Genetic Testing for a Patient with Suspected 3 Beta-Hydroxysteroid Dehydrogenase Deficiency: A Case of Unreported Genetic Variants
Abstract
1. Introduction
2. Case Report
2.1. Patients, Clinical Presentation and Hormonal Analysis
2.1.1. Patient n.1
2.1.2. Patient n.2
3. Materials and Methods
3.1. Hormonal Testing
3.2. DNA Sequencing
3.3. In Silico Analysis
- Alamut v1.4 (http://www.interactive-biosoftware.com (accessed on 8 June 2022));
- Varsome 11.3 (https://varsome.com/ (accessed on 8 June 2022));
- Franklin by Geeox (https://help.genoox.com/en/collections/2077313-franklin-variant-interpretation (accessed on 8 June 2022)).
- MetaLR;
- REVEL;
- DEOGEN2;
- FATHMM;
- M-CAP;
- MVP;
- MutPred;
- Mutation assessor;
- PROVEAN;
- SIFT4G;
- PolyPhen2.
- SpliteSiteFinder;
- MaxEntScan;
- NNSPLICE;
- GeneSplicer.
4. Results
4.1. HSD3B2 c.370 A>G p.Ser124Gly
- Alamut: variant of uncertain significance (PM1, PM2, BP4);
- Varsome: variant of uncertain significance (PM2, PP3);
- Franklin: variant of uncertain significance, likely pathogenic (PM2, PM1 e PP2).
4.2. HSD3B2 c.308-6 G>A
- MaxEnt: −67.1%
- NNSPLICE: −0.9%
- SSF: −100.0%
5. Discussion
6. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Lorence, M.C.; Murry, B.A.; Trant, J.M.; Mason, J.I. Human 3 beta-hydroxysteroid dehydrogenase/delta 5—4isomerase from placenta: Expression in nonsteroidogenic cells of a protein that catalyses the dehydrogenation/isomerisation of C21 and C19 steroids. Endocrinology 1990, 126, 2493–2498. Available online: https://pubmed.ncbi.nlm.nih.gov/2139411/ (accessed on 31 May 2022). [CrossRef]
- Lachance, Y.; Van Luu-The Labrie, C.; Simard, J.; Dumont, M.; De Launoit, Y.; Guerin, S.; Leblanc, G.; Labrie, F. Characterization of human 3 beta-hydroxysteroid dehydrogenase/delta 5-delta 4-isomerase gene and its expression in mammalian cells. J. Biol. Chem. 1990, 265, 20469–20475. Available online: http://www.jbc.org/article/S0021925817305288/fulltext (accessed on 31 May 2022). [CrossRef]
- Simard, J.; Ricketts, M.L.; Gingras, S.; Soucy, P.; Feltus, F.A.; Melner, M.H. Molecular biology of the 3beta-hydroxysteroid dehydrogenase/delta5-delta4 isomerase gene family. Endocr. Rev. 2005, 26, 525–582. Available online: https://pubmed.ncbi.nlm.nih.gov/15632317/ (accessed on 1 June 2022). [CrossRef]
- Wang, L.; Salavaggione, E.; Pelleymounter, L.; Eckloff, B.; Wieben, E.; Weinshilboum, R. Human 3beta-hydroxysteroid dehydrogenase types 1 and 2: Gene sequence variation and functional genomics. J. Steroid Biochem. Mol. Biol. 2007, 107, 88–99. Available online: https://pubmed.ncbi.nlm.nih.gov/17689071/ (accessed on 1 June 2022). [CrossRef][Green Version]
- Lachance, Y.; Luu-the, V.; Verreault, H.; Dumont, M.; Rhéaume, E.; Leblanc, G.; Labrie, F. Structure of the human type II 3 beta-hydroxysteroid dehydrogenase/delta 5-delta 4 isomerases (3 beta-HSD) gene: Adrenal and gonadal specificity. DNA Cell Biol. 1991, 10, 701–711. Available online: https://pubmed.ncbi.nlm.nih.gov/1741954/ (accessed on 1 June 2022). [CrossRef]
- Baquedano, M.S.; Guercio, G.; Costanzo, M.; Marino, R.; Rivarola, M.A.; Belgorosky, A. Mutation of HSD3B2 Gene and Fate of Dehydroepiandrosterone. Vitam. Horm. 2018, 108, 75–123. Available online: https://pubmed.ncbi.nlm.nih.gov/30029738/ (accessed on 7 June 2022).
