Efficacy of Phase I and Phase II Coxiella burnetii Bacterin Vaccines in a Pregnant Ewe Challenge Model
Abstract
:1. Introduction
2. Materials and Methods
2.1. Propagation of C. burnetii Strain
2.2. Experimental Design
2.2.1. Animals
2.2.2. Immunization and Challenge
2.2.3. Assessment of Post-Vaccination Reactogenicity
2.2.4. Sample Collection
2.3. Preparation of Clinical Samples
2.4. DNA Extraction
2.5. Detection of Abortifacient Agents
2.5.1. qPCR Detection of Abortifacient Agents
2.5.2. Serology
Coxiella burnetii ELISA
Chlamydia abortus ELISA
Toxoplasma gondii ELISA
2.6. Characterisation of LPS from C. burnetii Phase II Antigen
2.6.1. LPS Extraction
2.6.2. Visualization of C. burnetii LPS
2.7. Statistical Analysis
3. Results
3.1. Assessment of Post-Vaccination Reactogenicity
3.2. Serological Response to Vaccination and C. burnetii Challenge
3.3. Shedding of C. burnetii in Milk, Faecal and Vaginal Swab Samples
3.3.1. C. burnetii Shedding on Days 0, 1, 2 and 3, Relative to Lambing
3.3.2. C. burnetii Shedding at Weekly Sampling Points
3.4. Presence of C. burnetii DNA in Tissue Samples of Ewes and Lambs at Post-Mortem
3.5. Lambing Outcomes
3.6. Chlamydia abortus and Toxoplasma gondii Status
3.7. Characterisation of C. burnetii Phase II LPS
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Derrick, E.H. “Q” fever, a new fever entity: Clinical features, diagnosis and laboratory investigation. Med. J. Aust. 1937, 2, 281–299. [Google Scholar] [CrossRef]
- Eibach, R.; Bothe, F.; Runge, M.; Fischer, S.F.; Philipp, W.; Ganter, M. Q fever: Baseline monitoring of a sheep and a goat flock associated with human infections. Epidemiol. Infect. 2012, 140, 1939–1949. [Google Scholar] [CrossRef] [Green Version]
- Hilbink, F.; Penrose, M.; Kovacova, E.; Kazar, J. Q fever is absent from New Zealand. Int. J. Epidemiol. 1993, 22, 945–949. [Google Scholar] [CrossRef]
- Avberšek, J.; Pate, M.; Škibin, A.; Ocepek, M.; Krt, B. Management of a Coxiella burnetii-infected sheep flock after an outbreak of Q fever in humans. Turk. J. Vet. Anim. Sci. 2019, 43, 264–270. [Google Scholar] [CrossRef]
- Bontje, D.M.; Backer, J.A.; Hogerwerf, L.; Roest, H.I.J.; van Roermund, H.J.W. Analysis of Q fever in Dutch dairy goat herds and assessment of control measures by means of a transmission model. Prev. Vet. Med. 2016, 123, 71–89. [Google Scholar] [CrossRef] [Green Version]
- Meiklejohn, G.; Reimer, L.G.; Graves, P.S.; Helmick, C. Cryptic epidemic of Q fever in a medical school. J. Infect. Dis. 1981, 144, 107–113. [Google Scholar] [CrossRef]
- Brom, R.V.d.; Engelen, E.v.; Roest, H.I.J.; der Hoek, W.v.; Vellema, P. Coxiella burnetii infections in sheep or goats: An opinionated review. Vet. Microbiol. 2015, 181, 119–129. [Google Scholar] [CrossRef]
- Plummer, P.J.; McClure, J.; Menzies, P.; Morley, P.S.; Van den Brom, R.; Van Metre, D.C. Management of Coxiella burnetii infection in livestock populations and the associated zoonotic risk: A consensus statement. J. Vet. Intern. Med. 2018, 32, 1481–1494. [Google Scholar] [CrossRef] [Green Version]
