Identification of New Molecular Biomarkers in Ovarian Cancer Using the Gene Expression Profile
Abstract
1. Introduction
2. Materials and Methods
2.1. Patients
2.2. Expression Analysis
2.3. ELISA
2.4. Statistical Analysis
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Doubeni, C.; Doubeni, A.; Myers, A. Diagnosis and Management of Ovarian Cancer. Am. Fam. Physician 2016, 93, 937–944. [Google Scholar]
- Bray, F.; Ferlay, J.; Soerjomataram, I.; Siegel, R.L.; Torre, L.A.; Jemal, A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J. Clin. 2018, 68, 394–424. [Google Scholar] [CrossRef] [PubMed]
- Bhatla, N.; Denny, L. FIGO cancer report 2018. Int. J. Gynaecol. Obstet. 2018, 143, 2–3. [Google Scholar] [CrossRef]
- Malani, P.N. Harrison’s principles of internal medicine. JAMA 2012, 308, 1813–1814. [Google Scholar] [CrossRef]
- Jayson, G.C.; Kohn, E.C.; Kitchener, H.C.; Ledermann, J.A. Ovarian cancer. Lancet 2014, 384, 1376–1388. [Google Scholar] [CrossRef]
- Salehi, F.; Dunfield, L.; Phillips, K.P.; Krewski, D.; Vanderhyden, B.C. Risk factors for ovarian cancer: An overview with emphasis on hormonal factors. J. Toxicol. Environ. Health B Crit. Rev. 2008, 11, 301–321. [Google Scholar] [CrossRef]
- Zhao, L.; Li, Y.; Zhang, Z.; Zou, J.; Li, J.; Wei, R.; Guo, Q.; Zhu, X.; Chu, C.; Fu, X.; et al. Meta-analysis based gene expression profiling reveals functional genes in ovarian cancer. Biosci. Rep. 2020, 27, BSR20202911. [Google Scholar] [CrossRef]
- Moreno, C.S.; Matyunina, L.; Dickerson, E.B.; Schubert, N.; Bowen, N.J.; Logani, S.; Benigno, B.B.; McDonald, J.F. Evidence that p53-mediated cell-cycle-arrest inhibits chemotherapeutic treatment of ovarian carcinomas. PLoS ONE 2007, 2, e441. [Google Scholar] [CrossRef]
- Bowen, N.J.; Walker, L.D.; Matyunina, L.V.; Logani, S.; Totten, K.A.; Benigno, B.B.; McDonald, J.F. Gene expression profiling supports the hypothesis that human ovarian surface epithelia are multipotent and capable of serving as ovarian cancer initiating cells. BMC Med. Genom. 2009, 2, 71. [Google Scholar] [CrossRef]
- Oliveira, D.V.N.P.; Prahm, K.P.; Christensen, I.J.; Hansen, A.; Høgdall, C.K.; Høgdall, E.V. Gene expression profile association with poor prognosis in epithelial ovarian cancer patients. Sci. Rep. 2021, 11, 5438. [Google Scholar] [CrossRef]
- Bogacz, A.; Mikołajczak, P.Ł.; Wolek, M.; Górska, A.; Szulc, M.; Ożarowski, M.; Kujawski, R.; Czerny, B.; Wolski, H.; Karpiński, T.M.; et al. Combined Effects of Methyldopa and Flavonoids on the Expression of Selected Factors Related to Inflammatory Processes and Vascular Diseases in Human Placenta Cells—An In Vitro Study. Molecules 2021, 2, 1259. [Google Scholar] [CrossRef] [PubMed]
