Next Article in Journal
Polychlorinated Biphenyls, Oxidative Stress, and Brain Health: Mechanistic Links to Neurodegenerative and Neurodevelopmental Diseases
Next Article in Special Issue
The Role of Se-Containing Glutathione Peroxidases and Thioredoxin Reductases in Oncogenesis: Expression Paradoxes and Therapeutic Prospects
Previous Article in Journal
Proteomic Identification of PFKFB3 and PFKFB4 Associated with Coenzyme Metabolism and Redox Imbalance in Dairy Cows with Clinical Mastitis
Previous Article in Special Issue
Plasma, Urinary, and Salivary Total Redox Status in Critically Ill Patients with Brain Injury and Secondary Organ Failure
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Antioxidants
Volume 15
Issue 2
10.3390/antiox15020241
antioxidants-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Loss of ABCC6 in Human Mesenchymal Stem Cells Leads to Elevated Reactive Oxygen Species Formation and a Senescence-like Phenotype

by
Michel R. Osterhage
1,2,
Cornelius Knabbe
1,2 and
Doris Hendig
1,2,*
1
Herz- und Diabeteszentrum Nordrhein-Westfalen, Institut für Laboratoriums- und Transfusionsmedizin, Universitätsklinik der Ruhr-Universität Bochum, 32545 Bad Oeynhausen, Germany
2
Herz- und Diabeteszentrum Nordrhein-Westfalen, Medizinische Fakultät OWL (Universität Bielefeld), 32545 Bad Oeynhausen, Germany
*
Author to whom correspondence should be addressed.
Antioxidants 2026, 15(2), 241; https://doi.org/10.3390/antiox15020241
Submission received: 12 January 2026 / Revised: 29 January 2026 / Accepted: 5 February 2026 / Published: 12 February 2026
(This article belongs to the Special Issue Oxidative Stress in Human Diseases—4th Edition)
Browse Figures
Versions Notes

Abstract

Pseudoxanthoma elasticum (PXE) is an autosomal-recessive disorder caused by mutations in ATP-binding cassette subfamily C member 6 (ABCC6). In addition to the calcification and fragmentation of elastic fibers as the pathomechanistic cause of PXE, systemic and cellular oxidative stress have been reported. Human mesenchymal stem cells (hMSCs) with an ABCC6 knockdown were chosen to further investigate the oxidative stress associated with ABCC6 deficiency. The cells were treated with hydrogen peroxide to mimic external oxidative stress and the antioxidant Trolox to examine the cells’ reaction to decreased oxidative stress. The level of different types of reactive species (RS) like nitric oxide and reactive oxygen species, the senescent phenotype, oxidative damage and mRNA expression of oxidative stress-related genes were evaluated. Knockdown of ABCC6 was shown to increase RS levels in hMSCs, induce a p53-dependent senescence-like phenotype and increase oxidative damage, while the mRNA expression of oxidative defense genes was elevated. The ABCC6-deficient cells exhibited an altered reaction to additional oxidative stress and the incubation with Trolox reversed these changes induced by ABCC6 knockdown. Our findings provide further evidence linking ABCC6-deficiency to oxidative stress and a senescence-like phenotype, while pointing towards antioxidants as part of a potential treatment for PXE.

