Cell Wall Protein 2 as a Vaccine Candidate Protects Mice Against Clostridioides difficile Infection
Abstract
:1. Introduction
2. Materials and Methods
2.1. Phylogeny and Homology Analysis of Cwp2
2.2. Expression and Purification of Recombinant Protein Cwp2_A
2.3. Preparation of C. difficile Spores
2.4. Mouse Immunization and Mouse Model of CDI
2.5. ELISA for Anti-Cwp2_A IgG/A
2.6. Quantification of C. difficile Spores in Mouse Feces [37]
2.7. ELISA for TcdA and TcdB [37]
2.8. Adherence Inhibition Assays
2.9. Determination of Cytokine Expression by Real-Time PCR
2.10. Antigen-Specific T Cells Proliferation Assays
2.11. Statistical Analysis
3. Results
3.1. The Functional Domain of Cwp2 Is Highly Immunogenic Based on B Cell Epitope Analysis
3.2. Phylogeny and Homology of Cwp2 Across C. difficile Strains from Various Toxinotypes and Ribotypes
3.3. Immunization of Mice with Cwp2 Functional Domain (Cwp2_A) Induces Significant Anti-Cwp2_A Antibody Responses in Mice and Provides Protection Against C. difficile Infection
3.4. Anti-Cwp2_A Serum Inhibits the Binding of C. difficile to HCT8 Cells
3.5. Immunization of Mice with Cwp2_A Induces Th1- and Th17-Type Immune Responses
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Kelly, C.P.; Pothoulakis, C.; Lamont, J.T. Clostridium-difficile Colitis. N. Engl. J. Med. 1994, 330, 257–262. [Google Scholar] [CrossRef] [PubMed]
- Sunenshine, R.H.; McDonald, L.C. Clostridium difficile-associated disease: New challenges from an established pathogen. Clevel. Clin. J. Med. 2006, 73, 187–197. [Google Scholar] [CrossRef] [PubMed]
- Thomas, C.; Stevenson, M.; Riley, T.V. Antibiotics and hospital-acquired Clostridium difficile-associated diarrhoea: A systematic review. J. Antimicrob. Chemoth 2003, 51, 1339–1350. [Google Scholar] [CrossRef]
- Guery, B.; Menichetti, F.; Anttila, V.J.; Adomakoh, N.; Aguado, J.M.; Bisnauthsing, K.; Georgopali, A.; Goldenberg, S.D.; Karas, A.; Kazeem, G.; et al. Extended-pulsed fidaxomicin versus vancomycin for Clostridium difficile infection in patients 60 years and older (EXTEND): A randomised, controlled, open-label, phase 3b/4 trial. Lancet Infect. Dis. 2018, 18, 296–307. [Google Scholar] [CrossRef]
- Nelson, R.L.; Suda, K.J.; Evans, C.T. Antibiotic treatment for Clostridium difficile-associated diarrhoea in adults. Cochrane Database Syst. Rev. 2017, 3, CD004610. [Google Scholar] [CrossRef]
- Louie, T.J.; Miller, M.A.; Mullane, K.M.; Weiss, K.; Lentnek, A.; Golan, Y.; Gorbach, S.; Sears, P.; Shue, Y.K. Fidaxomicin versus Vancomycin for Clostridium difficile Infection. N. Engl. J. Med. 2011, 364, 422–431. [Google Scholar] [CrossRef]
- Barbut, F.; Richard, A.; Hamadi, K.; Chomette, V.; Burghoffer, B.; Petit, J.C. Epidemiology of recurrences or reinfections of Clostridium difficile-associated diarrhea. J. Clinic. Microbiol. 2000, 38, 2386–2388. [Google Scholar] [CrossRef]
- Tonna, I.; Welsby, P.D. Pathogenesis and treatment of Clostridium difficile infection. Postgrad. Med. J. 2005, 81, 367–369. [Google Scholar] [CrossRef]