- Amatori, S.; Persico, G.; Fanelli, M. Real-time quantitative PCR array to study drug-induced changes of gene expression in tumor cell lines. J. Cancer Metastasis Treat. 2017, 3, 90–99. [Google Scholar] [CrossRef]
- Liang, H.; Zhang, J.; Shao, C.; Zhao, L.; Xu, W.; Sutherland, L.C.; Wang, K. Differential Expression of RBM5, EGFR and KRAS mRNA and protein in non-small cell lung cancer tissues. J. Exp. Clin. Cancer Res. 2012, 31, 36. [Google Scholar] [CrossRef] [PubMed]
- Santos, M.M.; Tannuri, A.C.A.; Coelho, M.C.M.; Goncalves, J.O.; Serafini, S.; Ferraz da Silva, L.F.; Tannuri, U. Immediate expression of c-fos and c-jun mRNA in a model of intestinal autotransplantation and ischemia-reperfusion in situ. Clinics 2015, 70, 373–379. [Google Scholar] [CrossRef]
- Ishimine, M.; Lee, H.C.; Nakaoka, H.; Orita, H.; Kobayashi, T.; Mizuguchi, K.; Endo, M.; Inoue, I.; Sato, K.; Yokomizo, T. The Relationship between TP53 Gene Status and Carboxylesterase 2 Expression in Human Colorectal Cancer. Dis. Markers 2018, 2018, 5280736. [Google Scholar] [CrossRef]
- Xiong, H.; Zhang, J. Expression and clinical significance of ATM and PUMA gene in patients with colorectal cancer. Oncol. Lett. 2017, 14, 7825–7828. [Google Scholar] [CrossRef]
- Hu, W.M.; Zhang, Q.; Huang, L.H.; Mo, Z.H.; Long, X.D.; Yang, Y.B.; Yang, W.J.; Liu, J.; Jin, P. Identification of Novel Variants in MEN1: A Study Conducted with Four Multiple Endocrine Neoplasia Type 1 Patients. Horm. Metab. Res. 2020, 52, 788–795. [Google Scholar] [CrossRef]
- Wang, L.Y.; Sun, X.J.; Chen, M.; Zhao, M.H. The expression of NOD2, NLRP3 and NLRC5 and renal injury in anti-neutrophil cytoplasmic antibody-associated vasculitis. J. Transl. Med. 2019, 17, 197. [Google Scholar] [CrossRef]
- Sunde, R.A. mRNA transcripts as molecular biomarkers in medicine and nutrition. J. Nutr. Biochem. 2010, 21, 665–670. [Google Scholar] [CrossRef]
- Ismail, R.S.; Baldwin, R.L.; Fang, J.; Browning, D.; Karlan, B.Y.; Gasson, J.C.; Chang, D.D. Differential gene expression between normal and tumor-derived ovarian epithelial cells. Cancer Res. 2000, 60, 6744–6749. [Google Scholar]
- Tonin, P.N.; Hudsno, T.J.; Rodier, F.; Bossolasco, M.; Lee, P.D.; Novak, J.; Mandreson, E.N.; Provencher, D.; Mes-Masson, A. Microarray analysis of gene expression mirrors the biology of ovarian cancer model. Oncogene 2001, 20, 6617–6626. [Google Scholar] [CrossRef] [PubMed]
- Wong, K.K.; Cheng, R.S.; Mok, S.C. Identification of differentially expressed genes from ovarian cancer cells by MICROMAX cDNA microarray system. Biotechniques 2001, 30, 670–675. [Google Scholar] [CrossRef] [PubMed]
- Roy, R.; Chun, J.; Powell, S.N. BRCA1 and BRCA2: Different roles in a common pathway of genome protection. Nat. Rev. Cancer 2011, 12, 68–78. [Google Scholar] [CrossRef]
