Cyclin D1 Binding Protein 1 Responds to DNA Damage through the ATM–CHK2 Pathway
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plasmids
2.2. Cells
- CCNDBP1 (forward): GCTGTGGAAGAATGTGACC
- CCNDBP1 (reverse): AGAGCCAAATCATCCACA
- GAPDH (forward): AGGTCGGTGTGAACGGATTTG
- GAPDH (reverse): TGTAGACCATGTAGTTGAGGTCA
2.3. Animals
2.4. Irradiation
2.5. Cell Growth Assay
2.6. Western Blotting
2.7. Histological Analysis
2.8. Microarray and Bioinformatic Analyses
2.9. Statistical Analyses
3. Results
3.1. Effect of CCNDBP1 Expression in HCC Cells on X-ray Irradiation
3.2. Gene Expression Analyses in CCNDBP1-Overexpressed Cells and Ccndbp1 Knockout Mice
3.3. CCNDBP1 Expression and DNA Damage-Related Proteins
3.4. Effect of Ccndbp1 In Vivo
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Acknowledgments
Conflicts of Interest
References
- Seto, A.; Ikushima, H.; Suzuki, T.; Sato, Y.; Fukai, S.; Yuki, K.; Miyazawa, K.; Miyazono, K.; Ishitani, R.; Nureki, O. Crystallization and preliminary X-ray diffraction analysis of GCIP/HHM transcriptional regulator. Acta Crystallogr. Sect. F Struct. Biol. Cryst. Commun. 2009, 65, 21–24. [Google Scholar] [CrossRef]
- Ishii, R.; Isogaya, K.; Seto, A.; Koinuma, D.; Watanabe, Y.; Arisaka, F.; Yaguchi, S.; Ikushima, H.; Dohmae, N.; Miyazono, K.; et al. Structure of a dominant-negative helix-loop-helix transcriptional regulator suggests mechanisms of autoinhibition. EMBO J. 2012, 31, 2541–2552. [Google Scholar] [CrossRef] [Green Version]
- Xia, C.; Bao, Z.; Tabassam, F.; Ma, W.; Qiu, M.; Hua, S.; Liu, M. GCIP, a novel human grap2 and cyclin D interacting protein, regulates E2F-mediated transcriptional activity. J. Biol. Chem. 2000, 275, 20942–20948. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Terai, S.; Aoki, H.; Ashida, K.; Thorgeirsson, S.S. Human homologue of maid: A dominant inhibitory helix-loop-helix protein associated with liver-specific gene expression. Hepatology 2000, 32, 357–366. [Google Scholar] [CrossRef]
- Ma, W.; Stafford, L.J.; Li, D.; Luo, J.; Li, X.; Ning, G.; Liu, M. GCIP/CCNDBP1, a helix-loop-helix protein, suppresses tumorigenesis. J. Cell. Biochem. 2007, 100, 1376–1386. [Google Scholar] [CrossRef] [PubMed]
- Xu, W.; Cao, M.; Zheng, H.; Tan, X.; Li, L.; Cui, G.; Xu, J.; Cao, J.; Ke, K.; Wu, Q. Upregulation of SYF2 is associated with neuronal apoptosis caused by reactive astrogliosis to neuroinflammation. J. Neurosci. Res. 2014, 92, 318–328. [Google Scholar] [CrossRef] [PubMed]
- Zhu, J.; Ji, L.; Zhang, J.; Yang, L.; Guan, C.; Wang, Y.; Zhu, J.; Liang, L.; Ni, R. Upregulation of SYF2 in esophageal squamous cell carcinoma promotes tumor cell proliferation and predicts poor prognosis. Tumour Biol. 2014, 35, 10275–10285. [Google Scholar] [CrossRef] [PubMed]
- Sang, A.; Yang, X.; Chen, H.; Qin, B.; Zhu, M.; Dai, M.; Zhu, R.; Liu, X. Upregulation of SYF2 relates to retinal ganglion cell apoptosis and retinal glia cell proliferation after light-induced retinal damage. J. Mol. Neurosci. 2015, 56, 480–490. [Google Scholar] [CrossRef]
- Chellas-Géry, B.; Linton, C.N.; Fields, K.A. Human GCIP interacts with CT847, a novel Chlamydia trachomatis type III secretion substrate, and is degraded in a tissue-culture infection model. Cell. Microbiol. 2007, 9, 2417–2430. [Google Scholar] [CrossRef]
- Takami, T.; Terai, S.; Yokoyama, Y.; Tanimoto, H.; Tajima, K.; Uchida, K.; Yamasaki, T.; Sakaida, I.; Nishina, H.; Thorgeirsson, S.S.; et al. Human homologue of maid is a useful marker protein in hepatocarcinogenesis. Gastroenterology 2005, 128, 1369–1380. [Google Scholar] [CrossRef] [PubMed]
