Protective Effects of Orexin A in a Murine Model of Cisplatin-Induced Acute Kidney Injury
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animal Experiments
2.2. Determination of Creatinine, Blood Urea Nitrogen (BUN), and Cytokine Levels
2.3. Histological Analysis, Immunohistochemical (IHC) Staining, and Immunofluorescent (IF) Staining
2.4. Western Blot Analysis
2.5. Real-Time Reverse Transcription-Polymerase Chain Reaction (RT-PCR)
2.6. Assessment of Oxidative Stress and Antioxidant Enzyme Activities
2.7. TdT-Mediated dUTP Nick End Labeling (TUNEL) Staining
2.8. Statistical Analysis
3. Results
3.1. OXA Ameliorated Functional and Structural Kidney Damage Caused by Cisplatin
3.2. OXA Attenuated Cisplatin-Induced Oxidative Damage
3.3. OXA Inhibited Cisplatin-Induced Apoptosis
3.4. OXA Attenuated Cisplatin-Induced Inflammatory Responses
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Ronco, C.; Bellomo, R.; Kellum, J.A. Acute kidney injury. Lancet 2019, 394, 1949–1964. [Google Scholar] [CrossRef] [PubMed]
- Holditch, S.J.; Brown, C.N.; Lombardi, A.M.; Nguyen, K.N.; Edelstein, C.L. Recent Advances in Models, Mechanisms, Biomarkers, and Interventions in Cisplatin-Induced Acute Kidney Injury. Int. J. Mol. Sci. 2019, 20, 3011. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Perše, M.; Večerić-Haler, Ž. Cisplatin-Induced Rodent Model of Kidney Injury: Characteristics and Challenges. Biomed. Res. Int. 2018, 2018, 1462802. [Google Scholar] [CrossRef]
- Ozkok, A.; Edelstein, C.L. Pathophysiology of cisplatin-induced acute kidney injury. Biomed. Res. Int. 2014, 2014, 967826. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pizza, F.; Barateau, L.; Dauvilliers, Y.; Plazzi, G. The orexin story, sleep and sleep disturbances. J. Sleep Res. 2022, 31, e13665. [Google Scholar] [CrossRef]
- Zheng, H.; Patterson, L.M.; Berthoud, H.-R. Orexin-A projections to the caudal medulla and orexin-induced c-Fos expression, food intake, and autonomic function. J. Comp. Neurol. 2005, 485, 127–142. [Google Scholar] [CrossRef]
- Dale, N.C.; Hoyer, D.; Jacobson, L.H.; Pfleger, K.D.G.; Johnstone, E.K.M. Orexin Signaling: A Complex, Multifaceted Process. Front. Cell. Neurosci. 2022, 16, 812359. [Google Scholar] [CrossRef]
- Voisin, T.; Rouet-Benzineb, P.; Reuter, N.; Laburthe, M. Orexins and their receptors: Structural aspects and role in peripheral tissues. Cell. Mol. Life Sci. 2003, 60, 72–87. [Google Scholar] [CrossRef]
- Xu, D.; Kong, T.; Shao, Z.; Liu, M.; Zhang, R.; Zhang, S.; Kong, Q.; Chen, J.; Cheng, B.; Wang, C. Orexin-A alleviates astrocytic apoptosis and inflammation via inhibiting OX1R-mediated NF-κB and MAPK signaling pathways in cerebral ischemia/reperfusion injury. Biochim. Biophys. Acta Mol. Basis Dis. 2021, 1867, 166230. [Google Scholar] [CrossRef]
- Zhao, D.; Zeng, Z.; Mo, H.; Hu, W.; Tian, S.; Hu, D.; Gong, L.; Hu, K. Orexin-A inhibits cerebral ischaemic inflammatory injury mediated by the nuclear factor-κB signalling pathway and alleviates stroke-induced immunodepression in mice. Brain Res. Bull. 2021, 174, 296–304. [Google Scholar] [CrossRef]
- Li, T.; Xu, W.; Ouyang, J.; Lu, X.; Sherchan, P.; Lenahan, C.; Irio, G.; Zhang, J.H.; Zhao, J.; Zhang, Y.; et al. Orexin A alleviates neuroinflammation via OXR2/CaMKKβ/AMPK signaling pathway after ICH in mice. J. Neuroinflamm. 2020, 17, 187. [Google Scholar] [CrossRef]
