Protection Elicited by Glutamine Auxotroph of Yersinia pestis
Abstract
1. Introduction
2. Materials and Methods
2.1. Bacterial Strains, Plasmids, and Culture Conditions
2.2. Animals
2.3. Mutagenesis
2.4. Animal Challenges
2.5. Antibody Titers
2.6. Statistics
3. Results
3.1. Genetic Organization of the glnALG Region
3.2. Effect of glnA and glnALG Deletion on the Growth of Mutant Strains
3.3. Loss of the Entire glnALG Operon, Not Just the Single glnA Gene, Reduces Mutant Virulence
3.4. Humoral Immune Responses
3.5. Strain with Deletion of the Entire glnALG Operon Provides Protective Immunity Against Fatal Plague
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Reitzer, L.J.; Neidhardt, F.; Ingraham, J.L.; Low, K.B.; Magasanik, B.; Schaechter, M.; Umbarger, H.E. Ammonia Assimilation and the Biosynthesis of Glutamine, Glutamate, Aspartate, Asparagine, L-alanine, and D-alanine. In Escherichia coli and Salmonella Typhimurium: Cellular and Molecular Biology; ASM Press: Washington, DC, USA, 1987; pp. 302–320. [Google Scholar]
- Ikeda, T.P.; Shauger, A.E.; Kustu, S. Salmonella Typhimurium Apparently Perceives External Nitrogen Limitation as Internal Glutamine Limitation. J. Mol. Biol. 1996, 259, 589–607. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zimmer, D.P.; Soupene, E.; Lee, H.L.; Wendisch, V.F.; Khodursky, A.B.; Peter, B.J.; Bender, R.A.; Kustu, S. Nitrogen Regulatory Protein C-Controlled Genes of Escherichia coli: Scavenging as a Defense against Nitrogen Limitation. Proc. Natl. Acad. Sci. USA 2000, 97, 14674–14679. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nohno, T.; Saito, T.; Hong, J. Cloning and Complete Nucleotide Sequence of the Escherichia coli Glutamine Permease Operon (glnHPQ). Molec. Gen. Genet. 1986, 205, 260–269. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Maria-Neto, S.; Cândido, E.D.S.; Rodrigues, D.R.; De Sousa, D.A.; Da Silva, E.M.; De Moraes, L.M.P.; Otero-Gonzalez, A.D.J.; Magalhães, B.S.; Dias, S.C.; Franco, O.L. Deciphering the Magainin Resistance Process of Escherichia coli Strains in Light of the Cytosolic Proteome. Antimicrob. Agents Chemother. 2012, 56, 1714–1724. [Google Scholar] [CrossRef] [Scilit]
- El Khoury, J.Y.; Boucher, N.; Bergeron, M.G.; Leprohon, P.; Ouellette, M. Penicillin Induces Alterations in Glutamine Metabolism in Streptococcus pneumoniae. Sci. Rep. 2017, 7, 14587. [Google Scholar] [CrossRef] [Scilit]
- Gustafson, J.; Strässle, A.; Hächler, H.; Kayser, F.H.; Berger-Bächi, B. The femC Locus of Staphylococcus aureus Required for Methicillin Resistance Includes the Glutamine Synthetase Operon. J. Bacteriol. 1994, 176, 1460–1467. [Google Scholar] [CrossRef] [Scilit]
- Millanao, A.R.; Mora, A.Y.; Saavedra, C.P.; Villagra, N.A.; Mora, G.C.; Hidalgo, A.A. Inactivation of Glutamine Synthetase-Coding Gene glnA Increases Susceptibility to Quinolones Through Increasing Outer Membrane Protein F in Salmonella enterica Serovar Typhi. Front. Microbiol. 2020, 11, 428. [Google Scholar] [CrossRef] [Scilit]