- Huang, Y.; Chen, B.; Ye, M.; Liang, P.; Zhangfang, Y.; Huang, J.; Liu, M.; Songyang, Z.; Ma, W. Ccndbp1 is a new positive regulator of skeletal myogenesis. J. Cell. Sci. 2016, 129, 2767–2777. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ikushima, H.; Komuro, A.; Isogaya, K.; Shinozaki, M.; Hellman, U.; Miyazawa, K.; Miyazono, K. An Id-like molecule, HHM, is a synexpression group-restricted regulator of TGF-beta signalling. EMBO J. 2008, 27, 2955–2965. [Google Scholar] [CrossRef] [Green Version]
- Sonnenberg-Riethmacher, E.; Wustefeld, T.; Miehe, M.; Trautwein, C.; Riethmacher, D. Maid (GCIP) is involved in cell cycle control of hepatocytes. Hepatology 2007, 45, 404–411. [Google Scholar] [CrossRef] [PubMed]
- Ma, W.; Xia, X.; Stafford, L.J.; Yu, C.; Wang, F.; LeSage, G.; Liu, M. Expression of GCIP in transgenic mice decreases susceptibility to chemical hepatocarcinogenesis. Oncogene 2006, 25, 4207–4216. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chang, T.W.; Chen, C.C.; Chen, K.Y.; Su, J.H.; Chang, J.H.; Chang, M.C. Ribosomal phosphoprotein P0 interacts with GCIP and overexpression of P0 is associated with cellular proliferation in breast and liver carcinoma cells. Oncogene 2008, 27, 332–338. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fujisawa, K.; Terai, S.; Matsumoto, T.; Takami, T.; Yamamoto, N.; Nishina, H.; Furutani-Seiki, M.; Sakaida, I. Evidence for a role of the transcriptional regulator maid in tumorigenesis and aging. PLoS ONE 2015, 10, e0129950. [Google Scholar] [CrossRef] [PubMed]
- Su, T.; Deguchi, A.; Yao, Y.; Luo, J.; Weinstein, I.B. Dip1 inhibits growth and gene transcription in MCF-7 breast cancer cells. J. Exp. Ther. Oncol. 2007, 6, 117–127. [Google Scholar]
- Chen, W.C.; Su, P.F.; Jin, Y.T.; Chang, M.C.; Chang, T.W. Immunohistochemical expression of GCIP in breast carcinoma: Relationship with tumour grade, disease-free survival, mucinous differentiation and response to chemotherapy. Histopathology 2008, 53, 554–560. [Google Scholar] [CrossRef]
- Lee, I.; Yeom, S.Y.; Lee, S.J.; Kang, W.K.; Park, C. A novel senescence-evasion mechanism involving Grap2 and Cyclin D interacting protein inactivation by Ras associated with diabetes in cancer cells under doxorubicin treatment. Cancer Res. 2010, 70, 4357–4365. [Google Scholar] [CrossRef] [Green Version]
- Chen, K.Y.; Chen, C.C.; Tseng, Y.L.; Chang, Y.C.; Chang, M.C. GCIP functions as a tumor suppressor in non-small cell lung cancer by suppressing Id1-mediated tumor promotion. Oncotarget 2014, 5, 5017–5028. [Google Scholar] [CrossRef]
- Hélias-Rodzewicz, Z.; Lourenco, N.; Bakari, M.; Capron, C.; Emile, J.F. CDKN2A depletion causes aneuploidy and enhances cell proliferation in non-immortalized normal human cells. Cancer Investig. 2018, 36, 338–348. [Google Scholar] [CrossRef] [PubMed]
- Gong, H.; Gao, S.; Yu, C.; Li, M.; Liu, P.; Zhang, G.; Song, J.; Zheng, J. Effect and mechanism of YB-1 knockdown on glioma cell growth, migration, and apoptosis. Acta Biochim. Biophys. Sin. 2020, 52, 168–179. [Google Scholar] [CrossRef] [PubMed]
- Kamimura, K.; Ohi, H.; Kubota, T.; Okazuka, K.; Yoshikai, Y.; Wakabayashi, Y.; Aoyagi, Y.; Mishima, Y.; Kominami, R. Haploinsufficiency of Bcl11b for suppression of lymphomagenesis and thymocyte development. Biochem. Biophys. Res. Commun. 2007, 355, 538–542. [Google Scholar] [CrossRef] [PubMed]
- Kamimura, K.; Mishima, Y.; Obata, M.; Endo, T.; Aoyagi, Y.; Kominami, R. Lack of Bcl11b tumor suppressor results in vulnerability to DNA replication stress and damages. Oncogene 2007, 26, 5840–5850. [Google Scholar] [CrossRef] [Green Version]
- Baharudin, R.; Mutalib, N.-S.A.; Othman, S.N.; Sagap, I.; Rose, I.M.; Mokhtar, N.M.; Jamal, R. Identification of predictive DNA methylation biomarkers for chemotherapy response in colorectal cancer. Front. Pharmacol. 2017, 8, 47. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Motizuki, M.; Saitoh, M.; Miyazawa, K. Maid is a negative regulator of transforming growth factor-beta-induced cell migration. J. Biochem. 2015, 158, 435–444. [Google Scholar] [CrossRef] [PubMed]