- Saha, S.; Mandal, P.; Ganguly, S.; Jana, D.; Ayaz, A.; Banerjee, A.; Chouhan, R.; Sarkar, D.K. Decreased expression of BRCA2 accelerates sporadic breast cancer progression. Indian J. Surg. Oncol. 2015, 6, 378–383. [Google Scholar] [CrossRef][Green Version]
- Tsibulak, I.; Wieser, V.; Degasper, C.; Shivalingaiah, G.; Wenzel, S.; Sprung, S.; Lax, S.F.; Marth, C.; Fiegl, H.; Zeimet, A.G. BRCA1 and BRCA2 mRNA-expression prove to be of clinical impact in ovarian cancer. Br. J. Cancer 2018, 119, 683–692. [Google Scholar] [CrossRef]
- Gudas, J.M.; Nguyen, H.; Li, T.; Cowan, K.H. Hormone-dependent regulation of BRCA1 in human breast cancer cells. Cancer Res. 1995, 55, 4561–4565. [Google Scholar]
- Egawa, C.; Miyoshi, Y.; Taguchi, T.; Tamaki, Y.; Noguchi, S. High BRCA2 mRNA expression predicts poor prognosis in breast cancer patients. Int. J. Cancer 2002, 98, 879–882. [Google Scholar] [CrossRef]
- Abdel-Fatah, T.M.A.; Arora, A.; Moseley, P.; Coveney, C.; Perry, C.; Johnson, K.; Kent, C.; Ball, G.; Chan, S.; Madhusudan, S. ATM, ATR and DNA-PKcs expressions correlate to adverse clinical outcomes in epithelial ovarian cancers. BBA Clin. 2014, 2, 10–17. [Google Scholar] [CrossRef] [PubMed]
- Feng, X.; Li, H.; Dean, M.; Wilson, H.E.; Kornaga, E.; Enwere, E.K.; Tang, T.; Paterson, A.; Lees-Miller, S.P.; Magliocco, A.M.; et al. Low ATM protein expression in malignant tumor as well as cancer-associated stroma are independent prognostic factors in a retrospective study of early-stage hormone-negative breast cancer. Breast Cancer Res. 2015, 17, 65. [Google Scholar] [CrossRef] [PubMed]
- Han, J.; Flemington, C.; Houghton, A.B.; Gu, Z.; Zambetti, G.P.; Lutz, R.J.; Zhu, L.; Chittenden, T. Expression of bbc3, a pro-apoptotic BH3-only gene, is regulated by diverse cell death and survival signals. Proc. Natl. Acad. Sci. USA 2001, 98, 11318–11323. [Google Scholar] [CrossRef]
- Fernandez, P.C.; Frank, S.R.; Wang, L.; Schroeder, M.; Liu, S.; Greene, J.; Cocito, A.; Amati, B. Genomic targets of the human c-Myc protein. Genes Dev. 2003, 17, 1115–1129. [Google Scholar] [CrossRef]
- Reimertz, C.; Kogel, D.; Rami, A.; Chittenden, T.; Prehn, J.H. Gene expression during ER stress-induced apoptosis in neurons: Induction of the BH3-only protein Bbc3/PUMA and activation of the mitochondrial apoptosis pathway. J. Cell Biol. 2003, 162, 587–597. [Google Scholar] [CrossRef]
- Castedo, M.; Coquelle, A.; Vivet, S.; Vitale, I.; Kauffmann, A.; Dessen, P.; Pequignot, M.O.; Casares, N.; Valent, A.; Mouhamad, S.; et al. Apoptosis regulation in tetraploid cancer cells. EMBO J. 2006, 25, 2584–2595. [Google Scholar] [CrossRef]