- Arricau Bouvery, N.; Souriau, A.; Lechopier, P.; Rodolakis, A. Experimental Coxiella burnetii infection in pregnant goats: Excretion routes. Vet. Res. 2003, 34, 423–433. [Google Scholar] [CrossRef] [Green Version]
- Rodolakis, A.; Berri, M.; Hechard, C.; Caudron, C.; Souriau, A.; Bodier, C.C.; Blanchard, B.; Camuset, P.; Devillechaise, P.; Natorp, J.C.; et al. Comparison of Coxiella burnetii shedding in milk of dairy bovine, caprine, and ovine herds. J. Dairy Sci. 2007, 90, 5352–5360. [Google Scholar] [CrossRef] [Green Version]
- Eldin, C.; Melenotte, C.; Mediannikov, O.; Ghigo, E.; Million, M.; Edouard, S.; Mege, J.L.; Maurin, M.; Raoult, D. From Q Fever to Coxiella burnetii Infection: A Paradigm Change. Clin. Microbiol. Rev. 2017, 30, 115–190. [Google Scholar] [CrossRef] [Green Version]
- Clark, N.J.; Soares Magalhaes, R.J. Airborne geographical dispersal of Q fever from livestock holdings to human communities: A systematic review and critical appraisal of evidence. BMC Infect. Dis. 2018, 18, 218. [Google Scholar] [CrossRef] [Green Version]
- Morroy, G.; Peters, J.B.; van Nieuwenhof, M.; Bor, H.H.; Hautvast, J.L.; van der Hoek, W.; Wijkmans, C.J.; Vercoulen, J.H. The health status of Q-fever patients after long-term follow-up. BMC Infect. Dis. 2011, 11, 97. [Google Scholar] [CrossRef] [Green Version]
- Langley, J.M.; Marrie, T.J.; Leblanc, J.C.; Almudevar, A.; Resch, L.; Raoult, D. Coxiella burnetii seropositivity in parturient women is associated with adverse pregnancy outcomes. Am. J. Obstet. Gynecol. 2003, 189, 228–232. [Google Scholar] [CrossRef]
- Schneeberger, P.M.; Wintenberger, C.; van der Hoek, W.; Stahl, J.P. Q fever in the Netherlands—2007–2010: What we learned from the largest outbreak ever. Med. Mal. Infect. 2014, 44, 339–353. [Google Scholar] [CrossRef]
- Marshall, K.; Gibson, J.P.; Mwai, O.; Mwacharo, J.M.; Haile, A.; Getachew, T.; Mrode, R.; Kemp, S.J. Livestock Genomics for Developing Countries—African Examples in Practice. Front. Genet. 2019, 10, 297. [Google Scholar] [CrossRef] [Green Version]
- van Asseldonk, M.A.; Prins, J.; Bergevoet, R.H. Economic assessment of Q fever in the Netherlands. Prev. Vet. Med. 2013, 112, 27–34. [Google Scholar] [CrossRef]
- Foresight. The Future of Food and Farming; Final project report; The Government Office for Science: London, UK, 2011; p. 53. Available online: http://www.bis.gov.uk/assets/bispartners/foresight/docs/food-and-farming/11-546-future-of-food-and-farming-report.pdf (accessed on 25 January 2023).
- Hendrix, L.R.; Samuel, J.E.; Mallavia, L.P. Differentiation of Coxiella burnetii isolates by analysis of restriction-endonuclease-digested DNA separated by SDS-PAGE. Microbiology 1991, 137, 269–276. [Google Scholar] [CrossRef] [Green Version]
- Hemsley, C.M.; O’Neill, P.A.; Essex-Lopresti, A.; Norville, I.H.; Atkins, T.P.; Titball, R.W. Extensive genome analysis of Coxiella burnetii reveals limited evolution within genomic groups. BMC Genom. 2019, 20, 441. [Google Scholar] [CrossRef] [Green Version]