1. Introduction

The fragmentation and calcification of elastic fibers in connective tissues are hallmarks of the autosomal-recessive disorder pseudoxanthoma elasticum (PXE, OMIM 264800). The symptoms of PXE comprise extensive wrinkle formation of the skin, neovascularization and bleeding of the eye’s Bruch’s membrane and calcification of small and medium-sized arteries. The clinical consequences include impairment or loss of central vision, hypertension and intermittent claudication [1].
The genetic cause of PXE is mutations in the gene encoding the transmembrane protein ATP-binding cassette subfamily C member 6 (ABCC6, NG_007558.3) [2]. This ATP-dependent transporter is mainly localized in the liver and the kidneys and only to a small extent in the clinically involved tissues in PXE [3,4]. The substrate of ABCC6 remains unknown, leading to the emergence of two hypotheses on the pathobiology of PXE [5]. The metabolic hypothesis assumes that mutations in ABCC6 result in a lack of transport of the substrate from hepatocytes into the bloodstream leading to ectopic calcification. The cellular hypothesis claims that the loss of functional ABCC6 protein in peripheral cells alters their metabolism and, thus, promotes the calcification of elastic fibers in their proximity [6].
Excessive oxidative stress has been reported in the context of PXE, on both a cellular and systemic level. An increased mitochondrial membrane potential, elevated levels of mitochondrial superoxide and differential mitochondrial protein expression were detected in fibroblasts from PXE patients in comparison to those of healthy donors [7]. Pasquali-Ronchetti et al. were able to detect elevated levels of intracellular superoxide and an increase in hydrogen peroxide production. Furthermore, a decrease in antioxidative capacity and elevated levels of lipid peroxidation, a consequence of oxidative stress, were detected [8]. Garcia-Fernandez et al. detected a lower antioxidative capacity and higher levels of oxidative stress parameters in the circulation of PXE patients [9].
One mechanism of multicellular organisms to prevent the accumulation of DNA damage is called senescence, divided into replicative and acute senescence. Replicative senescence is typically induced by a shortening of the telomers of chromosomes during cell division, activating the DNA damage response and, thus, senescence [10]. Acute senescence is typically induced by stressors such as oxidative stress, oncogenes or ultraviolet radiation, ultimately leading to DNA damage as well [11]. The DNA damage in both types of senescence leads to the stabilization of one or more of the cyclin-dependent kinase inhibitors p53/p21 and p16 [12]. Consequently, cell cycle progression is terminated and further senescence characteristics are acquired. One of the latter is an elevated production of reactive species (RS), such as hydrogen peroxide (H2O2), superoxide (·O2−) and nitric oxide (NO), that are needed for the maintenance of senescence [13,14]. But RS can also be beneficial for the cell, since they exhibit signaling functions, [15,16,17]. As a result, the balance between the formation and degradation of RS is required for normal cellular function. Endogenous antioxidants, such as superoxide dismutase, catalase (CAT), and glutathione, synthesized by the glutathione synthetase (GSS) and glutathione peroxidases (GPX) or exogenous antioxidants, such as vitamin E and C or carotenoids, can be used to counteract excessive RS formation [18]. Sirtuins are a family of histone deacetylases that consist of seven members (SIRT1–7) with different functions in processes associated with oxidative stress defense [19,20]. The activation of SIRT1, for example, leads to reduced lipid peroxidation, measured by the peroxidation product 4-hydroxynonenal (4-HNE) [19]. Tumor necrosis factor receptor associated protein 1 (TRAP1) is a mitochondria-localized member of the heat shock protein family and known to decrease the production of RS [21].
Another important hallmark of senescence is the senescence-associated secretory phenotype, which is characterized by the increased expression and secretion of cytokines, such as interleukin (IL) 1β, IL-6 and IL-8 [22]. Furthermore, most senescent cells exhibit an increased activity of the senescence-associated β-galactosidase, which can act as a marker of the senescent state of the cells [23].
Recent studies in Abcc6 knockout mice have emphasized a possible role of the bone marrow in PXE pathogenesis [24]. Therefore, bone marrow-derived mesenchymal stem cells were chosen for this investigation. Furthermore, impaired lipid trafficking in adipocytes generated from ABCC6-deficient mesenchymal stem cells was detected [25]. The influence of ABCC6 knockdown on RS levels, senescence and oxidative damage and defense were investigated in this study. Incubation with H2O2 was chosen to induce acute senescence and mimic systemic oxidative stress, while the antioxidant Trolox was used to diminish RS levels and oxidative stress.

2. Materials and Methods

2.1. Cell Culture and Treatment

Human bone marrow-derived mesenchymal stem cells (hMSCs, see Table 1) were purchased from PromoCell (Heidelberg, Germany) and cultivated in a mesenchymal stem cell growth medium kit (MSCGM, Lonza, Basel, Switzerland) according to the manufacturer’s instructions. The cells were sub-cultured upon reaching approximately 90% confluence. Cells in passage 10 were used for experiments.
The hMSCs were seeded at a density of 4000 cells/cm2 in MSCGM for the induction of acute senescence and implementation of additional oxidative stress. The cells were treated 24 h later with 2 mM Trolox (1 mM Na2CO3, Merck, Darmstadt, Germany) with or without 1 mM H2O2 (Roth, Karlsruhe, Germany) or with 1 mM Na2CO3 (vehicle) in MSCGM with delipidated FCS (dFCS). After incubation with H2O2, cells were washed with 1× DPBS, given fresh dFCS MSCGM with or without Trolox and cultivated for an additional 72 h. Trolox concentration was selected by testing different concentrations using a WST1-cell proliferation assay. Control cells were cultivated in dFCS MSCGM without H2O2 following the same schedule.

2.2. Delipidation of FCS

The delipidation of FCS was performed by the incubation of 50 mL FCS (MCGS, Lonza, Basel, Switzerland) with 1 g of Cab-o-sil (Sigma-Aldrich, St. Louis, MO, USA) overnight at 4 °C. The mixture was then centrifugated at 4 °C and 10,000× g for 1 h and the delipidated FCS from the supernatant was sterile filtered using a 0.22 µm filter.

2.3. ABCC6 Knockdown via CRISPR/Cas9

The transfection of a ribonucleoprotein complex for CRISPR/Cas9-mediated ABCC6 knockdown was performed in accordance with Plümers et al. and the transfection protocol from IDT (Coralville, IA, USA) [25].

