TonB-Dependent Receptor Protein Displayed on Spores of Bacillus subtilis Stimulates Protective Immune Responses against Acinetobacter baumannii
Abstract
1. Introduction
2. Materials and Methods
2.1. Bacterial Origins, Plasmids, and Culture Conditions
2.2. Construction of Recombinant B. subtilis Spores Displaying TBDR of A. baumannii
2.3. Recombinant Spore Preparation and Evaluation of TBDR Protein on the Spore Surface
2.4. Animals and Immunization Schedule
2.5. Sample Collection and Processing
2.6. Determination of TBDR-Specific Antibody by Indirect Spore ELISA
2.7. Binding of Secretory IgA (sIgA) to A. baumannii Clinical Isolates
2.8. Complement-Mediated Bacteriolysis
2.9. Opsonophagocytic Killing Assay (OPKA)
2.10. Statistical Analysis
3. Results
3.1. Construction of Recombinant Plasmids Carrying TBDR of A. baumannii
3.2. Display of TBDR on the B. subtilis Spore Surface
3.3. Animal Inoculation with the Recombinant Spores
3.4. TBDR-Specific Antibodies in Inoculated Mice
3.5. Binding of sIgA from Intestinal Secretion to Clinical Isolates A. baumannii
3.6. Complement-Mediated Bacteriolysis Activity
3.7. Opsonophagocytic Killing (OPK) Activity against Different Clinical Isolates
4. Discussion
5. Patents
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix A
NAME | PRIMER SEQUENCE (5’-3’) |
---|---|
For confirmation of the insert in pHPS9 vector (sequencing) | |
pHPS9_1000F | TTAAAAACATATATTTGC |
pHPS9_3544R | CTAGTTGGTTTGTAGACG |
407-R | CTAAATATCAATTTTTGACC |
4783-F | CATGAGATCGAGAAC |
For the generation of constructs with 6x-His sequence | |
B.sub_all-F | CGAGCTC GGGGAGGAGAATCATG SacI |
Ab6908BsubR | GCCTGCAGGTTAGTGATGGTGATGGTGATGAAAGCGATATCTAAGCG SbfI 6x His |
Ab1PR82BsubR | GCCTGCAGGTTAGTGATGGTGATGGTGATGATAATTAAATGTATAGC SbfI 6x His |
For insertion of a 6x-His sequence using site-directed mutagenesis | |
Q56908_F | CACCACCACTAACCTGCAGGCATTCCA |
Q56908_R | ATGATGATGAAAGCGATATCTAAGCGC |
Q51PR82_F | CACCACCACTAACCTGCAGGCATTCCA |
Q51PR82_R | ATGATGATGATAATTAAATGTATAGCTAAGGCC |
Appendix B
Appendix C
Isolates | Source | Antimicrobial Susceptibility Profile | ||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
AP | SXT | SAM | AMC | CN | NET | CXM | CAZ | CRO | CTX | PIP | CIP | IPM | MEM | FEP | SCF | TZP | AN | CT | ||
Ab16 | Skin Blister | R | S | R | R | R | R | R | R | R | R | R | R | R | R | R | R | R | S | S |
Ab29 | Blood | R | R | R | R | R | R | R | R | R | R | R | R | R | R | R | R | R | R | S |
Ab35 | Bronchoalveolar Lavage | R | R | R | R | IN | R | R | R | R | R | R | R | R | R | R | R | R | R | S |
References
- Shamsizadeh, Z.; Nikaeen, M.; Nasr Esfahani, B.; Mirhoseini, S.H.; Hatamzadeh, M.; Hassanzadeh, A. Detection of antibiotic resistant Acinetobacter baumannii in various hospital environments: Potential sources for transmission of Acinetobacter infections. Environ. Health Prev. Med. 2017, 22, 44. [Google Scholar] [CrossRef] [PubMed]
- Zhang, C.; Hao, L.; Miao, H.; Chen, J.; Yuan, T.; Lei, Z.; Zhang, Z.; Utsumi, M.; Itayama, T.; Miura, T.; et al. Emergence of multidrug-resistant Acinetobacter baumannii under fluctuating levofloxacin concentration and its control by chlorine and UV disinfection. Process Saf. Environ. Prot. 2023, 173, 344–353. [Google Scholar] [CrossRef]