- Baquedano, M.S.; Ciaccio, M.; Marino, R.; Garrido, N.P.; Ramirez, P.; Maceiras, M.; Turjanski, A.; Defelipe, L.A.; Rivarola, M.A.; Belgorosky, A. A novel missense mutation in the HSD3B2 gene, underlying nonsalt-wasting congenital adrenal hyperplasia. New insight into the structure-function relationships of 3β-hydroxysteroid dehydrogenase type II. J. Clin. Endocrinol. Metab. 2015, 100, E191–E196. Available online: https://pubmed.ncbi.nlm.nih.gov/25322271/ (accessed on 7 June 2022). [CrossRef]
- Guran, T.; Kara, C.; Yildiz, M.; Bitkin, E.C.; Haklar, G.; Lin, J.C.; Keskin, M.; Barnard, L.; Anik, A.; Catli, G.; et al. Revisiting Classical 3β-hydroxysteroid Dehydrogenase 2 Deficiency: Lessons from 31 Pediatric Cases. J. Clin. Endocrinol. Metab. 2020, 105, E1718–E1728. Available online: https://pubmed.ncbi.nlm.nih.gov/31950145/ (accessed on 7 June 2022). [CrossRef]
- Wang, W.; Han, R.; Yang, Z.; Zheng, S.; Li, H.; Wan, Z.; Qi, Y.; Sun, S.; Ye, L.; Ning, G. Targeted gene panel sequencing for molecular diagnosis of congenital adrenal hyperplasia. J. Steroid Biochem. Mol. Biol. 2021, 211, 105899. [Google Scholar] [CrossRef]
- Simard, J.; Moisan, A.M.; Morel, Y. Congenital adrenal hyperplasia due to 3beta-hydroxysteroid dehydrogenase/Delta(5)-Delta(4) isomerase deficiency. Semin. Reprod. Med. 2002, 20, 255–276. Available online: https://pubmed.ncbi.nlm.nih.gov/12428206/ (accessed on 8 June 2022). [CrossRef]
- Turcu, A.; Smith, J.M.; Auchus, R.; Rainey, W.E. Adrenal androgens and androgen precursors-definition, synthesis, regulation and physiologic actions. Compr. Physiol. 2014, 4, 1369–1381. Available online: https://pubmed.ncbi.nlm.nih.gov/25428847/ (accessed on 8 June 2022).
- Rainey, W.E.; Nakamura, Y. Regulation of the adrenal androgen biosynthesis. J. Steroid Biochem. Mol. Biol. 2008, 108, 281–286. Available online: https://pubmed.ncbi.nlm.nih.gov/17945481/ (accessed on 8 June 2022). [CrossRef]
- Al Alawi, A.M.; Nordenström, A.; Falhammar, H. Clinical perspectives in congenital adrenal hyperplasia due to 3β-hydroxysteroid dehydrogenase type 2 deficiency. Endocrine 2019, 63, 407–421. Available online: https://pubmed.ncbi.nlm.nih.gov/30719691/ (accessed on 15 June 2022). [CrossRef]
- Podgórski, R.; Aebisher, D.; Stompor, M.; Podgórska, D.; Mazur, A. Congenital adrenal hyperplasia: Clinical symptoms and diagnostic methods. Acta Biochim. Pol. 2018, 65, 25–33. Available online: https://pubmed.ncbi.nlm.nih.gov/29543924/ (accessed on 15 June 2022). [CrossRef]
- Miller, W.L.; Auchus, R.J. The molecular biology, biochemistry, and physiology of human steroidogenesis and its disorders. Endocr. Rev. 2011, 32, 81–151. Available online: https://pubmed.ncbi.nlm.nih.gov/21051590/ (accessed on 5 July 2022). [CrossRef]