- Tunisi, L.; Forte, N.; Fernández-Rilo, A.C.; Mavaro, I.; Capasso, R.; D’Angelo, L.; Milić, N.; Cristino, L.; Marzo, V.D.; Palomba, L. Orexin-A Prevents Lipopolysaccharide-Induced Neuroinflammation at the Level of the Intestinal Barrier. Front. Endocrinol. 2019, 10, 219. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Becquet, L.; Abad, C.; Leclercq, M.; Miel, C.; Jean, L.; Riou, G.; Couvineau, A.; Boyer, O.; Tan, Y.-V. Systemic administration of orexin A ameliorates established experimental autoimmune encephalomyelitis by diminishing neuroinflammation. J. Neuroinflamm. 2019, 16, 64. [Google Scholar] [CrossRef] [PubMed]
- Ogawa, Y.; Irukayama-Tomobe, Y.; Murakoshi, N.; Kiyama, M.; Ishikawa, Y.; Hosokawa, N.; Tominaga, H.; Uchida, S.; Kimura, S.; Kanuka, M.; et al. Peripherally administered orexin improves survival of mice with endotoxin shock. eLife 2016, 5, e21055. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Messal, N.; Fernandez, N.; Dayot, S.; Gratio, V.; Nicole, P.; Prochasson, C.; Chantret, I.; LeGuiloux, G.; Jarry, A.; Couvelard, A.; et al. Ectopic expression of OX1R in ulcerative colitis mediates anti-inflammatory effect of orexin-A. Biochim. Biophys. Acta Mol. Basis Dis. 2018, 1864, 3618–3628. [Google Scholar] [CrossRef]
- Kim, J.-Y.; Park, J.-H.; Kim, K.; Jo, J.; Leem, J.; Park, K.-K. Pharmacological Inhibition of Caspase-1 Ameliorates Cisplatin-Induced Nephrotoxicity through Suppression of Apoptosis, Oxidative Stress, and Inflammation in Mice. Mediat. Inflamm. 2018, 2018, 6571676. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.-Y.; Jo, J.; Kim, K.; An, H.-J.; Gwon, M.-G.; Gu, H.; Kim, H.-J.; Yang, A.Y.; Kim, S.-W.; Jeon, E.J.; et al. Pharmacological Activation of Sirt1 Ameliorates Cisplatin-Induced Acute Kidney Injury by Suppressing Apoptosis, Oxidative Stress, and Inflammation in Mice. Antioxidants 2019, 8, 322. [Google Scholar] [CrossRef] [Green Version]
- Blais, A.; Drouin, G.; Chaumontet, C.; Voisin, T.; Couvelard, A.; Even, P.C.; Couvineau, A. Impact of Orexin-A Treatment on Food Intake, Energy Metabolism and Body Weight in Mice. PLoS ONE 2017, 12, e0169908. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dayot, S.; Speisky, D.; Couvelard, A.; Bourgoin, P.; Gratio, V.; Cros, J.; Rebours, V.; Sauvanet, A.; Bedossa, P.; Paradis, V.; et al. In vitro, in vivo and ex vivo demonstration of the antitumoral role of hypocretin-1/orexin-A and almorexant in pancreatic ductal adenocarcinoma. Oncotarget 2018, 9, 6952–6967. [Google Scholar] [CrossRef] [Green Version]
- Kim, J.-Y.; Lee, S.-J.; Maeng, Y.-I.; Leem, J.; Park, K.-K. Protective Effects of Bee Venom against Endotoxemia-Related Acute Kidney Injury in Mice. Biology 2020, 9, 154. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.-Y.; Leem, J.; Hong, H.-L. Melittin Ameliorates Endotoxin-Induced Acute Kidney Injury by Inhibiting Inflammation, Oxidative Stress, and Cell Death in Mice. Oxid. Med. Cell. Longev. 2021, 2021, 8843051. [Google Scholar] [CrossRef]
- Fu, S.; Hu, X.; Ma, Z.; Wei, Q.; Xiang, X.; Li, S.; Wen, L.; Liang, Y.; Dong, Z. p53 in Proximal Tubules Mediates Chronic Kidney Problems after Cisplatin Treatment. Cells 2022, 11, 712. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.-Y.; Leem, J.; Hong, H.-L. Protective Effects of SPA0355, a Thiourea Analogue, Against Lipopolysaccharide-Induced Acute Kidney Injury in Mice. Antioxidants 2020, 9, 585. [Google Scholar] [CrossRef] [PubMed]
- Haase-Feilitz, A.; Haase, M.; Devarajan, P. Neutrophil gelatinase-associated lipocalin as a biomarker of acute kidney injury: A critical evaluation of current status. Ann. Clin. Biochem. 2014, 51, 335–351. [Google Scholar] [CrossRef] [Green Version]
- Kim, J.-Y.; Hong, H.-L.; Kim, G.M.; Leem, J.; Kwon, H.H. Protective Effects of Carnosic Acid on Lipopolysaccharide-Induced Acute Kidney Injury in Mice. Molecules 2021, 26, 7589. [Google Scholar] [CrossRef] [PubMed]