- Wang, J.; Stegger, M.; Moodley, A.; Yang, M. Drug Combination of Ciprofloxacin and Polymyxin B for the Treatment of Multidrug-Resistant Acinetobacter baumannii Infections: A Drug Pair Limiting the Development of Resistance. Pharmaceutics 2023, 15, 720. [Google Scholar] [CrossRef] [PubMed]
- Mohd Rani, F.; Ni, A.R.; Ismail, S.; Abdullah, F.H.; Othman, N.; Alattraqchi, A.G.; Cleary, D.W.; Clarke, S.C.; Yeo, C.C. Prevalence and antimicrobial susceptibilities of Acinetobacter baumannii and non-baumannii Acinetobacters from Terengganu, Malaysia and their carriage of carbapenemase genes. J. Med. Microbiol. 2018, 67, 1538–1543. [Google Scholar] [CrossRef] [PubMed]
- WHO. WHO Priority Pathogens List of R&D of New Antibiotics, in Global Priority List of Antibiotic-Resistant Bacteria to Guide Research, Discovery, and Development of New Antibiotics; Essential Medicines and Health Products Information Portal; World Health Organization: Geneva, Switzerland, 2017; p. 7. [Google Scholar]
- Zeng, X.; Wang, N.; Xiang, C.; Liu, Q.; Li, D.; Zhou, Y.; Zhang, X.; Xie, Y.; Zhang, W.; Yang, H.; et al. Peptidoglycan-associated lipoprotein contributes to the virulence of Acinetobacter baumannii and serves as a vaccine candidate. Genomics 2023, 115, 110590. [Google Scholar] [CrossRef]
- Sun, P.; Li, X.; Pan, C.; Liu, Z.; Wu, J.; Wang, H.; Zhu, L. A Short Peptide of Autotransporter Ata Is a Promising Protective Antigen for Vaccination against Acinetobacter baumannii. Front. Immunol. 2022, 13, 884555. [Google Scholar] [CrossRef]
- Russo, T.A.; Beanan, J.M.; Olson, R.; MacDonald, U.; Cox, A.D.; St Michael, F.; Vinogradov, E.V.; Spellberg, B.; Luke-Marshall, N.R.; Campagnari, A.A. The K1 capsular polysaccharide from Acinetobacter baumannii is a potential therapeutic target via passive immunization. Infect. Immun. 2013, 81, 915–922. [Google Scholar] [CrossRef]
- Tan, Y.C.; Lahiri, C. Promising Acinetobacter baumannii Vaccine Candidates and Drug Targets in Recent Years. Front. Immunol. 2022, 13, 900509. [Google Scholar] [CrossRef]
- Huang, W.; Yao, Y.; Wang, S.; Xia, Y.; Yang, X.; Long, Q.; Sun, W.; Liu, C.; Li, Y.; Chu, X.; et al. Immunization with a 22-kDa outer membrane protein elicits protective immunity to multidrug-resistant Acinetobacter baumannii. Sci. Rep. 2016, 6, 20724. [Google Scholar] [CrossRef]
- Singh, R.; Capalash, N.; Sharma, P. Immunoprotective potential of BamA, the outer membrane protein assembly factor, against MDR Acinetobacter baumannii. Sci. Rep. 2017, 7, 12411. [Google Scholar] [CrossRef]
- Dalsass, M.; Brozzi, A.; Medini, D.; Rappuoli, R. Comparison of Open-Source Reverse Vaccinology Programs for Bacterial Vaccine Antigen Discovery. Front. Immunol. 2019, 10, 113. [Google Scholar] [CrossRef] [PubMed]
- Chiang, M.H.; Sung, W.C.; Lien, S.-P.; Chen, Y.-Z.; Lo, A.F.; Huang, J.-H.; Kuo, S.-C.; Chong, P. Identification of novel vaccine candidates against Acinetobacter baumannii using reverse vaccinology. Hum. Vaccines Immunother. 2015, 11, 1065–1073. [Google Scholar] [CrossRef] [PubMed]
- Singh, R.; Garg, N.; Shukla, G.; Capalash, N.; Sharma, P. Immunoprotective Efficacy of Acinetobacter baumannii Outer Membrane Protein, FilF, Predicted In silico as a Potential Vaccine Candidate. Front. Microbiol. 2016, 7, 158. [Google Scholar] [CrossRef] [PubMed]
