Fixed Orthodontic Treatment Increases Cariogenicity and Virulence Gene Expression in Dental Biofilm
Abstract
1. Introduction
2. Materials and Methods
2.1. Participants and Background
2.2. Sample Size Calculation
2.3. Questionnaire and Food Diary
2.4. Dental Biofilm Staining
2.5. Dental Biofilm Collection
2.6. Determination of Gene Expression by Real-Time PCR
2.7. Statistical Analysis
3. Results
3.1. The Study Population
3.2. Dental Biofilm Maturity
3.3. Cariogenic Virulence Gene Expression in Dental Biofilm
3.4. Association between PMS and Virulence Gene Expression Level
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Butera, A.; Maiorani, C.; Morandini, A.; Simonini, M.; Morittu, S.; Trombini, J.; Scribante, A. Evaluation of children caries risk factors: A narrative review of nutritional aspects, oral hygiene habits, and bacterial alterations. Children 2022, 9, 262. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Marsh, P.D.; Head, D.A.; Devine, D.A. Dental plaque as a biofilm and a microbial community—Implications for treatment. J. Oral Biosci. 2015, 57, 185–191. [Google Scholar] [CrossRef] [Scilit]
- Kutsch, V.K. Dental caries: An updated medical model of risk assessment. J. Prosthet. Dent. 2014, 111, 280–285. [Google Scholar] [CrossRef] [Scilit]
- Nyvad, B.; Crielaard, W.; Mira, A.; Takahashi, N.; Beighton, D. Dental caries from a molecular microbiological perspective. Caries Res. 2013, 47, 89–102. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sundararaj, D.; Venkatachalapathy, S.; Tandon, A.; Pereira, A. Critical evaluation of incidence and prevalence of white spot lesions during fixed orthodontic appliance treatment: A meta-analysis. J. Int. Soc. Prev. Community Dent. 2015, 5, 433–439. [Google Scholar] [PubMed]
- Brown, M.D.; Campbell, P.M.; Schneiderman, E.D.; Buschang, P.H. A practice-based evaluation of the prevalence and predisposing etiology of white spot lesions. Angle Orthod. 2016, 86, 181–186. [Google Scholar] [CrossRef] [Scilit]
- Hadler-Olsen, S.; Sandvik, K.; El-Agroudi, M.A.; Ogaard, B. The incidence of caries and white spot lesions in orthodontically treated adolescents with a comprehensive caries prophylactic regimen—A prospective study. Eur. J. Orthod. 2012, 34, 633–639. [Google Scholar] [CrossRef] [Scilit]
- Freitas, A.O.; Marquezan, M.; Mda, C.N.; Alviano, D.S.; Maia, L.C. The influence of orthodontic fixed appliances on the oral microbiota: A systematic review. Dent. Press J. Orthod. 2014, 19, 46–55. [Google Scholar] [CrossRef] [Scilit]
- Sawhney, R.; Sharma, R.; Sharma, K. Microbial colonization on elastomeric ligatures during orthodontic therapeutics: An overview. Turk. J. Orthod. 2018, 31, 21–25. [Google Scholar] [CrossRef] [Scilit]
- You, Y.-O. Virulence genes of Streptococcus mutans and dental caries. Int. J. Oral Biol. 2019, 44, 31–36. [Google Scholar] [CrossRef] [Scilit]
- Banas, J.A.; Vickerman, M.M. Glucan-binding proteins of the oral streptococci. Crit. Rev. Oral Biol. Med. 2003, 14, 89–99. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, J.; Deng, D.; Brandt, B.W.; Nazmi, K.; Wu, Y.; Crielaard, W.; Ligtenberg, A.J.M. Diversity of SpaP in genetic and salivary agglutinin mediated adherence among Streptococcus mutans strains. Sci. Rep. 2019, 9, 19943. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bowen, W.H.; Koo, H. Biology of Streptococcus mutans-derived glucosyltransferases: Role in extracellular matrix formation of cariogenic biofilms. Caries Res. 2011, 45, 69–86. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nishimura, J.; Saito, T.; Yoneyama, H.; Bai, L.L.; Okumura, K.; Isogai, E. Biofilm formation by Streptococcus mutans and related bacteria. Adv. Microbiol. 2012, 2, 208–215. [Google Scholar] [CrossRef]