- Zhang, C.; Abdukerim, M.; Abilailieti, M.; Tang, L.; Ling, Y.; Pan, S. The protective effects of orexin a against high glucose-induced activation of NLRP3 inflammasome in human vascular endothelial cells. Arch. Biochem. Biophys. 2019, 672, 108052. [Google Scholar] [CrossRef] [PubMed]
- Kim, M.-K.; Park, H.-J.; Kim, S.-R.; Choi, Y.K.; Bae, S.-K.; Bae, M.-K. Involvement of Heme Oxygenase-1 in Orexin-A-induced Angiogenesis in Vascular Endothelial Cells. Korean J. Physiol. Pharmacol. 2015, 19, 327–334. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kim, J.-Y.; Leem, J.; Park, K.-K. Antioxidative, Antiapoptotic, and Anti-Inflammatory Effects of Apamin in a Murine Model of Lipopolysaccharide-Induced Acute Kidney Injury. Molecules 2020, 25, 5717. [Google Scholar] [CrossRef]
- Gwon, M.-G.; Gu, H.; Leem, J.; Park, K.-K. Protective Effects of 6-Shogaol, an Active Compound of Ginger, in a Murine Model of Cisplatin-Induced Acute Kidney Injury. Molecules 2021, 26, 5931. [Google Scholar] [CrossRef] [PubMed]
- Kim, K.; Leem, J. Hispidulin Ameliorates Endotoxin-Induced Acute Kidney Injury in Mice. Molecules 2022, 27, 2019. [Google Scholar] [CrossRef] [PubMed]
- Yang, Q.; Wu, F.-R.; Wang, J.-N.; Gao, L.; Jiang, L.; Li, H.-D.; Ma, Q.; Liu, X.-Q.; Wei, B.; Zhou, L.; et al. Nox4 in renal diseases: An update. Free Radic. Biol. Med. 2018, 124, 466–472. [Google Scholar] [CrossRef] [PubMed]
- Meng, X.-M.; Ren, G.-L.; Gao, L.; Yang, Q.; Li, H.-D.; Wu, W.-F.; Huang, C.; Zhang, L.; Lv, X.-W.; Li, J. NADPH oxidase 4 promotes cisplatin-induced acute kidney injury via ROS-mediated programmed cell death and inflammation. Lab. Investig. 2018, 98, 63–78. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kim, J.-Y.; Jo, J.; Leem, J.; Park, K.-K. Kahweol Ameliorates Cisplatin-Induced Acute Kidney Injury through Pleiotropic Effects in Mice. Biomedicines 2020, 8, 572. [Google Scholar] [CrossRef] [PubMed]
- Thongnuanjan, P.; Soodvilai, S.; Fongsupa, S.; Thipboonchoo, N.; Chabang, N.; Munyoo, B.; Tuchinda, P.; Soodvilai, S. Panduratin A Derivative Protects against Cisplatin-Induced Apoptosis of Renal Proximal Tubular Cells and Kidney Injury in Mice. Molecules 2021, 26, 6642. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.W.; Jo, J.; Kim, J.-Y.; Choe, M.; Leem, J.; Park, J.-H. Melatonin Attenuates Cisplatin-Induced Acute Kidney Injury through Dual Suppression of Apoptosis and Necroptosis. Biology 2019, 8, 64. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kim, J.-Y.; Leem, J.; Jeon, E.J. Protective Effects of Melatonin Against Aristolochic Acid-Induced Nephropathy in Mice. Biomolecules 2020, 10, 11. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mukhopadhyay, P.; Horváth, B.; Kechrid, M.; Tanchian, G.; Rajesh, M.; Naura, A.S.; Boulares, A.H.; Pacher, P. Poly(ADP-ribose) polymerase-1 is a key mediator of cisplatin-induced kidney inflammation and injury. Free Radic. Biol. Med. 2011, 51, 1774–1788. [Google Scholar] [CrossRef] [Green Version]
- Gu, H.; Gwon, M.-G.; Kim, J.H.; Leem, J.; Lee, S.-J. Oridonin Attenuates Cisplatin-Induced Acute Kidney Injury via Inhibiting Oxidative Stress, Apoptosis, and Inflammation in Mice. Biomed. Res. Int. 2022, 2022, 3002962. [Google Scholar] [CrossRef] [PubMed]
- Xu, D.; Kong, T.; Cheng, B.; Zhang, R.; Yang, C.; Chen, J.; Wang, C. Orexin-A alleviates cerebral ischemia-reperfusion injury by inhibiting endoplasmic reticulum stress-mediated apoptosis. Mol. Med. Rep. 2021, 23, 266. [Google Scholar] [CrossRef] [PubMed]