- Baronio, F.; Ortolano, R.; Menabò, S.; Cassio, A.; Baldazzi, L.; Di Natale, V.; Tonti, G.; Vestrucci, B.; Balsamo, A. 46,XX DSD due to Androgen Excess in Monogenic Disorders of Steroidogenesis: Genetic, Biochemical, and Clinical Features. Int. J. Mol. Sci. 2019, 20, 4605. Available online: https://pubmed.ncbi.nlm.nih.gov/31533357/ (accessed on 5 July 2022). [CrossRef]
- Johannsen, T.H.; Mallet, D.; Dige-Petersen, H.; Müller, J.; Main, K.M.; Morel, Y.; Forest, M.G. Delayed diagnosis of congenital adrenal hyperplasia with salt wasting due to type II 3beta-hydroxysteroid dehydrogenase deficiency. J. Clin. Endocrinol. Metab. 2005, 90, 2076–2080. Available online: https://pubmed.ncbi.nlm.nih.gov/15671104/ (accessed on 5 July 2022). [CrossRef]
- Einaudi, S.; Napolitano, E.; Restivo, F.; Motta, G.; Baldi, M.; Tuli, G.; Grosso, E.; Migone, N.; Menegatti, E.; Manieri, C. Genotype, phenotype and hormonal levels correlation in non-classical congenital adrenal hyperplasia. J. Endocrinol. Investig. 2011, 34, 660–664. Available online: https://pubmed.ncbi.nlm.nih.gov/21169730/ (accessed on 29 July 2022).
- Richards, S.; Aziz, N.; Bale, S.; Bick, D.; Das, S.; Gautier-Foster, J.; Grody, W.W.; Hegde, M.; Lyon, E.; Spector, E.; et al. Standards and guidelines for the interpretation of sequence variants: A joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet. Med. 2015, 17, 405–424. Available online: https://pubmed.ncbi.nlm.nih.gov/25741868/ (accessed on 22 July 2022). [CrossRef]
- Yang, J.; Yan, R.; Roy, A.; Xu, D.; Poisson, J.; Zhang, Y. The I-TASER Suite: Protein structure and function prediction. Nat. Methods 2015, 12, 7–8. Available online: https://pubmed.ncbi.nlm.nih.gov/25549265/ (accessed on 25 July 2022). [CrossRef]
- Rhéaume, E.; Simard, J.; Morel, Y.; Mebarki, F.; Zachmann, M.; Forest, M.G.; New, M.I.; Labrie, F. Congenital adrenal hyperplasia due to point mutations in the type II 3 beta-hydroxysteroid dehydrogenase gene. Nat. Genet. 1992, 1, 239–245. [Google Scholar] [CrossRef] [PubMed]
- Ladjouze, A.; Donaldson, M.; Plotton, I.; Djenane, N.; Mohammedi, K.; Tardy-Guidollet, V.; Mallet, D.; Boulesnane, K.; Bouzerar, Z.; Morel, Y.; et al. Genotype, Mortality, Morbidity, and Outcomes of 3β-Hydroxysteroid Dehydrogenase Deficiency in Algeria. Front. Endocrinol. 2022, 13, 867073. [Google Scholar] [CrossRef] [PubMed]
- Pecori Giraldi, F.; Einaudi, S.; Sesta, A.; Verna, F.; Messina, M.; Manieri, C.; Menegatti, E.; Ghizzoni, L. POR polymorphisms are associated with 21 hydroxylase deficiency. J. Endocrinol. Investig. 2021, 44, 2219–2226. [Google Scholar] [CrossRef]

| Hormone | Patient n.1 Values | Patient n.2 Values | Normal Levels |
|---|---|---|---|
| 17-OHP ng/mL | 86 | - | <10 (full term newborn)987654<2 (after 6 months) |
| ACTH pg/mL | 250 | 53 | 8–53 |
| Cortisol µg/L | 42 | 157 | 60–230 |