- Harth, G.; Horwitz, M.A. Inhibition of Mycobacterium tuberculosis Glutamine Synthetase as a Novel Antibiotic Strategy against Tuberculosis: Demonstration of Efficacy In Vivo. Infect. Immun. 2003, 71, 456–464. [Google Scholar] [CrossRef] [Scilit]
- Crowther, G.J.; Shanmugam, D.; Carmona, S.J.; Doyle, M.A.; Hertz-Fowler, C.; Berriman, M.; Nwaka, S.; Ralph, S.A.; Roos, D.S.; Van Voorhis, W.C.; et al. Identification of Attractive Drug Targets in Neglected-Disease Pathogens Using an In Silico Approach. PLoS Negl. Trop. Dis. 2010, 4, e804. [Google Scholar] [CrossRef] [Scilit]
- Fisher, S.H. Regulation of Nitrogen Metabolism in Bacillus subtilis: Vive La Différence! Mol. Microbiol. 1999, 32, 223–232. [Google Scholar] [CrossRef] [Scilit]
- Klose, K.E.; Mekalanos, J.J. Simultaneous Prevention of Glutamine Synthesis and High-Affinity Transport Attenuates Salmonella Typhimurium Virulence. Infect. Immun. 1997, 65, 587–596. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chandra, H.; Basir, S.F.; Gupta, M.; Banerjee, N. Glutamine Synthetase Encoded by glnA-1 Is Necessary for Cell Wall Resistance and Pathogenicity of Mycobacterium bovis. Microbiology 2010, 156, 3669–3677. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Aurass, P.; Düvel, J.; Karste, S.; Nübel, U.; Rabsch, W.; Flieger, A. glnA Truncation in Salmonella Enterica Results in a Small Colony Variant Phenotype, Attenuated Host Cell Entry, and Reduced Expression of Flagellin and SPI-1-Associated Effector Genes. Appl. Environ. Microbiol. 2018, 84, e01838-17. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Anisimov, A.P.; Vagaiskaya, A.S.; Trunyakova, A.S.; Dentovskaya, S.V. Live Plague Vaccine Development: Past, Present, and Future. Vaccines 2025, 13, 66. [Google Scholar] [CrossRef] [Scilit]
- Hadjifrangiskou, M.; Brannon, J. The Arsenal of Pathogens and Antivirulence Therapeutic Strategies for Disarming Them. DDDT 2016, 2016, 1795–1806. [Google Scholar] [CrossRef] [Scilit]
- Asha, I.J.; Gupta, S.D.; Hossain, M.M.; Islam, M.N.; Akter, N.N.; Islam, M.M.; Das, S.C.; Barman, D.N. In Silico Characterization of a Hypothetical Protein (PBJ89160.1) from Neisseria meningitidis Exhibits a New Insight on Nutritional Virulence and Molecular Docking to Uncover a Therapeutic Target. Evol. Bioinform. Online 2024, 20, 11769343241298307. [Google Scholar] [CrossRef] [Scilit]
- Reboul, A.; Lemaître, N.; Titecat, M.; Merchez, M.; Deloison, G.; Ricard, I.; Pradel, E.; Marceau, M.; Sebbane, F. Yersinia pestis Requires the 2-Component Regulatory System OmpR-EnvZ to Resist Innate Immunity during the Early and Late Stages of Plague. J. Infect. Dis. 2014, 210, 1367–1375. [Google Scholar] [CrossRef] [Scilit]
- Solomentsev, V.I.; Kadnikova, L.A.; Kislichkina, A.A.; Mayskaya, N.V.; Kombarova, T.I.; Platonov, M.E.; Bogun, A.G.; Anisimov, A.P. Comparative Sequencing of Transcriptomes of Yersinia pestis subsp. microti bv. Ulegeica Different by Virulence for Guinea Pigs. Russ. J. Bacteriol. 2017, 2, 30–35. (In Russian) [Google Scholar]