- Bitoun, J.P.; Liao, S.; Yao, X.; Ahn, S.J.; Isoda, R.; Nguyen, A.H.; Brady, L.J.; Burne, R.A.; Abranches, J.; Wen, Z.T. BrpA is involved in regulation of cell envelope stress responses in Streptococcus mutans. Appl. Environ. Microbiol. 2012, 78, 2914–2922. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lemos, J.A.; Burne, R.A. A model of efficiency: Stress tolerance by Streptococcus mutans. Microbiology 2008, 154, 3247–3255. [Google Scholar] [CrossRef] [Scilit]
- Wen, Z.T.; Baker, H.V.; Burne, R.A. Influence of BrpA on critical virulence attributes of Streptococcus mutans. J. Bacteriol. 2006, 188, 2983–2992. [Google Scholar] [CrossRef] [Scilit]
- Wen, Z.T.; Nguyen, A.H.; Bitoun, J.P.; Abranches, J.; Baker, H.V.; Burne, R.A. Transcriptome analysis of LuxS-deficient Streptococcus mutans grown in biofilms. Mol. Oral Microbiol. 2011, 26, 2–18. [Google Scholar] [CrossRef] [Scilit]
- Yoshida, A.; Ansai, T.; Takehara, T.; Kuramitsu, H.K. LuxS-based signaling affects Streptococcus mutans biofilm formation. Appl. Environ. Microbiol. 2005, 71, 2372–2380. [Google Scholar] [CrossRef] [Scilit]
- Mira, A. Oral microbiome studies: Potential diagnostic and therapeutic implications. Adv. Dent. Res. 2018, 29, 71–77. [Google Scholar] [CrossRef] [Scilit]
- Pretty, I.A.; Edgar, W.M.; Smith, P.W.; Higham, S.M. Quantification of dental plaque in the research environment. J. Dent. 2005, 33, 193–207. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wei, S.H.Y.; Lang, N.P. Periodontal epidemiological indices for children and aldolescents: II Evaluation of oral hygiene; III Clinical applications. Pediatr. Dent. 1982, 4, 64–73. [Google Scholar] [PubMed]
- Al-Anezi, S.A.; Harradine, N.W. Quantifying plaque during orthodontic treatment. Angle Orthod. 2012, 82, 748–753. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Oikonomou, E.; Foros, P.; Tagkli, A.; Rahiotis, C.; Eliades, T. Impact of aligners and fixed appliances on oral Health duringo rthodontic treatment: A systematic review and meta-analysis. Oral Health Prev. Dent. 2021, 19, 659–672. [Google Scholar]
- Kozak, U.; Lasota, A.; Chalas, R. Changes in distribution of dental biofilm after insertion of fixed orthodontic appliances. J. Clin. Med. 2021, 10, 5638. [Google Scholar] [CrossRef] [Scilit]
- Walsh, L.J.; Healey, D.L. Prevention and caries risk management in teenage and orthodontic patients. Aust. Dent. J. 2019, 64 (Suppl. S1), S37–S45. [Google Scholar] [CrossRef] [Scilit]
- Jayanthi, M.; Shilpapriya, M.; Reddy, V.N.; Elangovan, A.; Sakthivel, R.; Vijayakumar, P. Efficacy of three-tone disclosing agent as an adjunct in caries risk assessment. Contemp. Clin. Dent. 2015, 6, 358–363. [Google Scholar] [CrossRef] [Scilit]
- Schulz, K.F.; Altman, D.G.; Mother, D. CONSORT 2010 Statement: Updated guidelines for reporting parallel group randomised trials. J. Pharmacol. Pharmacother. 2010, 1, 100–107. [Google Scholar] [CrossRef] [Scilit]
- Ferreira, J.C.; Patino, C.M. Types of outcomes in clinical research. J. Bras. Pneumol. 2017, 43, 5. [Google Scholar] [CrossRef] [Scilit]
- Pannuti, C.M.; Sendyk, D.I.; GraCas, Y.T.D.; Takai, S.L.; SabOia, V.P.A.; Romito, G.A.; Mendes, F.M. Clinically relevant outcomes in dental clinical trials: Challenges and proposals. Braz. Oral Res. 2020, 34 (Suppl. S2), e073. [Google Scholar] [CrossRef] [Scilit]
- Lakens, D. Calculating and reporting effect sizes to facilitate cumulative science: A practical primer for t-tests and ANOVAs. Front. Psychol. 2013, 4, 863. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, Y.J.; Kim, M.K.; Hwang, S.H.; Ahn, Y.; Shim, J.E.; Kim, D.H. Relative validities of 3-day food records and the food frequency questionnaire. Nutr. Res. Pract. 2010, 4, 142–148. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wongkamhaeng, K.; Poachanukoon, O.; Koontongkaew, S. Dental caries, cariogenic microorganisms and salivary properties of allergic rhinitis children. Int. J. Pediatr. Otorhinolaryngol. 2014, 78, 860–865. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Brostek, A.M.; Walsh, L.J. Minimal intervention dentistry in general practice. Oral Health Dent. Manag. 2014, 13, 285–294. [Google Scholar] [PubMed]