- Yu, J.; Zhang, L. PUMA, a potent killer with or without p53. Oncogene 2008, 27, 71–83. [Google Scholar] [CrossRef]
- Shibue, T.; Suzuki, S.; Okamoto, H.; Yoshida, H.; Ohba, Y.; Takaoka, A.; Taniguchi, T. Differential contribution of Puma and Noxa in dual regulation of p53-mediated apoptotic pathways. EMBO J. 2006, 25, 4952–4962. [Google Scholar] [CrossRef]
- Mahner, S.; Baasch, C.; Schwarz, J.; Hein, S.; Wolber, L.; Janicke, F.; Milde-Langosch, K. C-Fos expression is a molecular predictor of progression and survival in epithelial ovarian carcinoma. Br. J. Cancer 2008, 99, 1269–1275. [Google Scholar] [CrossRef]
- Nelakurti, D.D.; Pappula, A.L.; Rajasekaran, S.; Miles, W.O.; Petreaca, R.C. Comprehensive Analysis of MEN1 Mutations and Their Role in Cancer. Cancers 2020, 12, 2616. [Google Scholar] [CrossRef]
- Ma, X.; Qiu, Y.; Sun, Y.; Zhu, L.; Zhao, Y.; Li, T.; Lin, Y.; Ma, D.; Qin, Z.; Sun, C.; et al. NOD2 inhibits tumorigenesis and increases chemosensitivity of hepatocellular carcinoma by targeting AMPK pathway. Cell Death Dis. 2020, 11, 174. [Google Scholar] [CrossRef]
- Xu, D.; Zhang, S.; Zhang, S.; Liu, H.; Li, P.; Yu, L.; Shang, H.; Hou, Y.; Tian, Y. NOD2 maybe a biomarker for the survival of kidney cancer patients. Oncotarget 2017, 8, 101489–101499. [Google Scholar] [CrossRef]
- Stolarova, L.; Kleiblova, P.; Janatova, M.; Soukupova, J.; Zemankova, P.; Macurek, L.; Kleibl, Z. CHEK2 Germline Variants in Cancer Predisposition: Stalemate Rather than Checkmate. Cells 2020, 9, 2675. [Google Scholar] [CrossRef]
- Mehner, C.; Oberg, A.L.; Goergen, K.M.; Kalli, K.R.; Maurer, M.J.; Nassar, A.; Goode, E.L.; Keeney, G.L.; Jatoi, A.; Radisky, D.C.; et al. EGFR as a prognostic biomarker and therapeutic target in ovarian cancer: Evaluation of patient cohort and literature review. Genes Cancer 2017, 8, 589–599. [Google Scholar] [CrossRef]
- Teplinsky, E.; Muggia, F. EGFR and HER2: Is there a role in ovarian cancer? Transl. Cancer Res. 2015, 4, 107–117. [Google Scholar]
- Cîrstea, A.E.; Stepan, A.E.; Mărgăritescu, C.; Zăvoi, R.E.; Olimid, D.A.; Simionescu, C.E. The immunoexpression of EGFR, HER2 and HER3 in malignant serous ovarian tumors. Rom. J. Morphol. Embryol. 2017, 58, 1269–1273. [Google Scholar]
- Farrag, M.S.; Emarah, Z.; Elrefaie, W.; Farrag, N.S.; Hafez, M.T.; Abdelwahab, K. EGFR and HER2 Expression in Primary Ovarian High-Grade Serous Carcinoma and Their Prognostic Value. Res. Oncol. 2021, 17, 9–16. [Google Scholar] [CrossRef]


| Gene | Forward (5′-3′) | Reverse (5′-3′) | Reference |
|---|---|---|---|
| ATM | GGTATAGAAAAGCACCAGTCCAGTATTG | CGTGAACACCGGACAAGAGTTT | [12] |
| BRCA1 | GCATGCTGAAACTTCTCAACCA | GTGTCAAGCTGAAAAGCACAAATGA | [12] |