- Ni, Z.; Chen, Y.; Ong, E.; He, Y. Antibiotic Resistance Determinant-Focused Acinetobacter baumannii Vaccine Designed Using Reverse Vaccinology. Int. J. Mol. Sci. 2017, 18, E458. [Google Scholar] [CrossRef] [PubMed]
- Akbari, Z.; Rasooli, I.; Ghaini, M.H.; Chaudhuri, S.; Farshchi Andisi, V.; Jahangiri, A.; Ramezanalizadeh, F.; Schryvers, A.B. BauA and Omp34 surface loops trigger protective antibodies against Acinetobacter baumannii in a murine sepsis model. Int. Immunopharmacol. 2022, 108, 108731. [Google Scholar] [CrossRef]
- McConnell, M.J.; Martin-Galiano, A.J. Designing Multi-Antigen Vaccines against Acinetobacter baumannii Using Systemic Approaches. Front. Immunol. 2021, 12, 666742. [Google Scholar] [CrossRef]
- Wang, J.; Xiong, K.; Pan, Q.; He, W.; Cong, Y. Application of TonB-Dependent Transporters in Vaccine Development of Gram-Negative Bacteria. Front. Cell. Infect. Microbiol. 2021, 10, 589115. [Google Scholar] [CrossRef]
- Esmaeilkhani, H.; Rasooli, I.; Nazarian, S.; Sefid, F. In vivo validation of the immunogenicity of recombinant Baumannii Acinetobactin Utilization A protein (rBauA). Microb. Pathog. 2016, 98, 77–81. [Google Scholar] [CrossRef]
- Aghajani, Z.; Rasooli, I.; Mousavi Gargari, S.L. Exploitation of two siderophore receptors, BauA and BfnH, for protection against Acinetobacter baumannii infection. APMIS 2019, 127, 753–763. [Google Scholar] [CrossRef]
- Chaudhuri, S.; Rasooli, I.; Oskouei, R.H.; Pishgahi, M.; Jahangir, A.; Andisi, V.F.; Schryvers, A.B. Hybrid antigens expressing surface loops of BauA from Acinetobacter baumannii are capable of inducing protection against infection. Front. Immunol. 2022, 13, 933445. [Google Scholar] [CrossRef]
- Tavares Batista, M.; Souza, R.D.; Paccez, J.D.; Luiz, W.B.; Ferreira, E.L.; Cavalcante, R.C.M.; Ferreira, R.C.C.; Ferreira, L.C.S. Gut Adhesive Bacillus subtilis Spores as a Platform for Mucosal Delivery of Antigens. Infect. Immun. 2014, 82, 1414–1423. [Google Scholar] [CrossRef] [PubMed]
- Dai, X.; Liu, M.; Pan, K.; Yang, J. Surface display of OmpC of Salmonella serovar Pullorum on Bacillus subtilis spores. PLoS ONE 2018, 13, e0191627. [Google Scholar] [CrossRef] [PubMed]
- Mutlu, A.; Trauth, S.; Ziesack, M.; Nagler, K.; Bergeest, J.-P.; Rohr, K.; Becker, N.; Höfer, T.; Bischofs, I.B. Phenotypic memory in Bacillus subtilis links dormancy entry and exit by a spore quantity-quality tradeoff. Nat. Commun. 2018, 9, 69. [Google Scholar] [CrossRef] [PubMed]
- Souza, C.C.; Guimaraes, J.M.; Pereira, S.D.S.; Mariuba, L.A.M. The multifunctionality of expression systems in Bacillus subtilis: Emerging devices for the production of recombinant proteins. Exp. Biol. Med. 2021, 246, 2443–2453. [Google Scholar] [CrossRef]
- Mat Rahim, N.; Lee, H.; Strych, U.; AbuBakar, S. Facing the challenges of multidrug-resistant Acinetobacter baumannii: Progress and prospects in the vaccine development. Hum. Vaccines Immunother. 2021, 17, 3784–3794. [Google Scholar] [CrossRef]
- Jee, P.F.; Chen, F.S.; Shu, M.H.; Wong, W.F.; Abdul Rahim, R.; AbuBakar, S.; Chang, L.Y. Insertion of single-chain variable fragment (scFv) peptide linker improves surface display of influenza hemagglutinin (HA1) on non-recombinant Lactococcus lactis. Biotechnol. Prog. 2017, 33, 154–162. [Google Scholar] [CrossRef]