- Widhianingsih, D.; Koontongkaew, S. Enhancement of cariogenic virulence properties of dental plaque in asthmatics. J. Asthma. 2021, 58, 1051–1057. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wen, Z.T.; Yates, D.; Ahn, S.-J.; Burne, R.A. Biofilm formation and virulence expression by Streptococcus mutans are altered when grown in dual-species model. BMC Microbiol. 2010, 10, 111. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Utispan, K.; Chitkul, B.; Monthanapisut, P.; Meesuk, L.; Pugdee, K.; Koontongkaew, S. Propolis extracted from the stingless bee Trigona sirindhornae Inhibited S. mutans activity in vitro. Oral Health Prev. Dent. 2017, 15, 279–284. [Google Scholar]
- Zhao, B.; Erwin, A.; Xue, B. How many differentially expressed genes: A perspective from the comparison of genotypic and phenotypic distances. Genomics 2018, 110, 67–73. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, J.H. Multicollinearity and misleading statistical results. Korean J. Anesthesiol. 2019, 72, 558–569. [Google Scholar] [CrossRef] [Scilit]
- Pitts, N.B.; Zero, D.T.; Marsh, P.D.; Ekstrand, K.; Weintraub, J.A.; Ramos-Gomez, F.; Tagami, J.; Twetman, S.; Tsakos, G.; Ismail, A. Dental caries. Nat. Rev. Dis. Prim. 2017, 3, 17030. [Google Scholar] [CrossRef] [Scilit]
- Marsh, P.D. Dental plaque as a biofilm and a microbial community—Implications for health and disease. BMC Oral Health 2006, 6 (Suppl. S1), S14. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, J.; Park, H.; Lee, J.; Seo, H.; Lee, S. Study of bacteria associated with dental daries using a 3 tone disclosing agent. J. Korean Acad. Pediatr. Dent. 2018, 45, 32–40. [Google Scholar]
- Alavaikko, S.; Jaakkola, M.S.; Tjaderhane, L.; Jaakkola, J.J. Asthma and caries: A systematic review and meta-analysis. Am. J. Epidemiol. 2011, 174, 631–641. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Len, A.C.L.; Harty, D.W.S.; Jacques, N.A. Proteome analysis of Streptococcus mutans metabolic phenotype during acid tolerance. Microbiology 2004, 150, 1353–1366. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bowen, W.H.; Burne, R.A.; Wu, H.; Koo, H. Oral Biofilms: Pathogens, matrix, and polymicrobial interactions in microenvironments. Trends Microbiol. 2018, 26, 229–242. [Google Scholar] [CrossRef] [Scilit]
- Bowen, W.H.; Schilling, K.; Giertsen, E.; Pearson, S.; Lee, S.F.; Bleiweis, A.; Beeman, D. Role of a cell surface-associated protein in adherence and dental caries. Infect. Immun. 1991, 59, 4606–4609. [Google Scholar] [CrossRef] [Scilit]
- Niazy, A.A. LuxS quorum sensing system and biofilm formation of oral microflora: A short review article. Saudi Dent. J. 2021, 33, 116–123. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Q.; Ma, Q.; Wang, Y.; Wu, H.; Zou, J. Molecular mechanisms of inhibiting glucosyltransferases for biofilm formation in Streptococcus mutans. Int. J. Oral Sci. 2021, 13, 30. [Google Scholar] [CrossRef] [Scilit]
- Cury, J.A.; Rebelo, M.A.; Del Bel Cury, A.A.; Derbyshire, M.T.; Tabchoury, C.P. Biochemical composition and cariogenicity of dental plaque formed in the presence of sucrose or glucose and fructose. Caries Res. 2000, 34, 491–497. [Google Scholar] [CrossRef] [Scilit]
- Wolff, M.P.; Larson, C. The cariogenic dental biofilm: Good, bad or just something to control? Braz. Oral Res. 2009, 23, 31–38. [Google Scholar] [CrossRef] [Scilit]