- Hackstadt, T.; Peacock, M.G.; Hitchcock, P.J.; Cole, R.L. Lipopolysaccharide variation in Coxiella burnetti: Intrastrain heterogeneity in structure and antigenicity. Infect. Immun. 1985, 48, 359–365. [Google Scholar] [CrossRef] [Green Version]
- Moos, A.; Hackstadt, T. Comparative virulence of intra- and interstrain lipopolysaccharide variants of Coxiella burnetii in the guinea pig model. Infect. Immun. 1987, 55, 1144–1150. [Google Scholar] [CrossRef] [Green Version]
- Amano, K.; Williams, J.C.; Missler, S.R.; Reinhold, V.N. Structure and biological relationships of Coxiella burnetii lipopolysaccharides. J. Biol. Chem. 1987, 262, 4740–4747. [Google Scholar] [CrossRef]
- Vodkin, M.H.; Williams, J.C. Overlapping deletion in two spontaneous phase variants of Coxiella burnetii. Microbiology 1986, 132, 2587–2594. [Google Scholar] [CrossRef] [Green Version]
- Hoover, T.A.; Culp, D.W.; Vodkin, M.H.; Williams, J.C.; Thompson, H.A. Chromosomal DNA deletions explain phenotypic characteristics of two antigenic variants, phase II and RSA 514 (crazy), of the Coxiella burnetii nine mile strain. Infect. Immun. 2002, 70, 6726–6733. [Google Scholar] [CrossRef] [Green Version]
- Beare, P.A.; Jeffrey, B.M.; Long, C.M.; Martens, C.M.; Heinzen, R.A. Genetic mechanisms of Coxiella burnetii lipopolysaccharide phase variation. PLoS Pathog. 2018, 14, e1006922. [Google Scholar] [CrossRef] [Green Version]
- Reeves, P.M.; Paul, S.R.; Sluder, A.E.; Brauns, T.A.; Poznansky, M.C. Q-vaxcelerate: A distributed development approach for a new Coxiella burnetii vaccine. Hum. Vaccines Immunother. 2017, 13, 2977–2981. [Google Scholar] [CrossRef] [Green Version]
- European Medicines Agency. Coxevac, Inactivated Coxiella burnetii Vaccine. Available online: https://www.ema.europa.eu/en/medicines/veterinary/EPAR/coxevac (accessed on 25 January 2023).
- Schulze, L.S.; Borchardt, S.; Ouellet, V.; Heuwieser, W. Effect of a phase I Coxiella burnetii inactivated vaccine on body temperature and milk yield in dairy cows. J. Dairy Sci. 2016, 99, 541–550. [Google Scholar] [CrossRef] [Green Version]
- Hogerwerf, L.; van den Brom, R.; Roest, H.I.; Bouma, A.; Vellema, P.; Pieterse, M.; Dercksen, D.; Nielen, M. Reduction of Coxiella burnetii prevalence by vaccination of goats and sheep, The Netherlands. Emerg. Infect. Dis. 2011, 17, 379–386. [Google Scholar] [CrossRef]
- Arricau-Bouvery, N.; Souriau, A.; Bodier, C.; Dufour, P.; Rousset, E.; Rodolakis, A. Effect of vaccination with phase I and phase II Coxiella burnetii vaccines in pregnant goats. Vaccine 2005, 23, 4392–4402. [Google Scholar] [CrossRef]
- Ormsbee, R.A.; Bell, E.J.; Lackman, D.B.; Tallent, G. The Influence of Phase on the Protective Potency of Q Fever Vaccine. J. Immunol. 1964, 92, 404–412. [Google Scholar] [CrossRef]
- Brooks, D.L.; Ermel, R.W.; Franti, C.E.; Ruppanner, R.; Behymer, D.E.; Williams, J.C.; Stephenson, E.H. Q fever vaccination of sheep: Challenge of immunity in ewes. Am. J. Vet. Res. 1986, 47, 1235–1238. [Google Scholar]