- Copland, A.; Diogo, G.R.; Hart, P.; Harris, S.; Tran, A.C.; Paul, M.J.; Singh, M.; Cutting, S.M.; Reljic, R. Mucosal Delivery of Fusion Proteins with Bacillus subtilis Spores Enhances Protection against Tuberculosis by Bacillus Calmette-Guérin. Front. Immunol. 2018, 9, 346. [Google Scholar] [CrossRef]
- Lee, S.J.; Pan, J.G.; Park, S.H.; Choi, S.K. Development of a stationary phase-specific autoinducible expression system in Bacillus subtilis. J. Biotechnol. 2010, 149, 16–20. [Google Scholar] [CrossRef]
- Pan, J.-G.; Choi, S.-K.; Jung, H.-C.; Kim, E.-J. Display of native proteins on Bacillus subtilis spores. FEMS Microbiol. Lett. 2014, 358, 209–217. [Google Scholar] [CrossRef]
- Nicholson, W.; Setlow, P. Sporulation, Germination and Outgrowth, in Molecular Biological Methods for Bacillus; Harwood, C.R., Cutting, S.M., Eds.; Wiley: Chichester, UK, 1990; pp. 391–429. [Google Scholar]
- Mat-Rahim, N.-A.; AbuBakar, S. Human Enterovirus 71 DNA Vaccine Constructs Containing 5’UTR with Complete Internal Ribosome Entry Site Sequence Stimulated Improved Anti-Human Enterovirus 71 Neutralizing Immune Responses. World J. Vaccines 2014, 4, 33–43. [Google Scholar] [CrossRef]
- Nygren, E.; Holmgren, J.; Attridge, S.R. Murine antibody responses following systemic or mucosal immunization with viable or inactivated Vibrio cholerae. Vaccine 2008, 26, 6784–6790. [Google Scholar] [CrossRef] [PubMed]
- Johansson, E.L.; Rask, C.; Fredriksson, M.; Eriksson, K.; Czerkinsky, C.; Holmgren, J. Antibodies and antibody-secreting cells in the female genital tract after vaginal or intranasal immunization with cholera toxin B subunit or conjugates. Infect. Immun. 1998, 66, 514–520. [Google Scholar] [CrossRef] [PubMed]
- Kuehn, A.; Kovac, P.; Saksena, R.; Bannert, N.; Klee, S.R.; Ranisch, H.; Grunow, R. Development of antibodies against anthrose tetrasaccharide for specific detection of Bacillus anthracis spores. Clin. Vaccine Immunol. 2009, 16, 1728–1737. [Google Scholar] [CrossRef] [PubMed]
- Frey, A.; Di Canzio, J.; Zurakowski, D. A statistically defined endpoint titer determination method for immunoassays. J. Immunol. Methods 1998, 221, 35–41. [Google Scholar] [CrossRef]
- Shu, M.H.; MatRahim, N.; NorAmdan, N.; Pang, S.P.; Hashim, S.H.; Phoon, W.H.; AbuBakar, S. An Inactivated Antibiotic-Exposed Whole-Cell Vaccine Enhances Bactericidal Activities against Multidrug-Resistant Acinetobacter baumannii. Sci. Rep. 2016, 6, 22332. [Google Scholar] [CrossRef]
- Jansen, K.U.; Knirsch, C.; Anderson, A.S. The role of vaccines in preventing bacterial antimicrobial resistance. Nat. Med. 2018, 24, 10–19. [Google Scholar] [CrossRef]
- Abdollahi, S.; Rasooli, I.; Mousavi Gargari, S.L. The role of TonB-dependent copper receptor in virulence of Acinetobacter baumannii. Infect. Genet. Evol. 2018, 60, 181–190. [Google Scholar] [CrossRef] [PubMed]
- Fujita, M.; Mori, K.; Hara, H.; Hishiyama, S.; Kamimura, N.; Masai, E. A TonB-dependent receptor constitutes the outer membrane transport system for a lignin-derived aromatic compound. Commun. Biol. 2019, 2, 432. [Google Scholar] [CrossRef] [PubMed]
- Burgess, N.K.; Dao, T.P.; Stanley, A.M.; Fleming, K.G. β-Barrel Proteins That Reside in the Escherichia coli Outer Membrane in Vivo Demonstrate Varied Folding Behavior in Vitro. J. Biol. Chem. 2008, 283, 26748–26758. [Google Scholar] [CrossRef]