- Ngo, H.C.; Wolff, M.S.; Hume, W.R. Dental caries: Activity and risk assessments as a logical and effective path to both prevention and cure. In Preservation and Restoration of Tooth Structure, 3rd ed.; John Wiley & Sons: Chichester, UK, 2016; pp. 33–49. [Google Scholar]
- Raju, A.S.; Hegde, N.A.; Reddy, V.P.; Chandrashekar, B.S.; Mahendra, S.; Harishkoushik, S.R. An in vivo study on bacterial colonization with metal, ceramic and self-ligating brackets: A scanning ekectron microscopy study. J. Indian Orthod. Soc. 2013, 47, 88–96. [Google Scholar] [CrossRef] [Scilit]
- Butera, A.; Pascadopoli, M.; Gallo, S.; Lelli, M.; Tarterini, F.; Giglia, F.; Scribante, A. SEM/EDS evaluation of the mineral deposition on a polymeric composite resin of a toothpaste containing biomimetic Zn-carbonate hydroxyapatite (microRepair (R)) in oral environment: A Randomized Clinical Trial. Polymers 2021, 13, 2740. [Google Scholar] [CrossRef] [Scilit] [PubMed]




| Primers | Forward Primers (5′–3′) | Reverse Primers (5′–3′) | Size (bp) |
|---|---|---|---|
| gtfB | AGCAATGCAGCCATCTACAAAT | ACGAACTTTGCCGTTATTGTCA | 98 |
| ldh | TTGGCGACGCTCTTGATCTTAG | GTCAGCATCCGCACAGTCTTC | 92 |
| brpA | CGTGAGGTCATCAGCAAGGTC | CGCTGTACCCCAAAAGTTTAGG | 148 |
| spaP | TCCGCTTATACAGGTCAAGTTG | GAGAAGCTACTGATAGAAGGGC | 121 |
| luxS | ACTGTTCCCCTTTTGGCTGTC | AACTTGCTTTGATGACTGTGGC | 93 |
| gbpB | CGTGTTTCGGCTATTCGTGAAG | TGCTGCTTGATTTTCTTGTTGC | 108 |
| 16S rRNA | TCCACGCCGTAAACGATGA | TTGTGCGGCCCCCGT | 119 |
| Variables | Values |
|---|---|
| Demographic characteristics | |
| Age (years) Mean ± SD Min–Max | 27.21 ± 6.45 14–41 |
| Sex Male, n (%) Female, n (%) | 12 (50%) 12 (50%) |
| Orthodontic treatment duration | |
| Fixed orthodontic therapy follow-up (months) Mean ± SD Min–Max | 7.74 ± 0.63 6.46–8.70 |
| Oral hygiene practices | |
| Tooth brushing frequency, n (%) 1 time a day ≥2 times a day | 1 (4.7) 23 (95.83) |
| Use of dental floss, n (%) Daily Occasionally No | 4 (16.67) 15 (62.5) 5 (20.83) |
| Use an interdental brush, n (%) Daily Occasionally No | 9 (37.5) 15 (62.5) 0 (0) |
| Use a fluoride toothpaste, n (%) Yes No | 24 (100) 0 (0) |
| Use mouthwash, n (%) Yes No | 13 (54.17) 11 (45.83) |
| Dietary habits | |
| Sugary intake between meals/day (Median and range) | 0.90 (0–3) |
| Acidic food intake between meals/day (Median and rage) | 0 (0–0.4) |
| Predictor Variables | Coefficients | p-Value | Collinearity Statistics | ||
|---|---|---|---|---|---|
| Unstandardized Coefficient (B) | Coefficients Standard Error | Tolerance | VIF | ||
| gtfB | −1.15 | 1.2 | 0.35 | 0.88 | 1.14 |
| ldh | −0.19 | 0.44 | 0.67 | 0.49 | 2.06 |
| brpA | −0.71 | 0.16 | 0.65 | 0.39 | 2.56 |
| spaP | −16.37 | 23.1 | 0.49 | 0.98 | 1.02 |
| luxS | −2.45 | 1.71 | 0.17 | 0.96 | 1.04 |
| gbpB | 0.14 | 0.59 | 0.82 | 0.68 | 1.46 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Thanetchaloempong, W.; Koontongkaew, S.; Utispan, K. Fixed Orthodontic Treatment Increases Cariogenicity and Virulence Gene Expression in Dental Biofilm. J. Clin. Med. 2022, 11, 5860. https://doi.org/10.3390/jcm11195860
Thanetchaloempong W, Koontongkaew S, Utispan K. Fixed Orthodontic Treatment Increases Cariogenicity and Virulence Gene Expression in Dental Biofilm. Journal of Clinical Medicine. 2022; 11(19):5860. https://doi.org/10.3390/jcm11195860
Chicago/Turabian StyleThanetchaloempong, Watcharawee, Sittichai Koontongkaew, and Kusumawadee Utispan. 2022. "Fixed Orthodontic Treatment Increases Cariogenicity and Virulence Gene Expression in Dental Biofilm" Journal of Clinical Medicine 11, no. 19: 5860. https://doi.org/10.3390/jcm11195860
APA StyleThanetchaloempong, W., Koontongkaew, S., & Utispan, K. (2022). Fixed Orthodontic Treatment Increases Cariogenicity and Virulence Gene Expression in Dental Biofilm. Journal of Clinical Medicine, 11(19), 5860. https://doi.org/10.3390/jcm11195860

