterase gene is associated with the responsiveness to imidapril medication and the promoter activity. Hypertens. Res. 2005, 28, 719–725. [Google Scholar] [CrossRef] [Scilit]
- Helin, T.; Joutsi-Korhonen, L.; Lassila, R. Clinical use and laboratory testing of oral anticoagulation therapy: Experience from Finland. Ann. Blood 2019, 4, 17. [Google Scholar] [CrossRef] [Scilit]
- Sychev, D.A.; Levanov, A.N.; Shelekhova, T.V.; Bochkov, P.O.; Denisenko, N.P.; Ryzhikova, K.A.; Mirzaev, K.B.; Grishina, E.A.; Gavrilov, M.A.; Ramenskaya, G.V.; et al. The impact of ABCB1 (rs1045642 and rs4148738) and CES1 (rs2244613) gene polymorphisms on dabigatran equilibrium peak concentration in patients after total knee arthroplasty. Pharmgenom. Pers. Med. 2018, 11, 127–137. [Google Scholar]
- Abdrakhmanov, A.; Akilzhanova, A.; Shaimerdinova, A.; Zhalbinova, M.; Tuyakova, G.; Abildinova, S.; Albayev, R.; Ainabekova, B.; Chinybayeva, A.; Suleimen, Z.; et al. The Distribution of the Genotypes of ABCB1 and CES1 Polymorphisms in Kazakhstani Patients with Atrial Fibrillation Treated with DOAC. Genes 2023, 14, 1192. [Google Scholar] [CrossRef] [Scilit]
- Dimatteo, C.; D’Andrea, G.; Vecchione, G.; Paoletti, O.; Cappucci, F.; Tiscia, G.L.; Buono, M.; Grandone, E.; Testa, S.; Margaglione, M. Pharmacogenetics of dabigatran etexilate interindividual variability. Thromb. Res. 2016, 144, 1–5. [Google Scholar] [CrossRef] [Scilit]
- Anna, O.; Petr, J.; Hana, M.; Tereza, S.; Petra, K.; Silvia, K.; Vlastimil, S.; Hana, H.; Martin, S.; Ivana, S.; et al. The Effect of ABCB1 and CES1 Polymorphisms on Plasma Levels of Dabigatran and Risk of Hemorrhagic Complications in Ischemic Stroke Patients. Am. J. Ther. 2024. [Google Scholar] [CrossRef] [Scilit]
- Kryukov, A.V.; Sychev, D.A.; Andreev, D.A.; Ryzhikova, K.A.; Grishina, E.A.; Ryabova, A.V.; Loskutnikov, M.A.; Smirnov, V.V.; Konova, O.D.; Matsneva, I.A.; et al. Influence of ABCB1 and CYP3A5 gene polymorphisms on pharmacokinetics of apixaban in patients with atrial fibrillation and acute stroke. Pharm. Pers. Med. 2018, 11, 43–49. [Google Scholar] [CrossRef] [Scilit]
- Ueshima, S.; Hira, D.; Fujii, R.; Kimura, Y.; Tomitsuka, C.; Yamane, T.; Tabuchi, Y.; Ozawa, T.; Itoh, H.; Horie, M.; et al. Impact of ABCB1, ABCG2, and CYP3A5 polymorphisms on plasma trough concentrations of apixaban in Japanese patients with atrial fibrillation. Pharm. Genom. 2017, 27, 329–336. [Google Scholar] [CrossRef] [Scilit] [PubMed]




| Overall Population (n = 100) | Dabigatran 110 mg (n = 43) | Dabigatran 150 mg (n = 57) | p Value | |
|---|---|---|---|---|
| Age (years) | 77 (68–82) | 82 (81–86) | 70 (67–74) | <0.001 |
| Gender | ||||
| Male | 63 (63) | 23 (53) | 40 (70) | 0.09 |
| Female | 37 (37) | 20 (47) | 17 (30) | |
| Weight (Kg) | 79 ± 13 | 74 ± 13 | 83 ± 13 | 0.002 |
| Diabetes mellitus | 16 (16) | 7 (16) | 9 (16) | 0.88 |
| Systemic hypertension | 65 (65) | 24 (56) | 41 (72) | 0.13 |
| Previous stroke/TIA | 15 (15) | 3 (7) | 12 (21) | 0.051 |
| Concomitant vascular disease | 28 (28) | 18 (41) | 10 (18) | 0.005 |
| Heart failure | 14 (14) | 5 (12) | 9 (16) | 0.63 |
| CHA2DS2VASc score | 3 (2–4) | 4 (3–4) | 3 (2–4) | 0.025 |
| HASBLED score | 1 (1–2) | 1 (1–2) | 1 (1–2) | 0.08 |
| Type of AF | ||||
| Paroxysmal | 52 (52) | 18 (42) | 34 (56) | 0.08 |
| Persistent | 22 (22) | 7 (16) | 15 (26) | 0.23 |
| Permanent | 26 (26) | 18 (42) | 8 (31) | 0.002 |
| Creatinine clearance (mL/min) | 71 (59–86) | 60 (55–70) | 81 (67–90) | <0.001 |
| LVEF (%) | 58 (54–62) | 60 (54–60) | 58 (54–62) | 0.88 |
| Overall Population (n = 100) | Dabigatran 110 mg (n = 43) | Dabigatran 150 mg (n = 57) | p Value | |
|---|---|---|---|---|
| Dabigatran concentration at trough (ng/mL) | 59 (48–87) | 69 (49–91) | 59 (42–81) | 0.37 |