- Drekonja, D.M.; Butler, M.; MacDonald, R.; Bliss, D.; Filice, G.A.; Rector, T.S.; Wilt, T.J. Comparative effectiveness of Clostridium difficile treatments: A systematic review. Ann. Intern. Med. 2011, 155, 839–847. [Google Scholar] [CrossRef] [PubMed]
- Lee, B.Y.; Popovich, M.J.; Tian, Y.; Bailey, R.R.; Ufberg, P.J.; Wiringa, A.E.; Muder, R.R. The potential value of Clostridium difficile vaccine: An economic computer simulation model. Vaccine 2010, 28, 5245–5253. [Google Scholar] [CrossRef] [PubMed]
- Riley, T.V.; Lyras, D.; Douce, G.R. Status of vaccine research and development for Clostridium difficile. Vaccine 2019, 37, 7300–7306. [Google Scholar] [CrossRef] [PubMed]
- Rebeaud, F.; Bachmann, M.F. Immunization strategies for Clostridium difficile infections. Expert Rev. Vaccines 2012, 11, 469–479. [Google Scholar] [CrossRef] [PubMed]
- Kelly, C.P.; Kyne, L. The host immune response to Clostridium difficile. J. Med Microbiol. 2011, 60, 1070–1079. [Google Scholar] [CrossRef]
- Kuehne, S.A.; Cartman, S.T.; Heap, J.T.; Kelly, M.L.; Cockayne, A.; Minton, N.P. The role of toxin A and toxin B in Clostridium difficile infection. Nature 2010, 467, 711–713. [Google Scholar] [CrossRef] [PubMed]
- Guh, A.Y.; Kutty, P.K. Clostridioides difficile Infection. Ann. Intern. Med. 2018, 169, ITC49–ITC64. [Google Scholar] [CrossRef] [PubMed]
- Chandrasekaran, R.; Lacy, D.B. The role of toxins in Clostridium difficile infection. FEMS Microbiol. Rev. 2017, 41, 723–750. [Google Scholar] [CrossRef]
- Martinez-Melendez, A.; Cruz-Lopez, F.; Morfin-Otero, R.; Maldonado-Garza, H.J.; Garza-Gonzalez, E. An Update on Clostridioides difficile Binary Toxin. Toxins 2022, 14, 305. [Google Scholar] [CrossRef]
- Tian, J.H.; Fuhrmann, S.R.; Kluepfel-Stahl, S.; Carman, R.J.; Ellingsworth, L.; Flyer, D.C. A novel fusion protein containing the receptor binding domains of C. difficile toxin A and toxin B elicits protective immunity against lethal toxin and spore challenge in preclinical efficacy models. Vaccine 2012, 30, 4249–4258. [Google Scholar] [CrossRef]
- Donald, R.G.; Flint, M.; Kalyan, N.; Johnson, E.; Witko, S.E.; Kotash, C.; Zhao, P.; Megati, S.; Yurgelonis, I.; Lee, P.K.; et al. A novel approach to generate a recombinant toxoid vaccine against Clostridium difficile. Microbiology 2013, 159, 1254–1266. [Google Scholar] [CrossRef]
- Zhao, S.; Ghose-Paul, C.; Zhang, K.; Tzipori, S.; Sun, X. Immune-based treatment and prevention of Clostridium difficile infection. Hum. Vaccin. Immunother. 2014, 10, 3522–3530. [Google Scholar] [CrossRef] [PubMed]
- Sara, M.; Sleytr, U.B. S-layer proteins. J. Bacteriol. 2000, 182, 859–868. [Google Scholar] [CrossRef]
- Bradshaw, W.J.; Roberts, A.K.; Shone, C.C.; Acharya, K.R. The structure of the S-layer of Clostridium difficile. J. Cell Commun. Signal. 2018, 12, 319–331. [Google Scholar] [CrossRef] [PubMed]
- Calabi, E.; Ward, S.; Wren, B.; Paxton, T.; Panico, M.; Morris, H.; Dell, A.; Dougan, G.; Fairweather, N. Molecular characterization of the surface layer proteins from Clostridium difficile. Mol. Microbiol. 2001, 40, 1187–1199. [Google Scholar] [CrossRef] [PubMed]