- Anisimov, A.P.; Kislichkina, A.A.; Kopylov PKh Krasilnikova, E.A.; Bogun, A.G.; Dentovskaya, S.V. Search for Factors of Selective Virulence of Rhamnose-Positive Strains of Yersinia pestis. In Proceedings of the 22nd International Scientific Conference “Current Issues on Zoonotic Diseases”, Ulaanbaatar, Mongolia, 5 July 2017; Volume 22, pp. 88–95. Available online: https://www.researchgate.net/publication/320138653 (accessed on 19 February 2025). (In Russian)
- Kislichkina, A.A.; Krasil’nikova, E.A.; Platonov, M.E.; Skryabin, Y.P.; Sizova, A.A.; Solomentsev, V.I.; Gapel’chenkova, T.V.; Dentovskaya, S.V.; Bogun, A.G.; Anisimov, A.P. Whole-Genome Assembly of Yersinia pestis 231, the Russian Reference Strain for Testing Plague Vaccine Protection. Microbiol. Resour. Announc. 2021, 10, e01373-20. [Google Scholar] [CrossRef] [Scilit]
- Datsenko, K.A.; Wanner, B.L. One-Step Inactivation of Chromosomal Genes in Escherichia coli K-12 Using PCR Products. Proc. Natl. Acad. Sci. USA 2000, 97, 6640–6645. [Google Scholar] [CrossRef] [Scilit]
- Cherepanov, P.P.; Wackernagel, W. Gene Disruption in Escherichia coli: TcR and KmR Cassettes with the Option of Flp-Catalyzed Excision of the Antibiotic-Resistance Determinant. Gene 1995, 158, 9–14. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Donnenberg, M.S.; Kaper, J.B. Construction of an eae Deletion Mutant of Enteropathogenic Escherichia coli by Using a Positive-Selection Suicide Vector. Infect. Immun. 1991, 59, 4310–4317. [Google Scholar] [CrossRef] [Scilit]
- Dentovskaya, S.V.; Vagaiskaya, A.S.; Platonov, M.E.; Trunyakova, A.S.; Kotov, S.A.; Krasil’nikova, E.A.; Titareva, G.M.; Mazurina, E.M.; Gapel’chenkova, T.V.; Shaikhutdinova, R.Z.; et al. Peptidoglycan-Free Bacterial Ghosts Confer Enhanced Protection against Yersinia pestis Infection. Vaccines 2021, 10, 51. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Trunyakova, A.S.; Platonov, M.E.; Ivanov, S.A.; Kopylov, P.K.; Dentovskaya, S.V.; Anisimov, A.P. A Recombinant Low-Endotoxic Yersinia pseudotuberculosis Strain—over-Producer of Yersinia pestis F1 Antigen. Mol. Gen. Microbio. Viro. 2024, 42, 10. [Google Scholar] [CrossRef] [Scilit]
- Kopylov, P.K.; Svetoch, T.E.; Ivanov, S.A.; Kombarova, T.I.; Perovskaya, O.N.; Titareva, G.M.; Anisimov, A.P. Characteristics of the Chromatographic Cleaning and Protectiveness of the LcrV Isoform of Yersinia pestis. Appl. Biochem. Microbiol. 2019, 55, 524–533. [Google Scholar] [CrossRef] [Scilit]
- Titball, R.W.; Williamson, E.D. Yersinia pestis (Plague) Vaccines. Expert Opin. Biol. Ther. 2004, 4, 965–973. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Finney, D. Statistical Method in Biological Assay, 3rd ed.; Charles Griffin: London, UK, 1978; p. 508. [Google Scholar]