- Guoyan, Z.; Yingfeng, A.; Zabed, H.; Qi, G.; Yang, M.; Jiao, Y.; Li, W.; Wenjing, S.; Xianghui, Q. Bacillus subtilis Spore Surface Display Technology: A Review of Its Development and Applications. J. Microbiol. Biotechnol. 2019, 29, 179–190. [Google Scholar] [CrossRef]
- Wang, H.; Jiang, X.; Qian, Y.; Yin, L. Constructing an Efficient Bacillus subtilis Spore Display by Using Cohesin-Dockerin Interactions. Molecules 2021, 26, 1186. [Google Scholar] [CrossRef] [PubMed]
- Vela Ramirez, J.E.; Sharpe, L.A.; Peppas, N.A. Current state and challenges in developing oral vaccines. Adv. Drug Deliv. Rev. 2017, 114, 116–131. [Google Scholar] [CrossRef] [PubMed]
- Pelaseyed, T.; Bergström, J.H.; Gustafsson, J.K.; Ermund, A.; Birchenough, G.M.H.; Schütte, A.; van der Post, S.; Svensson, F.; Rodríguez-Piñeiro, A.M.; Nyström, E.E.L.; et al. The mucus and mucins of the goblet cells and enterocytes provide the first defense line of the gastrointestinal tract and interact with the immune system. Immunol. Rev. 2014, 260, 8–20. [Google Scholar] [CrossRef]
- Qin, J.; Wang, X.; Kong, J.; Ma, C.; Xu, P. Construction of a food-grade cell surface display system for Lactobacillus casei. Microbiol. Res. 2014, 169, 733–740. [Google Scholar] [CrossRef]
- Jiang, B.; Li, Z.; Ou, B.; Duan, Q.; Zhu, G. Targeting ideal oral vaccine vectors based on probiotics: A systematical view. Appl. Microbiol. Biotechnol. 2019, 103, 3941–3953. [Google Scholar] [CrossRef]
- Buddenborg, C.; Daudel, D.; Liebrecht, S.; Greune, L.; Humberg, V.; Schmidt, M.A. Development of a tripartite vector system for live oral immunization using a Gram-negative probiotic carrier. Int. J. Med. Microbiol. 2008, 298, 105–114. [Google Scholar] [CrossRef]
- Zhang, R.; Xu, T.; Li, Z.; Li, L.; Li, C.; Li, X.; Wang, Z.; Wang, S.; Wang, X.; Zhang, H. Vaccination with recombinant Lactococcus lactis expressing HA1-IgY Fc fusion protein provides protective mucosal immunity against H9N2 avian influenza virus in chickens. Virol. J. 2023, 20, 76. [Google Scholar] [CrossRef] [PubMed]
- Vetráková, A.; Chovanová, R.K.; Rechtoríková, R.; Krajčíková, D.; Barák, I. Bacillus subtilis spores displaying RBD domain of SARS-CoV-2 spike protein. Comput. Struct. Biotechnol. J. 2023, 21, 1550–1556. [Google Scholar] [CrossRef]
- Zhao, Z.; Wang, H.; Zhang, D.; Guan, Y.; Siddiqui, S.A.; Feng-Shan, X.; Cong, B. Oral vaccination with recombinant Lactobacillus casei expressing Aeromonas hydrophila Aha1 against A. hydrophila infections in common carps. Virulence 2022, 13, 794–807. [Google Scholar] [CrossRef]
- Forsström, B.; Axnäs, B.B.; Rockberg, J.; Danielsson, H.; Bohlin, A.; Uhlen, M. Dissecting antibodies with regards to linear and conformational epitopes. PLoS ONE 2015, 10, e0121673. [Google Scholar] [CrossRef]
- Loong, S.K.; Mahfodz, N.H.; Che Mat Seri, N.A.; Mohamad Wali, H.A.; Abd Gani, S.A.; Wong, P.F.; AbuBakar, S. Genetic characterization of commensal Escherichia coli isolated from laboratory rodents. Springerplus 2016, 5, 1035. [Google Scholar] [CrossRef] [PubMed]
- Sanchez-Larrayoz, A.F.; Elhosseiny, N.M.; Chevrette, M.G.; Fu, Y.; Giunta, P.; Spallanzani, R.G.; Ravi, K.; Pier, G.B.; Lory, S.; Maira-Litrán, T. Complexity of Complement Resistance Factors Expressed by Acinetobacter baumannii Needed for Survival in Human Serum. J. Immunol. 2017, 199, 2803. [Google Scholar] [CrossRef] [PubMed]