- Karjalainen, T.; Waligora-Dupriet, A.J.; Cerquetti, M.; Spigaglia, P.; Maggioni, A.; Mauri, P.; Mastrantonio, P. Molecular and genomic analysis of genes encoding surface-anchored proteins from Clostridium difficile. Infect. Immun. 2001, 69, 3442–3446. [Google Scholar] [CrossRef] [PubMed]
- Bradshaw, W.J.; Kirby, J.M.; Roberts, A.K.; Shone, C.C.; Acharya, K.R. Cwp2 from Clostridium difficile exhibits an extended three domain fold and cell adhesion in vitro. FEBS J. 2017, 284, 2886–2898. [Google Scholar] [CrossRef] [PubMed]
- Willing, S.E.; Candela, T.; Shaw, H.A.; Seager, Z.; Mesnage, S.; Fagan, R.P.; Fairweather, N.F. Clostridium difficile surface proteins are anchored to the cell wall using CWB2 motifs that recognise the anionic polymer PSII. Mol. Microbiol. 2015, 96, 596–608. [Google Scholar] [CrossRef]
- Lanzoni-Mangutchi, P.; Banerji, O.; Wilson, J.; Barwinska-Sendra, A.; Kirk, J.A.; Vaz, F.; O’Beirne, S.; Basle, A.; El Omari, K.; Wagner, A.; et al. Structure and assembly of the S-layer in C. difficile. Nat. Commun. 2022, 13, 970. [Google Scholar] [CrossRef]
- Wright, A.; Drudy, D.; Kyne, L.; Brown, K.; Fairweather, N.F. Immunoreactive cell wall proteins of Clostridium difficile identified by human sera. J. Med. Microbiol. 2008, 57, 750–756. [Google Scholar] [CrossRef]
- Wright, A.; Wait, R.; Begum, S.; Crossett, B.; Nagy, J.; Brown, K.; Fairweather, N. Proteomic analysis of cell surface proteins from Clostridium difficile. Proteomics 2005, 5, 2443–2452. [Google Scholar] [CrossRef]
- Lawley, T.D.; Croucher, N.J.; Yu, L.; Clare, S.; Sebaihia, M.; Goulding, D.; Pickard, D.J.; Parkhill, J.; Choudhary, J.; Dougan, G. Proteomic and genomic characterization of highly infectious Clostridium difficile 630 spores. J. Bacteriol. 2009, 191, 5377–5386. [Google Scholar] [CrossRef] [PubMed]
- Frentrup, M.; Zhou, Z.; Steglich, M.; Meier-Kolthoff, J.P.; Göker, M.; Riedel, T.; Bunk, B.; Spröer, C.; Overmann, J.; Blaschitz, M. A publicly accessible database for genome sequences supports tracing of transmission chains and epidemics. Microb. Genom. 2020, 6, mgen000410. [Google Scholar] [CrossRef] [PubMed]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547. [Google Scholar] [CrossRef]
- Zimmermann, L.; Stephens, A.; Nam, S.-Z.; Rau, D.; Kübler, J.; Lozajic, M.; Gabler, F.; Söding, J.; Lupas, A.N.; Alva, V.J.J.o.m.b. A completely reimplemented MPI bioinformatics toolkit with a new HHpred server at its core. J. Mol. Biol. 2018, 430, 2237–2243. [Google Scholar] [CrossRef]
- Gabler, F.; Nam, S.Z.; Till, S.; Mirdita, M.; Steinegger, M.; Söding, J.; Lupas, A.N.; Alva, V.J.C.P.i.B. Protein Sequence Analysis Using the MPI Bioinformatics Toolkit. Curr. Protoc. Bioinform. 2020, 72, e108. [Google Scholar] [CrossRef] [PubMed]
- Waterhouse, A.M.; Procter, J.B.; Martin, D.M.; Clamp, M.; Barton, G.J. Jalview Version 2—A multiple sequence alignment editor and analysis workbench. Bioinformatics 2009, 25, 1189–1191. [Google Scholar] [CrossRef]