| BRCA2 | AGACTGTACTTCAGGGCCGTACA | GGCTGAGACAGGTGTGGAAACA | [12] |
| KRAS | TCTTGCCTCCCTACCTTCCACAT | CTGTCAGATTCTCTTGAGCCCTG | [13] |
| c-JUN | ACCTTCAACACCCCAGCCATG | GGCCATCTCTTGCTCGAAGTC | [14] |
| c-FOS | GCCTCGTTCCTCCAGTCCGA | TGCGATGGAAAGGCCAGCCC | [14] |
| NOXA | GCTGGAAGTC GAGTGTGCTA | CCTGAGCAGAAGAGTTTGGA | [15] |
| PUMA | GCCAGATTTGTGAGACAAGAGG | CAGGCACCTAATTGGGCTC | [16] |
| MEN1 | CTTCCATTGACCTGCACACC | CAGCCAGGTACATGTAGGG | [17] |
| NOD2 | ACCTTTGATGGCTTTGACG | CACCTTGCGGGCATTCTT | [18] |
| CHEK2 | TCAGCAAGAGAGGCAGACCC | ACAGCTCTCCCCCTTCCATC | [12] |
| EGFR | TGATAGACGCAGATAGTCGCC | TCAGGGCACGGTAGAAGTTG | [13] |
| GAPDH | GCAAATTCCATGGCACCGT | TCGCCCCACTTGATTTTGG | [12] |
| β-ACTIN | GCCAGAGCGGGAGTGGTGAA | GGCTTGGGCTCAGGGTCATT | [14] |
| Parameter | Group | Mean ± SEM | Median | 95% CI | p |
|---|---|---|---|---|---|
| Leukocytes 109/L | OC | 8.24 ± 3.48 | 7.32 | 7.53–8.94 | 0.006 |
| Control | 6.93 ± 2.61 | 6.57 | 6.41–7.45 | ||
| Erythrocytes 1012/L | OC | 4.28 ± 0.58 | 4.32 | 4.16–4.40 | 0.148 |
| Control | 4.39 ± 0.53 | 4.41 | 4.28–4.49 | ||
| Platelets 109/L | OC | 328.87 ± 158.44 | 287.00 | 296.76–360.96 | 0.014 |
| Control | 266.48 ± 64.87 | 262.50 | 253.47–279.48 | ||
| Hemoglobin g/dL | OC | 7.46 ± 1.01 | 7.50 | 7.26–7.67 | 0.035 |
| Control | 7.71 ± 0.91 | 7.80 | 7.52–7.89 | ||
| Hematocrit | OC | 0.37 ± 0.36 | 0.37 | 0.36–0.38 | 0.059 |
| Control | 0.46 ± 0.83 | 0.38 | 0.30–0.63 | ||
| Glucose mg/dL | OC | 96.12 ± 18.28 | 92.00 | 92.41–99.82 | <0.001 |
| Control | 88.81 ± 14.96 | 84.85 | 71.22–91.81 | ||
| Sodium mmol/L | OC | 139.50 ± 2.89 | 138.91 | 138.91–140.09 | 0.035 |
| Control | 139.28 ± 2.60 | 139.00 | 138.75–139.80 | ||
| Potassium mmol/L | OC | 4.37 ± 0.43 | 4.37 | 4.29–4.46 | 0.417 |
| Control | 4.25 ± 0.31 | 4.21 | 4.19–4.32 | ||
| Creatinine mg/dL | OC | 0.84 ± 0.49 | 0.73 | 0.73–0.95 | 0.631 |
| Control | 0.82 ± 0.24 | 0.76 | 0.70–0.94 | ||
| eGFRmL/min/1.73 m2 | OC | 85.53 ± 33.53 | 87.21 | 77.22–93.84 | 0.289 |
| Control | 94.97 ± 22.65 | 96.95 | 82.91–107.04 | ||
| Total protein g/dL | OC | 6.93 ± 0.81 | 6.95 | 6.74–7.12 | 0.314 |
| Control | 7.07 ± 0.40 | 7.05 | 6.88–7.28 | ||
| Uric acid mg/dL | OC | 5.08 ± 1.77 | 4.80 | 4.67–5.49 | 0.714 |
| Control | 5.14 ± 1.51 | 5.10 | 4.36–5.92 | ||
| Urea mg/dL | OC | 33.30 ± 18.89 | 28.70 | 28.22–37.65 | 0.276 |
| Control | 32.42 ± 10.38 | 30.00 | 27.09–37.77 | ||
| D-dimer ng/mL | OC | 3329.63 ± 2124.62 | 1831.00 | 2459.53–4199.53 | <0.001 |
| Control | 789.69 ± 423.54 | 464.50 | 397.20–1182.18 | ||
| Fibrinogen g/L | OC | 7.55 ± 6.34 | 3.62 | 0.25–14.84 | <0.001 |
| Control | 2.91 ± 0.75 | 2.89 | 2.61–3.20 | ||
| INR | OC | 1.17 ± 0.23 | 1.12 | 1.12–1.22 | 0.073 |
| Control | 1.09 ± 0.05 | 1.11 | 1.07–1.12 | ||