- Roest, H.I.; Post, J.; van Gelderen, B.; van Zijderveld, F.G.; Rebel, J.M. Q fever in pregnant goats: Humoral and cellular immune responses. Vet. Res. 2013, 44, 67. [Google Scholar] [CrossRef] [Green Version]
- Davies, G.E.; Cox, H.R. Public Health Weekly Reports for DECEMBER 30, 1938. Public Health Rep. 1938, 53, 2259–2309. [Google Scholar]
- Roest, H.I.; Ruuls, R.C.; Tilburg, J.J.; Nabuurs-Franssen, M.H.; Klaassen, C.H.; Vellema, P.; van den Brom, R.; Dercksen, D.; Wouda, W.; Spierenburg, M.A.; et al. Molecular epidemiology of Coxiella burnetii from ruminants in Q fever outbreak, the Netherlands. Emerg. Infect. Dis. 2011, 17, 668–675. [Google Scholar] [CrossRef]
- Klee, S.R.; Tyczka, J.; Ellerbrok, H.; Franz, T.; Linke, S.; Baljer, G.; Appel, B. Highly sensitive real-time PCR for specific detection and quantification of Coxiella burnetii. BMC Microbiol. 2006, 6, 2. [Google Scholar] [CrossRef] [Green Version]
- Livingstone, M.; Wheelhouse, N.; Maley, S.W.; Longbottom, D. Molecular detection of Chlamydophila abortus in post-abortion sheep at oestrus and subsequent lambing. Vet. Microbiol. 2009, 135, 134–141. [Google Scholar] [CrossRef]
- Opsteegh, M.; Langelaar, M.; Sprong, H.; den Hartog, L.; De Craeye, S.; Bokken, G.; Ajzenberg, D.; Kijlstra, A.; van der Giessen, J. Direct detection and genotyping of Toxoplasma gondii in meat samples using magnetic capture and PCR. Int. J. Food Microbiol. 2010, 139, 193–201. [Google Scholar] [CrossRef]
- Wilson, K.; Livingstone, M.; Longbottom, D. Comparative evaluation of eight serological assays for diagnosing Chlamydophila abortus infection in sheep. Vet. Microbiol. 2009, 135, 38–45. [Google Scholar] [CrossRef]
- Benjamini, Y.; Hochberg, Y. Controlling the False Discovery Rate: A Practical and Powerful Approach to Multiple Testing. J. R. Stat. Soc. Ser. B (Methodol.) 1995, 57, 289–300. [Google Scholar] [CrossRef]
- Firth, D. Bias Reduction of Maximum Likelihood Estimates. Biometrika 1993, 80, 27–38. [Google Scholar] [CrossRef]
- R Core Development Team. A Language and Environment for Statistical Computing; R Foundation for Statistical Computing: Vienna, Austria, 2019. [Google Scholar]
- COXEVAC® Suspension for Injection for Cattle and Goats. Available online: https://www.noahcompendium.co.uk/?id=-474060&template=template_printview (accessed on 25 January 2023).
- Segal, L.; Roger, V.; Williams, C.; Destexhe, E.; Garcon, N. Effects of Adjuvant Systems on the cardiovascular and respiratory functions in telemetered conscious dogs and anaesthetised rats. Regul. Toxicol. Pharmacol. 2015, 73, 116–125. [Google Scholar] [CrossRef]
- Rousset, E.; Durand, B.; Champion, J.L.; Prigent, M.; Dufour, P.; Forfait, C.; Marois, M.; Gasnier, T.; Duquesne, V.; Thiery, R.; et al. Efficiency of a phase 1 vaccine for the reduction of vaginal Coxiella burnetii shedding in a clinically affected goat herd. Clin. Microbiol. Infect. 2009, 15 (Suppl. S2), 188–189. [Google Scholar] [CrossRef]
- Vaxquery. Chlamyvax FQ. Available online: https://violinet.org/vaxquery/vaccine_detail.php?c_vaccine_id=244&keywords=chlamy (accessed on 30 June 2020).