- Liang, R.Y.; Liu, B.H.; Huang, C.J.; Lin, K.T.; Ko, C.C.; Huang, L.L.; Hsu, B.; Wu, C.Y.; Chuang, S.M. MEK2 is a critical modulating mechanism to down-regulate GCIP stability and function in cancer cells. FASEB J. 2020, 34, 1958–1969. [Google Scholar] [CrossRef] [PubMed]
- Vrekoussis, T.; Chaniotis, V.; Navrozoglou, I.; Dousias, V.; Pavlakis, K.; Stathopoulos, E.N.; Zoras, O. Image analysis of breast cancer immunohistochemistry-stained sections using ImageJ: An RGB-based model. Anticancer Res. 2009, 29, 4995–4998. [Google Scholar]
- Bremer, S.C.B.; Conradi, L.C.; Mechie, N.C.; Amanzada, A.; Mavropoulou, E.; Kitz, J.; Ghadimi, M.; Ellenrieder, V.; Ströbel, P.; Hessmann, E.; et al. Enhancer of zeste homolog 2 in colorectal cancer development and progression. Digestion 2021, 102, 227–235. [Google Scholar] [CrossRef]
- Naskou, J.; Beiter, Y.; van Rensburg, R.; Honisch, E.; Rudelius, M.; Schlensog, M.; Gottstein, J.; Walter, L.; Braicu, E.I.; Sehouli, J.; et al. EZH2 loss drives resistance to carboplatin and paclitaxel in serious ovarian cancers expressing ATM. Mol. Cancer Res. 2020, 18, 278–286. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ahmad, F.; Patrick, S.; Sheikh, T.; Sharma, V.; Pathak, P.; Malgulwar, P.B.; Kumar, A.; Joshi, S.D.; Sarkar, C.; Sen, E. Telomerase reverse transcriptase (TERT)-enhancer of zeste homolog 2 (EZH2) network regulates lipid metabolism and DNA damage responses in glioblastoma. J. Neurochem. 2017, 143, 671–683. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ye, Q.; Chen, H.; Wen, Z.; Guo, W.; Huang, Y.; Mo, X. Abnormal expression of p-ATM/CHK2 in nasal extranodal NK/T cell lymphoma, nasal type, is correlated with poor prognosis. J. Clin. Pathol. 2021, 74, 223–227. [Google Scholar] [CrossRef] [PubMed]
- Ziegler, V.; Deußen, M.; Schumacher, L.; Roos, W.P.; Fritz, G. Anticancer drug and ionizing radiation-induced DNA damage differently influences transcription activity and DDR-related stress responses of an endothelial monolayer. Biochim. Biophys. Acta Mol. Cell Res. 2020, 1867, 118678. [Google Scholar] [CrossRef] [PubMed]
- Yang, L.; Wu, Z.; Sun, W.; Luo, P.; Chen, S.; Chen, Y.; Yan, W.; Li, Y.; Wang, C. CCNDBP1, a prognostic marker regulated by DNA methylation, inhibits aggressive behavior in dedifferentiated liposarcoma via repressing epithelial mesenchymal transition. Front. Oncol. 2021, 11, 687012. [Google Scholar] [CrossRef] [PubMed]
- Mateo, J.; Carreira, S.; Sandhu, S.; Miranda, S.; Mossop, H.; Perez-Lopez, R.; Nava Rodrigues, D.; Robinson, D.; Omlin, A.; Tunariu, N.; et al. DNA-repair defects and olaparib in metastatic prostate cancer. N. Engl. J. Med. 2015, 373, 1697–1708. [Google Scholar] [CrossRef] [PubMed]
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Niwa, Y.; Kamimura, K.; Ogawa, K.; Oda, C.; Tanaka, Y.; Horigome, R.; Ohtsuka, M.; Miura, H.; Fujisawa, K.; Yamamoto, N.; et al. Cyclin D1 Binding Protein 1 Responds to DNA Damage through the ATM–CHK2 Pathway. J. Clin. Med. 2022, 11, 851. https://doi.org/10.3390/jcm11030851
Niwa Y, Kamimura K, Ogawa K, Oda C, Tanaka Y, Horigome R, Ohtsuka M, Miura H, Fujisawa K, Yamamoto N, et al. Cyclin D1 Binding Protein 1 Responds to DNA Damage through the ATM–CHK2 Pathway. Journal of Clinical Medicine. 2022; 11(3):851. https://doi.org/10.3390/jcm11030851
Chicago/Turabian StyleNiwa, Yusuke, Kenya Kamimura, Kohei Ogawa, Chiyumi Oda, Yuto Tanaka, Ryoko Horigome, Masato Ohtsuka, Hiromi Miura, Koichi Fujisawa, Naoki Yamamoto, and et al. 2022. "Cyclin D1 Binding Protein 1 Responds to DNA Damage through the ATM–CHK2 Pathway" Journal of Clinical Medicine 11, no. 3: 851. https://doi.org/10.3390/jcm11030851