| PTT | OC | 12.92 ± 2.52 | 12.40 | 12.36–13.47 | 0.058 |
| Control | 12.08 ± 0.65 | 12.20 | 11.81–12.35 | ||
| APTT | OC | 30.00 ± 3.82 | 30.20 | 29.17–30.84 | 0.955 |
| Control | 30.31 ± 3.72 | 30.45 | 28.74–31.88 | ||
| Systolic pressure mmHg | OC | 123.07 ± 13.17 | 125.00 | 120.39–125.76 | 0.165 |
| Control | 120.81 ± 14.98 | 120.00 | 117.81–123.82 | ||
| Diastolic pressure mmHg | OC | 78.94 ± 14.59 | 80.00 | 75.98–81.89 | 0.719 |
| Control | 78.32 ± 8.45 | 80.00 | 76.62–80.01 | ||
| CA-125 U/mL | OC | 773.51–454.22 | 290.00 | 501.27–1045.74 | <0.001 |
| Control | 128.29 ± 100.43 | 20.81 | 8.49–266.64 | ||
| HE4 pmol/L | OC | 1708.42 ± 1204.42 | 363.45 | 129.20–3967.74 | 0.009 |
| Control | 83.47 ± 30.34 | 73.66 | 8.12–158.83 |
| Gene | Patients with Ovarian Cancer | p-Value |
|---|---|---|
| ATM | 75.45 ± 5.56 | 0.056 |
| BRCA1 | 107.69 ± 9.42 | 0.231 |
| BRCA2 | 120.00 ± 12.24 | 0.084 |
| CHEK2 | 97.50 ± 8.45 | 0.142 |
| KRAS | 195.55 ± 18.32 | 0.012 |
| NOXA | 51.96 ± 7.34 | 0.024 |
| PUMA | 184.97 ± 18.42 | 0.026 |
| c-FOS | 228.57 ± 21.44 | 0.008 |
| EGFR | 186.66 ± 17.54 | 0.006 |
| NOD2 | 84.61 ± 9.32 | 0.164 |
| MEN1 | 69.01 ± 8.64 | 0.118 |
| c-JUN | 34.14 ± 6.42 | 0.001 |
| Gene | Patients with Ovarian Cancer | p-Value |
|---|---|---|
| ATM | 89.64 ± 9.32 | 0.086 |
| BRCA1 | 98.67 ± 6.41 | 0.224 |
| BRCA2 | 92.28 ± 9.45 | 0.196 |
| CHEK2 | 88.26 ± 11.24 | 0.252 |
| KRAS | 141.11 ± 8.65 | 0.044 |
| NOXA | 60.62 ± 6.56 | 0.042 |
| PUMA | 115.73 ± 9.66 | 0.052 |
| c-FOS | 145.52 ± 10.48 | 0.032 |
| EGFR | 178.89 ± 7.32 | 0.046 |
| NOD2 | 86.08 ± 10.11 | 0.262 |
| MEN1 | 82.35 ± 7.44 | 0.275 |
| c-JUN | 54.43 ± 9.82 | 0.024 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Olbromski, P.J.; Pawlik, P.; Bogacz, A.; Sajdak, S. Identification of New Molecular Biomarkers in Ovarian Cancer Using the Gene Expression Profile. J. Clin. Med. 2022, 11, 3888. https://doi.org/10.3390/jcm11133888
Olbromski PJ, Pawlik P, Bogacz A, Sajdak S. Identification of New Molecular Biomarkers in Ovarian Cancer Using the Gene Expression Profile. Journal of Clinical Medicine. 2022; 11(13):3888. https://doi.org/10.3390/jcm11133888
Chicago/Turabian StyleOlbromski, Piotr Józef, Piotr Pawlik, Anna Bogacz, and Stefan Sajdak. 2022. "Identification of New Molecular Biomarkers in Ovarian Cancer Using the Gene Expression Profile" Journal of Clinical Medicine 11, no. 13: 3888. https://doi.org/10.3390/jcm11133888
APA StyleOlbromski, P. J., Pawlik, P., Bogacz, A., & Sajdak, S. (2022). Identification of New Molecular Biomarkers in Ovarian Cancer Using the Gene Expression Profile. Journal of Clinical Medicine, 11(13), 3888. https://doi.org/10.3390/jcm11133888