- Sun, H.X.; Xie, Y.; Ye, Y.P. ISCOMs and ISCOMATRIX. Vaccine 2009, 27, 4388–4401. [Google Scholar] [CrossRef]
- Zhang, G.; Russell-Lodrigue, K.E.; Andoh, M.; Zhang, Y.; Hendrix, L.R.; Samuel, J.E. Mechanisms of vaccine-induced protective immunity against Coxiella burnetii infection in BALB/c mice. J. Immunol. 2007, 179, 8372–8380. [Google Scholar] [CrossRef] [Green Version]
- Hackstadt, T. Antigenic variation in the phase I lipopolysaccharide of Coxiella burnetii isolates. Infect. Immun. 1986, 52, 337–340. [Google Scholar] [CrossRef] [Green Version]
- Ftacek, P.; Skultety, L.; Toman, R. Phase variation of Coxiella burnetii strain Priscilla: Influence of this phenomenon on biochemical features of its lipopolysaccharide. J. Endotoxin Res. 2000, 6, 369–376. [Google Scholar] [CrossRef] [Green Version]
- Watson, R.L.; McNeilly, T.N.; Watt, K.A.; Pemberton, J.M.; Pilkington, J.G.; Waterfall, M.; Hopper, P.R.; Cooney, D.; Zamoyska, R.; Nussey, D.H. Cellular and humoral immunity in a wild mammal: Variation with age & sex and association with overwinter survival. Ecol. Evol. 2016, 6, 8695–8705. [Google Scholar] [CrossRef]
- Hernandez-Castellano, L.E.; Moreno-Indias, I.; Sanchez-Macias, D.; Morales-delaNuez, A.; Torres, A.; Arguello, A.; Castro, N. Sheep and goats raised in mixed flocks have diverse immune status around parturition. J. Dairy Sci. 2019, 102, 8478–8485. [Google Scholar] [CrossRef]
- Palmer, N.C.; Kierstead, M.; Key, D.W.; Williams, J.C.; Peacock, M.G.; Vellend, H. Placentitis and Abortion in Goats and Sheep in Ontario Caused by Coxiella burnetii. Can. Vet. J. 1983, 24, 60–61. [Google Scholar]
- Hazlett, M.J.; McDowall, R.; DeLay, J.; Stalker, M.; McEwen, B.; van Dreumel, T.; Spinato, M.; Binnington, B.; Slavic, D.; Carman, S.; et al. A prospective study of sheep and goat abortion using real-time polymerase chain reaction and cut point estimation shows Coxiella burnetii and Chlamydophila abortus infection concurrently with other major pathogens. J. Vet. Diagn. Investig. 2013, 25, 359–368. [Google Scholar] [CrossRef] [Green Version]
- Roest, H.J.; van Gelderen, B.; Dinkla, A.; Frangoulidis, D.; van Zijderveld, F.; Rebel, J.; van Keulen, L. Q fever in pregnant goats: Pathogenesis and excretion of Coxiella burnetii. PLoS ONE 2012, 7, e48949. [Google Scholar] [CrossRef] [Green Version]
- Porten, K.; Rissland, J.; Tigges, A.; Broll, S.; Hopp, W.; Lunemann, M.; van Treeck, U.; Kimmig, P.; Brockmann, S.O.; Wagner-Wiening, C.; et al. A super-spreading ewe infects hundreds with Q fever at a farmers’ market in Germany. BMC Infect. Dis. 2006, 6, 147. [Google Scholar] [CrossRef] [Green Version]
- Gilsdorf, A.; Kroh, C.; Grimm, S.; Jensen, E.; Wagner-Wiening, C.; Alpers, K. Large Q fever outbreak due to sheep farming near residential areas, Germany, 2005. Epidemiol. Infect. 2008, 136, 1084–1087. [Google Scholar] [CrossRef]
- Berri, M.; Souriau, A.; Crosby, M.; Crochet, D.; Lechopier, P.; Rodolakis, A. Relationships between the shedding of Coxiella burnetii, clinical signs and serological responses of 34 sheep. Vet. Rec. 2001, 148, 502–505. [Google Scholar] [CrossRef]