- Perez, J.; Springthorpe, V.S.; Sattar, S.A. Clospore: A liquid medium for producing high titers of semi-purified spores of Clostridium difficile. J. AOAC Int. 2011, 94, 618–626. [Google Scholar] [CrossRef]
- Wang, S.; Ju, X.; Heuler, J.; Zhang, K.; Duan, Z.; Warnakulasuriya Patabendige, H.M.L.; Zhao, S.; Sun, X. Recombinant Fusion Protein Vaccine Containing Clostridioides difficile FliC and FliD Protects Mice against C. Difficile Infection. Infect. Immun. 2023, 91, e0016922. [Google Scholar] [CrossRef] [PubMed]
- Sorg, J.A.; Dineen, S.S. Laboratory maintenance of Clostridium difficile. Curr. Protoc. Microbiol. 2009, 12, 9A-1. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.; Wang, Y.; Cai, Y.; Kelly, C.P.; Sun, X. Novel Chimeric Protein Vaccines Against Clostridium difficile Infection. Front. Immunol. 2018, 9, 2440. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.; Zhu, D.; Sun, X. Development of an Effective Nontoxigenic Clostridioides difficile-Based Oral Vaccine against C. difficile Infection. Microbiol. Spectr. 2022, 10, e0026322. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.K.; Yan, Y.X.; Kim, H.B.; Ju, X.; Zhao, S.; Zhang, K.; Tzipori, S.; Sun, X. A chimeric protein comprising the glucosyltransferase and cysteine proteinase domains of toxin B and the receptor binding domain of toxin A induces protective immunity against Clostridium difficile infection in mice and hamsters. Hum. Vaccin. Immunother. 2015, 11, 2215–2222. [Google Scholar] [CrossRef] [PubMed]
- Joshi, L.T.; Phillips, D.S.; Williams, C.F.; Alyousef, A.; Baillie, L. Contribution of Spores to the Ability of Clostridium difficile To Adhere to Surfaces. Appl. Environ. Microb. 2012, 78, 7671–7679. [Google Scholar] [CrossRef]
- McCarthy, M.K.; Procario, M.C.; Twisselmann, N.; Wilkinson, J.E.; Archambeau, A.J.; Michele, D.E.; Day, S.M.; Weinberg, J.B. Proinflammatory effects of interferon gamma in mouse adenovirus 1 myocarditis. J. Virol. 2015, 89, 468–479. [Google Scholar] [CrossRef] [PubMed]
- Liu, W.; Xiong, W.; Liu, W.; Hirakawa, J.; Kawashima, H. A novel monoclonal antibody against 6-sulfo sialyl Lewis x glycans attenuates murine allergic rhinitis by suppressing Th2 immune responses. Sci. Rep. 2023, 13, 15740. [Google Scholar] [CrossRef]
- Yuan, Q.; Zhao, Y.; Zhu, X.; Liu, X. Low regulatory T cell and high IL-17 mRNA expression in a mouse Graves’ disease model. J. Endocrinol. Investig. 2017, 40, 397–407. [Google Scholar] [CrossRef]
- Calabi, E.; Fairweather, N. Patterns of sequence conservation in the S-layer proteins and related sequences in Clostridium difficile. J. Bacteriol. 2002, 184, 3886–3897. [Google Scholar] [CrossRef] [PubMed]
- Usenik, A.; Renko, M.; Mihelič, M.; Lindič, N.; Borišek, J.; Perdih, A.; Pretnar, G.; Müller, U.; Turk, D. The CWB2 cell wall-anchoring module is revealed by the crystal structures of the Clostridium difficile cell wall proteins Cwp8 and Cwp6. Structure 2017, 25, 514–521. [Google Scholar] [CrossRef]