- Moor, K.; Diard, M.; Sellin, M.E.; Felmy, B.; Wotzka, S.Y.; Toska, A.; Bakkeren, E.; Arnoldini, M.; Bansept, F.; Co, A.D.; et al. High-avidity IgA protects the intestine by enchaining growing bacteria. Nature 2017, 544, 498–502. [Google Scholar] [CrossRef]
- Zwarthoff, S.A.; Widmer, K.; Kuipers, A.; Strasser, J.; Ruyken, M.; Aerts, P.C.; de Haas, C.J.C.; Ugurlar, D.; den Boer, M.A.; Vidarsson, G.; et al. C1q binding to surface-bound IgG is stabilized by C1r2s2 proteases. Proc. Natl. Acad. Sci. USA 2021, 118, e2102787118. [Google Scholar] [CrossRef] [PubMed]
- Qiu, H.; KuoLee, R.; Harris, G.; Van Rooijen, N.; Patel, G.B.; Chen, W. Role of Macrophages in Early Host Resistance to Respiratory Acinetobacter baumannii Infection. PLoS ONE 2012, 7, e40019. [Google Scholar] [CrossRef] [PubMed]
- Chen, W. Host Innate Immune Responses to Acinetobacter baumannii Infection. Front. Cell. Infect. Microbiol. 2020, 10, 486. [Google Scholar] [CrossRef]
- Padeh, S.; Jaffe, C.L.; Passwell, J.H. Activation of human monocytes via their sIgA receptors. Immunology 1991, 72, 188–193. [Google Scholar]
- FrançA, E.L.; Morceli, G.; Fagundes, D.L.G.; Rudge, M.V.C.; Calderon, I.D.M.P.; Honorio-FrançA, A.C. Secretory IgA–Fcα receptor interaction modulating phagocytosis and microbicidal activity by phagocytes in human colostrum of diabetics. APMIS 2011, 119, 710–719. [Google Scholar] [CrossRef]
- Antunes, L.C.S.; Imperi, F.; Towner, K.J.; Visca, P. Genome-assisted identification of putative iron-utilization genes in Acinetobacter baumannii and their distribution among a genotypically diverse collection of clinical isolates. Res. Microbiol. 2011, 162, 279–284. [Google Scholar] [CrossRef]
- Harris, G.; KuoLee, R.; Xu, H.H.; Chen, W. Acute intraperitoneal infection with a hypervirulent Acinetobacter baumannii isolate in mice. Sci. Rep. 2019, 9, 6538. [Google Scholar] [CrossRef]
Groups | Liver (g) | Intestine (g) |
---|---|---|
Control (spPS9) | 1.138 ± 0.193 | 2.105 ± 0.220 |
sp6908 | 1.034 ± 0.210 | 1.942 ± 0.228 |
spPR82 | 1.079 ± 0.175 | 1.942 ± 0.277 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
MatRahim, N.-A.; Jones, K.M.; Keegan, B.P.; Strych, U.; Zhan, B.; Lee, H.-Y.; AbuBakar, S. TonB-Dependent Receptor Protein Displayed on Spores of Bacillus subtilis Stimulates Protective Immune Responses against Acinetobacter baumannii. Vaccines 2023, 11, 1106. https://doi.org/10.3390/vaccines11061106
MatRahim N-A, Jones KM, Keegan BP, Strych U, Zhan B, Lee H-Y, AbuBakar S. TonB-Dependent Receptor Protein Displayed on Spores of Bacillus subtilis Stimulates Protective Immune Responses against Acinetobacter baumannii. Vaccines. 2023; 11(6):1106. https://doi.org/10.3390/vaccines11061106
Chicago/Turabian StyleMatRahim, Nor-Aziyah, Kathryn Marie Jones, Brian P. Keegan, Ulrich Strych, Bin Zhan, Hai-Yen Lee, and Sazaly AbuBakar. 2023. "TonB-Dependent Receptor Protein Displayed on Spores of Bacillus subtilis Stimulates Protective Immune Responses against Acinetobacter baumannii" Vaccines 11, no. 6: 1106. https://doi.org/10.3390/vaccines11061106
APA StyleMatRahim, N.-A., Jones, K. M., Keegan, B. P., Strych, U., Zhan, B., Lee, H.-Y., & AbuBakar, S. (2023). TonB-Dependent Receptor Protein Displayed on Spores of Bacillus subtilis Stimulates Protective Immune Responses against Acinetobacter baumannii. Vaccines, 11(6), 1106. https://doi.org/10.3390/vaccines11061106