- Joulie, A.; Rousset, E.; Gasqui, P.; Lepetitcolin, E.; Leblond, A.; Sidi-Boumedine, K.; Jourdain, E. Coxiella burnetii Circulation in a Naturally Infected Flock of Sheep: Individual Follow-Up of Antibodies in Serum and Milk. Appl. Environ. Microbiol. 2017, 83, e00222-17. [Google Scholar] [CrossRef] [Green Version]
Pathogen | Primer/Probe | Nucleotide Sequence 5′-3′ | Concentration (nM) | Ref |
---|---|---|---|---|
C. burnetii | IS1111-F | catgacattgccgcgtttac | 400 | |
IS1111-R | ggttggtccctcgacaacat | 400 | [36] | |
IS1111-probe | FAM-aatccccaacaacacctccttattcccac-BHQ-1 | 200 | ||
C. abortus | MOMP-F | gcggcattcaacctcgtt | 300 | |
MOMP-R | ccttgagtgatgcctacattgg | 300 | [38] | |
MOMP-probe | FAM-tgttaaaggatcctccatagcagctgatcag-TAMRA | 250 | ||
T. gondii | TOX-F | aggagagatatcaggactgtag | 700 | |
TOX-R | gcgtcgtctcgtctagatcg | 700 | ||
TOX-probe | FAM-ccggcttggctgcttttcct-BHQ-1 | 250 | [39] | |
CIAC-probe | JOE-agcgtaccaacaagtaattctgtatcgatg-BHQ-1 | 200 |
Milk Samples | |||||||||
---|---|---|---|---|---|---|---|---|---|
Vaccine Group | Ewe No. | Days Post Lambing | Weekly Sample Points | PM | |||||
0 | 1 | 2 | 3 | WK 1 | WK 2 | WK 3 | |||
Group 1: Coxevac® vaccinated | 9329 | - | - | - | - | - | - | - | - |
9360 | - | - | - | - | - | - | - | - | |
9914 | - | - | - | - | - | - | - | - | |
21996 | - | - | - | - | - | - | - | - | |
22155 | - | - | - | - | - | - | - | - | |
Group 2: Phase II vaccinated | 9315 | - | - | - | - * | - | - | - | |
9612 | - | - | - | - | - | - | - | - | |
9888 | - | - | - | - | - | - | - | - | |
9902 | - | - | - | - | - | - | - | - | |
23161 | - | - | - | - | - | - | - | - | |
Group 3: Unvaccinated controls | 9668 | - | + | + | - | + | + | + | + |
21898 | - | + | + | + | + | + | + | - | |
22164 | - | - | - | + | + | - | + | + | |
23501 | + | + | + | + | + | + | + | + | |
23538 | - | - | + | - | - | - | + | + | |
22357 | - | - | - | + | + | + | + | + |
Vaginal Swab Samples | |||||||||
---|---|---|---|---|---|---|---|---|---|
Vaccine Group | Ewe No. | Days Post Lambing | Weekly Sample Points | PM | |||||
0 | 1 | 2 | 3 | WK 1 | WK 2 | WK 3 | |||
Group 1: Coxevac® vaccinated | 9329 | - | - | - | + | - | - | - | - |
9360 | - | - | - | - | - | - | - | - | |
9914 | - | + | - | - | - | - | - | - | |
21996 | - | - | - | - | - | - | - | - | |
22155 | - | - | - | - | - | - | - | - | |
Group 2: Phase II vaccinated | 9315 | - | - | - | - * | - | - | - | |
9612 | - | - | - | - | - | - | - | - | |
9888 | - | - | - | - | - | - | - | - | |
9902 | - | - | - | - | - | - | - | - | |
23161 | - | - | - | - | - | - | - | - | |
Group 3: Unvaccinated controls | 9668 | - | + | + | + | - | + | + | + |
21898 | - | - | + | + | - | - | + | + | |
22164 | - | - | + | - | - | - | + | + | |
23501 | + | + | + | + | + | + | + | + | |
23538 | - | - | - | + | + | + | - | + | |
22357 | - | - | + | - | + | + | + | + |
Faecal Samples | |||||||||
---|---|---|---|---|---|---|---|---|---|
Vaccine Group | Ewe No. | Days Post-Lambing | Weekly Sample Points | PM | |||||
0 | 1 | 2 | 3 | WK 1 | WK 2 | WK 3 | |||
Group 1: Coxevac® vaccinated | 9329 | - | - | - | - | - | - | - | - |
9360 | - | - | - | - | - | - | - | - | |
9914 | - | - | - | - | - | - | - | - | |
21996 | - | - | NA | - | - | - | - | - | |
22155 | - | - | - | - | - | - | - | - | |
Group 2: Phase II vaccinated | 9315 | - | - | - | -* | - | - | - | |