- Kong, T.; Qiu, K.; Liu, M.; Cheng, B.; Pan, Y.; Yang, C.; Chen, J.; Wang, C. Orexin-A protects against oxygen-glucose deprivation/reoxygenation-induced cell damage by inhibiting endoplasmic reticulum stress-mediated apoptosis via the Gi and PI3K signaling pathways. Cell. Signal. 2019, 62, 109348. [Google Scholar] [CrossRef]
- Duffy, C.M.; Nixon, J.P.; Butterick, T.A. Orexin A attenuates palmitic acid-induced hypothalamic cell death. Mol. Cell. Neurosci. 2016, 75, 93–100. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kim, J.-Y.; Jo, J.; Leem, J.; Park, K.-K. Inhibition of p300 by Garcinol Protects against Cisplatin-Induced Acute Kidney Injury through Suppression of Oxidative Stress, Inflammation, and Tubular Cell Death in Mice. Antioxidants 2020, 9, 1271. [Google Scholar] [CrossRef] [PubMed]
- Volarevic, V.; Djokovic, B.; Jankovic, M.G.; Harrell, C.R.; Fellabaum, C.; Djonov, V.; Arsenijevic, N. Molecular mechanisms of cisplatin-induced nephrotoxicity: A balance on the knife edge between renoprotection and tumor toxicity. J. Biomed. Sci. 2019, 26, 25. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ramesh, G.; Reeves, W.B. TNF-alpha mediates chemokine and cytokine expression and renal injury in cisplatin nephrotoxicity. J. Clin. Investig. 2002, 110, 835–842. [Google Scholar] [CrossRef] [PubMed]
- Meng, H.; Fu, G.; Shen, J.; Shen, K.; Xu, Z.; Wang, Y.; Jin, B.; Pan, H. Ameliorative Effect of Daidzein on Cisplatin-Induced Nephrotoxicity in Mice via Modulation of Inflammation, Oxidative Stress, and Cell Death. Oxid. Med. Cell. Longev. 2017, 2017, 3140680. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tracey, K.J. The inflammatory reflex. Nature 2002, 420, 853–859. [Google Scholar] [CrossRef]
- Wang, Y.; Liu, S.; Liu, Q.; Lv, Y. The Interaction of Central Nervous System and Acute Kidney Injury: Pathophysiology and Clinical Perspectives. Front. Physiol. 2022, 13, 826686. [Google Scholar] [CrossRef]
Gene | Primer Sequence (5′→3′) | Accession No. |
---|---|---|
NOX4 | F: CCCAAGTTCCAAGCTCATTTCC R: TGGTGACAGGTTTGTTGCTCCT | NM_015760 |
Catalase | F: CAAGTACAACGCTGAGAAGCCTAAG R: CCCTTCGCAGCCATGTG | NM_009804 |
SOD2 | F: AACTCAGGTCGCTCTTCAGC R: CTCCAGCAACTCTCCTTTGG | NM_0136671 |
GPx | F: GCAATCAGTTCGGACACCAG R: CACCATTCACTTCGCACTTCTC | NM_008160 |
TNF-α | F: CACAGAAAGCATGATCCGCGACGT R: CGGCAGAGAGGAGGTTGACTTTCT | NM_013693 |
IL-6 | F: TAGTCCTTCCTACCCCAATTTCC R: TTGGTCCTTAGCCACTCCTTC | NM_031168 |
IL-1β | F: CGCAGCAGCACATCAACAAGAGC R: TGTCCTCATCCTGGAAGGTCCACG | NM_008361 |
MCP-1 | F: TAAAAACCTGGATCGGAACCAA R: GCATTAGCTTCAGATTTACGGGT | NM_011333 |
GAPDH | F: ACTCCACTCACGGCAAATTC R: TCTCCATGGTGGTGAAGACA | NM_001289726 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jo, J.; Kim, J.-Y.; Leem, J. Protective Effects of Orexin A in a Murine Model of Cisplatin-Induced Acute Kidney Injury. J. Clin. Med. 2022, 11, 7196. https://doi.org/10.3390/jcm11237196
Jo J, Kim J-Y, Leem J. Protective Effects of Orexin A in a Murine Model of Cisplatin-Induced Acute Kidney Injury. Journal of Clinical Medicine. 2022; 11(23):7196. https://doi.org/10.3390/jcm11237196
Chicago/Turabian StyleJo, Jungmin, Jung-Yeon Kim, and Jaechan Leem. 2022. "Protective Effects of Orexin A in a Murine Model of Cisplatin-Induced Acute Kidney Injury" Journal of Clinical Medicine 11, no. 23: 7196. https://doi.org/10.3390/jcm11237196
APA StyleJo, J., Kim, J.-Y., & Leem, J. (2022). Protective Effects of Orexin A in a Murine Model of Cisplatin-Induced Acute Kidney Injury. Journal of Clinical Medicine, 11(23), 7196. https://doi.org/10.3390/jcm11237196