| Dabigatran concentration at peak (ng/mL) | 115 (91–171) | 113 (100–147) | 132 (65–176) | 0.94 |
| dTT at trough (ng/mL) | 90 (51–132) | 90 (54–140) | 90 (47–129) | 0.94 |
| dTT at peak (ng/mL) | 176 (101–232) | 174 (87–213) | 186 (101–237) | 0.53 |
| Overall Population (n = 100) | Dabigatran 110 mg (n = 43) | Dabigatran 150 mg (n = 57) | |
|---|---|---|---|
| CES1 rs2244613 polymorphism | |||
| GG genotype (wild-type) | 5 (5) | - | 5 (9) |
| GT genotype (heterozygous) | 35 (35) | 17 (39) | 18 (31) |
| TT genotype (mutant trait) | 60 (60) | 26 (60) | 34 (60) |
| CES1 rs8192935 polymorphism | |||
| AA genotype (wild-type) | 11 (11) | 3 (7) | 8 (14) |
| AG genotype (heterozygous) | 43 (43) | 21 (49) | 22 (39) |
| GG genotype (mutant trait) | 46 (46) | 19 (44) | 27 (47) |
| ABCB1 rs4148738 polymorphism | |||
| CC genotype (wild-type) | 22 (22) | 10 (23) | 12 (21) |
| CT genotype (heterozygous) | 61 (61) | 26 (60) | 35 (61) |
| TT genotype (mutant trait) | 17 (17) | 7 (16) | 10 (18) |
| Dabigatran 110 mg (n = 43) | p Value | Dabigatran 150 mg (n = 57) | p Value | |||||
|---|---|---|---|---|---|---|---|---|
| Concentration at trough (ng/mL) | Wild-type homozygosis (CC) | Heterozygosis (CT) | Mutant trait (TT) | Wild-type homozygosis (CC) | Heterozygosis (CT) | Mutant trait (TT) | ||
| 85 (47–98) | 58 (48–102) | 56 (50–84) | 0.76 | 85 (68–119) | 49 (32–59) | 78 (62–93) | 0.02 | |
| Concentration at peak (ng/mL) | Wild-type homozygosis (CC) | Heterozygosis (CT) | Mutant trait (TT) | Wild-type homozygosis (CC) | Heterozygosis (CT) | Mutant trait (TT) | ||
| 108 (102–132) | 126 (99–209) | 109 (91–115) | 0.59 | 189 (129–232) | 132 (55–175) | 90 (65–117) | 0.24 | |
| dTT at trough (ng/mL) | Wild-type homozygosis (CC) | Heterozygosis (CT) | Mutant trait (TT) | Wild-type homozygosis (CC) | Heterozygosis (CT) | Mutant trait (TT) | ||
| 114 (69–151) | 74 (42–128) | 93 (88–145) | 0.23 | 127 (85–147) | 77 (44–111) | 110 (47–159) | 0.048 | |
| dTT at peak (ng/mL) | Wild-type homozygosis (CC) | Heterozygosis (CT) | Mutant trait (TT) | Wild-type homozygosis (CC) | Heterozygosis (CT) | Mutant trait (TT) | ||
| 172 (153–188) | 172 (70–213) | 187 (150–241) | 0.70 | 214 (159–295) | 163 (101–237) | 178 (86–236) | 0.28 | |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cumitini, L.; Renda, G.; Giordano, M.; Rolla, R.; Shail, T.; Sacchetti, S.; Iezzi, L.; Giacomini, L.; Zanotti, V.; Auciello, R.; et al. Role of CES1 and ABCB1 Genetic Polymorphisms on Functional Response to Dabigatran in Patients with Atrial Fibrillation. J. Clin. Med. 2024, 13, 2545. https://doi.org/10.3390/jcm13092545
Cumitini L, Renda G, Giordano M, Rolla R, Shail T, Sacchetti S, Iezzi L, Giacomini L, Zanotti V, Auciello R, et al. Role of CES1 and ABCB1 Genetic Polymorphisms on Functional Response to Dabigatran in Patients with Atrial Fibrillation. Journal of Clinical Medicine. 2024; 13(9):2545. https://doi.org/10.3390/jcm13092545
Chicago/Turabian StyleCumitini, Luca, Giulia Renda, Mara Giordano, Roberta Rolla, Tarek Shail, Sara Sacchetti, Lorena Iezzi, Luca Giacomini, Valentina Zanotti, Raffaella Auciello, and et al. 2024. "Role of CES1 and ABCB1 Genetic Polymorphisms on Functional Response to Dabigatran in Patients with Atrial Fibrillation" Journal of Clinical Medicine 13, no. 9: 2545. https://doi.org/10.3390/jcm13092545
APA StyleCumitini, L., Renda, G., Giordano, M., Rolla, R., Shail, T., Sacchetti, S., Iezzi, L., Giacomini, L., Zanotti, V., Auciello, R., Angilletta, I., Foglietta, M., Zucchelli, M., Antonucci, I., Stuppia, L., Gallina, S., Dianzani, U., & Patti, G. (2024). Role of CES1 and ABCB1 Genetic Polymorphisms on Functional Response to Dabigatran in Patients with Atrial Fibrillation. Journal of Clinical Medicine, 13(9), 2545. https://doi.org/10.3390/jcm13092545