9612 | NA | - | - | - | - | - | - | - | |
9888 | - | - | - | NA | - | - | - | - | |
9902 | NA | - | - | - | - | - | - | - | |
23161 | - | - | - | - | - | - | - | - | |
Group 3: Unvaccinated controls | 9668 | - | - | - | NA | - | + | + | - |
21898 | - | NA | - | + | - | + | + | - | |
22164 | - | - | - | NA | - | - | + | - | |
23501 | + | + | + | + | + | + | - | - | |
23538 | - | - | - | - | - | + | - | - | |
22357 | - | - | - | - | + | - | - | - |
Group | Ewe No. | Parity | Healthy Lambs | Stillborn | Neonatal Death | Aborted | Weak Lambs |
---|---|---|---|---|---|---|---|
1: Coxevac® vaccinated | 9329 | Twins | 2 | 0 | 0 | 0 | 0 |
9360 | Twins | 2 | 0 | 0 | 0 | 0 | |
9914 a | Triplets | 2 | 0 | 1@24hrs | 0 | 0 | |
21996 | Twins | 2 | 0 | 0 | 0 | 0 | |
22155 | Twins | 2 | 0 | 0 | 0 | 0 | |
9880 | Triplets | 0 | 0 | 0 | 3 b | 0 | |
2: Phase II vaccinated | 9315 | Twins | 2 | 0 | 0 | 0 | 0 |
9612 | Twins | 2 | 0 | 0 | 0 | 0 | |
9888 | Twins | 2 | 0 | 0 | 0 | 0 | |
9902 | Twins | 2 | 0 | 0 | 0 | 0 | |
23647 | Twins c | 0 | 0 | 0 | 0 | 0 | |
23161 | Triplets | 3 | 0 | 0 | 0 | 0 | |
3: Unvaccinated controls | 9668 | Twins | 1 | 0 | 0 | 0 | 1 |
21898 | Twins | 1 | 1 | 0 | 0 | 0 | |
22164 | Twins | 1 | 0 | 1@72hrs | 0 | 0 | |
23501 | Twins | 2 | 0 | 0 | 0 | 0 | |
23538 | Twins | 1 | 1 | 0 | 0 | 0 | |
22357 | Triplets | 2 | 0 | 0 | 0 | 1E@24hrs |
Group | Survived | Died | Total |
---|---|---|---|
1: Coxevac® vaccinated | 10 | 1 | 11 |
2: Phase II vaccinated | 11 | 0 | 11 |
3: Unvaccinated controls | 8 | 4 | 12 |
Group | Normal a | Abnormal b | Total |
---|---|---|---|
1: Coxevac® vaccinated | 4 | 1 | 5 |
2: Phase II vaccinated | 5 | 0 | 5 |
3: Unvaccinated controls | 1 | 5 | 6 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Williams-Macdonald, S.E.; Mitchell, M.; Frew, D.; Palarea-Albaladejo, J.; Ewing, D.; Golde, W.T.; Longbottom, D.; Nisbet, A.J.; Livingstone, M.; Hamilton, C.M.; et al. Efficacy of Phase I and Phase II Coxiella burnetii Bacterin Vaccines in a Pregnant Ewe Challenge Model. Vaccines 2023, 11, 511. https://doi.org/10.3390/vaccines11030511
Williams-Macdonald SE, Mitchell M, Frew D, Palarea-Albaladejo J, Ewing D, Golde WT, Longbottom D, Nisbet AJ, Livingstone M, Hamilton CM, et al. Efficacy of Phase I and Phase II Coxiella burnetii Bacterin Vaccines in a Pregnant Ewe Challenge Model. Vaccines. 2023; 11(3):511. https://doi.org/10.3390/vaccines11030511
Chicago/Turabian StyleWilliams-Macdonald, Sarah E., Mairi Mitchell, David Frew, Javier Palarea-Albaladejo, David Ewing, William T. Golde, David Longbottom, Alasdair J. Nisbet, Morag Livingstone, Clare M. Hamilton, and et al. 2023. "Efficacy of Phase I and Phase II Coxiella burnetii Bacterin Vaccines in a Pregnant Ewe Challenge Model" Vaccines 11, no. 3: 511. https://doi.org/10.3390/vaccines11030511
APA StyleWilliams-Macdonald, S. E., Mitchell, M., Frew, D., Palarea-Albaladejo, J., Ewing, D., Golde, W. T., Longbottom, D., Nisbet, A. J., Livingstone, M., Hamilton, C. M., Fitzgerald, S. F., Buus, S., Bach, E., Dinkla, A., Roest, H.-J., Koets, A. P., & McNeilly, T. N. (2023). Efficacy of Phase I and Phase II Coxiella burnetii Bacterin Vaccines in a Pregnant Ewe Challenge Model. Vaccines, 11(3), 511. https://doi.org/10.3390/vaccines11030511