- Niranda-Rjos, J.; Saàanchez-Pescador, R.; Urdea, M.; Covarrubias, A.A. The Complete Nucleotide Sequence of the ginALG Operon of Escherichia coli K12. Nucl. Acids Res. 1987, 15, 2757–2770. [Google Scholar] [CrossRef] [Scilit]
- Li, B.; Zhou, L.; Guo, J.; Wang, X.; Ni, B.; Ke, Y.; Zhu, Z.; Guo, Z.; Yang, R. High-Throughput Identification of New Protective Antigens from a Yersinia pestis Live Vaccine by Enzyme-Linked Immunospot Assay. Infect. Immun. 2009, 77, 4356–4361. [Google Scholar] [CrossRef] [Scilit]
- Van Heeswijk, W.C.; Westerhoff, H.V.; Boogerd, F.C. Nitrogen Assimilation in Escherichia coli: Putting Molecular Data into a Systems Perspective. Microbiol. Mol. Biol. Rev. 2013, 77, 628–695. [Google Scholar] [CrossRef] [Scilit]
- Abu Kwaik, Y.; Bumann, D. Microbial Quest for Food in Vivo: ‘Nutritional Virulence’ as an Emerging Paradigm. Cell Microbiol. 2013, 15, 882–890. [Google Scholar] [CrossRef] [Scilit]
- Eisenreich, W.; Heesemann, J.; Rudel, T.; Goebel, W. Metabolic Host Responses to Infection by Intracellular Bacterial Pathogens. Front. Cell. Infect. Microbiol. 2013, 3. [Google Scholar] [CrossRef] [Scilit]
- Merrick, M.J.; Edwards, R.A. Nitrogen Control in Bacteria. Microbiol. Rev. 1995, 59, 604–622. [Google Scholar] [CrossRef]
- Burrows, T.W. Virulence of Pasteurella pestis and immunity to plague. In Ergebnisse der Mikrobiologie Immunitätsforschung und Experimentellen Therapie; Henle, W., Kikuth, W., Meyer, K.F., Nauck, E.G., Tomcsik, J., Eds.; Springer: Berlin, Heidelberg, 1963; pp. 59–113. [Google Scholar] [CrossRef] [Scilit]
- Anisimova, T.I.; Sayapina, L.V.; Sergeeva, G.M.; Isupov, I.V.; Beloborodov, R.A.; Samoilova, L.V.; Anisimov, A.P.; Ledvanov, M.Y.; Shvedun, G.P.; Zadumina, S.Y.; et al. Main Requirements for Vaccine Strains of the Plague Pathogen: Methodological Guidelines MU 3.3.1.1113-02; Federal Centre of State Epidemic Surveillance of Ministry of Health of Russian Federation: Moscow, Russia, 2002. [Google Scholar] [CrossRef] [Scilit]






| Strain, Plasmid | Relevant Attributes | Source |
|---|---|---|
| Y. pestis | ||
| 231 | 0.ANT3 phylogroup, wild-type strain, universally virulent (LD50 for mice ≤ 10 CFU, for guinea pigs ≤ 10 CFU); Pgm+, pMT1+, pPCP1+, pCD+ | SCPM-O [21] |
| EV | 1.ORI3 phylogroup, vaccine strain, Pgm—, pMT1+, pPCP1+, pCD+ | SCPM-O |
| EVΔglnA::cat | ΔglnA derivative of EV, Cmr | This study |
| EVΔglnALG::cat | ΔglnALG derivative of EV, Cmr | This study |
| 231ΔglnA | ΔglnA derivative of 231 | This study |
| 231ΔglnALG | ΔglnALG derivative of 231 | This study |
| C-231ΔglnALG | ΔglnALG containing plasmid pEYlpp-glnALG | This study |
| E. coli | ||
| S17-1 λpir | thi pro hsdR− hsdM+ recA RP4 2-Tc::Mu-Km::Tn7(TpRSmRPmS) | SCPM-O |
| Plasmids | ||
| pKD46 | bla PBADgam bet exopSC101 oriTS | [22] |
| pKD3 | bla FRT cat FRT PS1 PS2 oriR6K | [22] |
| pCP20 | bla cat cI857 λPRflp pSC101 oriTS | [23] |
| pCVD442 | ori R6K mob RP4 bla sacB | [24] |
| pEYR’ | ori pA15 cat pR’ | [25] |
| pEYlpp | ori pA15 cat plpp | This study |