- de Bruyn, G.; Gordon, D.L.; Steiner, T.; Tambyah, P.; Cosgrove, C.; Martens, M.; Bassily, E.; Chan, E.S.; Patel, D.; Chen, J.; et al. Safety, immunogenicity, and efficacy of a Clostridioides difficile toxoid vaccine candidate: A phase 3 multicentre, observer-blind, randomised, controlled trial. Lancet Infect. Dis. 2021, 21, 252–262. [Google Scholar] [CrossRef]
- Heuler, J.; Chandra, H.; Sun, X. Mucosal Vaccination Strategies against Clostridioides difficile Infection. Vaccines 2023, 11, 887. [Google Scholar] [CrossRef]
- Pechine, S.; Gleizes, A.; Janoir, C.; Gorges-Kergot, R.; Barc, M.C.; Delmee, M.; Collignon, A. Immunological properties of surface proteins of Clostridium difficile. J. Med. Microbiol. 2005, 54, 193–196. [Google Scholar] [CrossRef]
- Laera, D.; HogenEsch, H.; O’Hagan, D.T. Aluminum Adjuvants-‘Back to the Future’. Pharmaceutics 2023, 15, 1884. [Google Scholar] [CrossRef]
- HogenEsch, H.; O’Hagan, D.T.; Fox, C.B. Optimizing the utilization of aluminum adjuvants in vaccines: You might just get what you want. NPJ Vaccines 2018, 3, 51. [Google Scholar] [CrossRef]
- Chandra, H.; Kovall, R.A.; Yadav, J.S.; Sun, X. Host Immune Responses to Surface S-Layer Proteins (SLPs) of Clostridioides difficile. Microorganisms 2023, 11, 380. [Google Scholar] [CrossRef] [PubMed]
- Noori, M.; Azimirad, M.; Eslami, G.; Looha, M.A.; Yadegar, A.; Ghalavand, Z.; Zali, M.R. Surface layer protein A from hypervirulent Clostridioides difficile ribotypes induce significant changes in the gene expression of tight junctions and inflammatory response in human intestinal epithelial cells. BMC Microbiol. 2022, 22, 259. [Google Scholar] [CrossRef] [PubMed]
Target | Forward Primer (5′ to 3′) | Reverse Primer (5′ to 3′) |
---|---|---|
GAPDH | TGCACCACCAACTGCTTAG | GGATGCAGGGATGATGTTC |
IFN-γ | AAAGAGATAATCTGGCTCTGC | GCTCTGAGACAATGAACGCT |
TNF-α | CCACCACGCTCTTCTGTCTAC | AGGGTCTGGGCCATAGAACT |
IL-17 | GGAGAAAGCGGATACCAA | TGTGAGGACTACCGAGCC |
IL-4 | TCTCGAATGTACCAGGAGCCATATC | AGCACCTTGGAAGCCCTACAGA |
IL-5 | AGCACAGTGGTGAAAGAGACCTT | TCCAATGCATAGCTGGTGATTT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, S.; Heuler, J.; Bullock, J.; Qin, J.; Chakraborty, S.; Nathaniel, A.L.; Wang, S.; Sun, X. Cell Wall Protein 2 as a Vaccine Candidate Protects Mice Against Clostridioides difficile Infection. Vaccines 2025, 13, 21. https://doi.org/10.3390/vaccines13010021
Wang S, Heuler J, Bullock J, Qin J, Chakraborty S, Nathaniel AL, Wang S, Sun X. Cell Wall Protein 2 as a Vaccine Candidate Protects Mice Against Clostridioides difficile Infection. Vaccines. 2025; 13(1):21. https://doi.org/10.3390/vaccines13010021
Chicago/Turabian StyleWang, Shaohui, Joshua Heuler, Jessica Bullock, Junling Qin, Soumyadeep Chakraborty, Agbendeh Lubem Nathaniel, Shifeng Wang, and Xingmin Sun. 2025. "Cell Wall Protein 2 as a Vaccine Candidate Protects Mice Against Clostridioides difficile Infection" Vaccines 13, no. 1: 21. https://doi.org/10.3390/vaccines13010021
APA StyleWang, S., Heuler, J., Bullock, J., Qin, J., Chakraborty, S., Nathaniel, A. L., Wang, S., & Sun, X. (2025). Cell Wall Protein 2 as a Vaccine Candidate Protects Mice Against Clostridioides difficile Infection. Vaccines, 13(1), 21. https://doi.org/10.3390/vaccines13010021