| Aldosterone ng/mL | 514 | 197 | 70–550 |
| PRA ng/mL/h | 2.07 | 12.8 | 1.31–3.95 |
| Dihydrotestosterone pg/mL | 26 | - | 300–1200 |
| Testosterone ng/mL | 1.3 | <0.2 | <0.4 |
| Delta4androstenedione ng/mL | 18.5 | - | 0.60–5.60 |
| DHEAS mcg/L | 1970 | 779 | 560–2360 |
| LH U/L | 1.2 | - | <1.3 |
| FSH U/L | 0.4 | - | <2 |
| Na mEq/L | 136 | 139 | 136–146 |
| K mEq/L | 5.3 | 4.6 | 3.5–5.3 |
| Cl mEq/L | 105 | - | 97–110 |
| Glucose | 64 | 78 | 70–110 |
| Primer | Sequence |
|---|---|
| HSD3B2_1-2_FW | GCTCCAGTCCTTCCTCCAGG |
| HSD3B2_1-2_REV | AGGTCAACCTCCCCACACCC |
| HSD3B2_3_FW | GGATGTGTGACAATTCACTGC |
| HSD3B2_3_REV | TCTTTCTGATCCTCATTTAACCAA |
| HSD3B2_4_FW | CATGTGGTTGCAGCTCCTTT |
| HSD3B2_4_REV | GAAGAAGACAGTAAGTTGGG |
| HSD3B2_4INT_FW * | ACCTTGTACACTTGTGC |
| HSD3B2_4INT_REV * | TGTGGCGGTTGAAGGG |
| Predictor | Outcome |
|---|---|
| metal | Damaging (score: 0.8606) |
| REVEL | Pathogenic (score: 0.6129) |
| DEOGEN2 | Damaging (score: 0.6196, 0.7482) |
| FATHMM | Damaging (score: −3.44) |
| M-CAP | Damaging (score: 0.1732) |
| MVP | Pathogenic (score: 0.9976) |
| MutPred | Pathogenic (score: 0.935) |
| Mutation assessor | High (score: 3.86) |
| PROVEAN | Damaging (score: −3.02, −3.49) |
| SIFT4G | Damaging (score: 0.002, 0.003) |
| PolyPhen2 | HDivPred = probably damaging (score: 0.986)/HVarPred = possibly damaging (score: 0.898) |
| EIGEN | Neutral (score −0.1586) |
| LRT | Neutral (score 0.06347) |
| Mutation taster | Polymorphism (score: 0.9774) |
| PrimateAI | Tolerated (score 0.3522) |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Menegatti, E.; Tessaris, D.; Barinotti, A.; Matarazzo, P.; Einaudi, S. Genetic Testing for a Patient with Suspected 3 Beta-Hydroxysteroid Dehydrogenase Deficiency: A Case of Unreported Genetic Variants. J. Clin. Med. 2022, 11, 5767. https://doi.org/10.3390/jcm11195767
Menegatti E, Tessaris D, Barinotti A, Matarazzo P, Einaudi S. Genetic Testing for a Patient with Suspected 3 Beta-Hydroxysteroid Dehydrogenase Deficiency: A Case of Unreported Genetic Variants. Journal of Clinical Medicine. 2022; 11(19):5767. https://doi.org/10.3390/jcm11195767
Chicago/Turabian StyleMenegatti, Elisa, Daniele Tessaris, Alice Barinotti, Patrizia Matarazzo, and Silvia Einaudi. 2022. "Genetic Testing for a Patient with Suspected 3 Beta-Hydroxysteroid Dehydrogenase Deficiency: A Case of Unreported Genetic Variants" Journal of Clinical Medicine 11, no. 19: 5767. https://doi.org/10.3390/jcm11195767
APA StyleMenegatti, E., Tessaris, D., Barinotti, A., Matarazzo, P., & Einaudi, S. (2022). Genetic Testing for a Patient with Suspected 3 Beta-Hydroxysteroid Dehydrogenase Deficiency: A Case of Unreported Genetic Variants. Journal of Clinical Medicine, 11(19), 5767. https://doi.org/10.3390/jcm11195767