| pCVD442-glnA::cat | ori R6K mob RP4 bla sacB cat glnA | This study |
| pCVD442-glnALG::cat | ori R6K mob RP4 bla sacB cat glnALG | This study |
| pEYlpp-glnALG | ori pA15 cat Plpp glnALG | This study |
| glnA Primers for Mutant Construction and Screening | |
|---|---|
| glnA1F | ATGCCTGAACACCATAAATGCAGTAACACACGGTAATCGTTCCACGACGACGACTATGGGAATTAGCCATGGTCC |
| glnA1R | GTGTTGGCTGCTTTCGCTCGCCACCTTCCTACACCTTGAAATCTATTAGGTAAACGTGTAGGCTGGAGCTGCTTC |
| glnA2F | CGGTCGCATCCAGGTTAACG |
| glnA2R | GCGTTACGGGTGATATTCAG |
| glnALG Primers for Mutant Construction and Screening | |
| glnA1F | ATGCCTGAACACCATAAATGCAGTAACACACGGTAATCGTTCCACGACGACGACTATGGGAATTAGCCATGGTCC |
| glnLG3R | CTACTCCATCCCCAACTCTTTCAACTTCCGCGTTAATGTATTACGGCCCCAGCCCGTGTAGGCTGGAGCTGCTTC |
| glnA2R | GCGTTACGGGTGATATTCAG |
| glnLG2R | CTTGATTCTATTGCAACGGAAC |
| Primers for pEYlpp Construction | |
| Plpp-SphI | CGATGAGCATGCGATAACCAGAAGCAATAAAAAATC |
| PlppR-NdeI | CGATGTCATATGTAATACCCTCTAGTTTGAGTTAATC |
| Screening for pCD1 | |
| yscFPlus | ACACCATATGAGTAACTTCTCTGGATTTACG |
| yscFMinus | ATTCTCGAGTGGGAACTTCTGTAGGATG |
| Screening for pMT | |
| caf1Plus | AGTTCCGTTATCGCCATTGC |
| caf1Minus | GGTTAGATACGGTTACGGTTAC |
| Screening for pPst | |
| PstF | CAATCATATGTCAGATACAATGGTAGTG |
| PstR | CTCCTCGAGTTTTAACAATCCACTATC |
| Y. pestis Strains | LD50, CFU | |
|---|---|---|
| Mice | GUINEA PIGS | |
| 231 | 1 | 15 |
| 231ΔglnA | 5 | 3 |
| 231ΔglnALG | >105 | >107 |
| C-231ΔglnALG | 7 | 32 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Dentovskaya, S.V.; Vagaiskaya, A.S.; Platonov, M.E.; Trunyakova, A.S.; Krasil’nikova, E.A.; Mazurina, E.M.; Gapel’chenkova, T.V.; Lipatnikova, N.A.; Shaikhutdinova, R.Z.; Ivanov, S.A.; et al. Protection Elicited by Glutamine Auxotroph of Yersinia pestis. Vaccines 2025, 13, 353. https://doi.org/10.3390/vaccines13040353
Dentovskaya SV, Vagaiskaya AS, Platonov ME, Trunyakova AS, Krasil’nikova EA, Mazurina EM, Gapel’chenkova TV, Lipatnikova NA, Shaikhutdinova RZ, Ivanov SA, et al. Protection Elicited by Glutamine Auxotroph of Yersinia pestis. Vaccines. 2025; 13(4):353. https://doi.org/10.3390/vaccines13040353
Chicago/Turabian StyleDentovskaya, Svetlana V., Anastasia S. Vagaiskaya, Mikhail E. Platonov, Alexandra S. Trunyakova, Ekaterina A. Krasil’nikova, Elizaveta M. Mazurina, Tat’yana V. Gapel’chenkova, Nadezhda A. Lipatnikova, Rima Z. Shaikhutdinova, Sergei A. Ivanov, and et al. 2025. "Protection Elicited by Glutamine Auxotroph of Yersinia pestis" Vaccines 13, no. 4: 353. https://doi.org/10.3390/vaccines13040353
APA StyleDentovskaya, S. V., Vagaiskaya, A. S., Platonov, M. E., Trunyakova, A. S., Krasil’nikova, E. A., Mazurina, E. M., Gapel’chenkova, T. V., Lipatnikova, N. A., Shaikhutdinova, R. Z., Ivanov, S. A., Kombarova, T. I., Sebbane, F., & Anisimov, A. P. (2025). Protection Elicited by Glutamine Auxotroph of Yersinia pestis. Vaccines, 13(4), 353. https://doi.org/10.3390/vaccines13040353