2.4. Nucleic Acid Isolation

The isolation of genomic DNA was performed using the NucleoSpin Blood Kit (Macherey-Nagel, Düren, Germany), following the manufacturer’s instructions. RNA was isolated using the NucleoSpin RNA Kit (Macherey-Nagel, Düren, Germany), according to the manufacturer’s instructions. The concentration of DNA and RNA was measured using the NanoDrop2000 spectrophotometer (Peqlab, Erlangen, Germany).

2.5. Assessment of Reactive Oxygen and Nitrogen Species

The levels of reactive oxygen and nitrogen species were measured using different fluorescent probes. The hMSCs were seeded and treated according to Section 2.1. After 72 h of incubation, the cells were stained with different concentrations of the fluorescent probes for different time periods (see Table 2). Cells were stained using the Viobility™ 640/770 Fixable Dye (Miltenyi Biotec, Bergisch Gladbach, Germany) 15 min before the RS staining was completed. The cells were washed with 1× DPBS and detached using 1× Trypsin (PAN Biotech, Aidenbach, Germany). After centrifugation for 5 min at 310× g, the cells were resuspended in 1× DPBS and the fluorescence was measured using the BD FACSCanto™ II Flow Cytometer (BD Biosciences, Franklin Lakes, NJ, USA). The fluorescence measurement was performed using biological triplicates and background fluorescence was subtracted using unstained hMSCs. Recorded events were gated for intact cells, singlets and viable cells using the Kaluza Software (Kaluza Analysis 2.3., Beckman Coulter, Brea, CA, USA) and the mean intensity of the events recorded was determined.

2.6. Immunofluorescence Staining and Fluorescence Microscopy

After the cell treatment, cells were seeded on 8-well µ-slides (ibidi, Gräfelfing, Germany) at a density of 4000 cells/cm2 and cultivated for an additional 24 h. The medium was removed, and the cells were washed with 1× DPBS and fixated using 4% paraformaldehyde (Roth, Karlsruhe, Germany) for 15 min. Permeabilization was performed using 0.1% Triton-X-100 (Roth, Karlsruhe, Germany) in 1× DPBS for 10 min and unspecific binding sites were blocked using 5% normal goat serum (Cell Signaling Technology, Cambridge, United Kingdom) in 1× DPBS for 1 h. Primary antibodies were diluted in 5% normal goat serum according to Table 3 and incubated on the cells for 2 h.
Species-specific fluorescence-conjugated secondary antibodies were diluted in 5% normal goat serum and incubated with the cells for 1 h before staining the nuclei using 5 µg/mL Hoechst (Abcam, Cambridge, MA, USA). Cells were mounted with ROTI®Mount FluorCare mounting media (Roth, Karlsruhe, Germany) and images were captured using the BZ-X810 microscope (Keyence, Osaka, Japan). The image processing and determination of fluorescence intensity was performed using ImageJ 1.52a (National Institutes of Health, Bethesda, MD, USA). For quantification of fluorescence intensity, images were converted to greyscale and identical acquisition settings were used for all compared conditions. Regions of interest were defined manually and mean fluorescence intensity was measured.

2.7. β-Galactosidase Assay

The β-galactosidase activity was measured using a fluorescence-based assay [26]. The hMSCs were treated as described in 4.1 and incubated for 72 h. Lysis of the cells was performed using 300 µL lysis buffer (pH 6.0, see Table 4) and the lysate was frozen at −80 °C until the assay was performed. The lysate was centrifuged at 12,000× g and 4 °C for 5 min. An amount of 100 µL of the supernatant was mixed with 100 µL of 2× reaction buffer (see Table 5) and incubated for 1 h at 37 °C.
The reaction was stopped using 600 µL of a 400 mM sodium carbonate solution and the fluorescence was measured on the Tecan Reader Infinite 200 Pro (Tecan, Männedorf, Switzerland). The fluorescence intensity detected was normalized to the protein concentration determined using a bicichonic acid assay (Merck, Darmstadt, Germany).

2.8. Gene Expression Analysis

An amount of 1 µg of isolated RNA was transcribed to complementary DNA using the GoScript™ Reverse Transcriptase Kit (Promega, Madison, WI, USA) following the manufacturer’s instructions. Quantitative real-time polymerase chain reaction (qRT-PCR) was performed using 5 µL LightCycler 480 SYBR Green I Master reaction mixture (Roche, Basel, Switzerland), 0.25 µL each of 25 µM forward and reverse primers (Biomers, Ulm, Germany), 2 µL water and 2.5 µL 1:10 diluted complementary DNA in a 384-well plate (Sarstedt, Nümbrecht, Germany). The PCR reaction consisted of an initial denaturation at 95 °C for 5 min, followed by 45 cycles of amplification including denaturation at 95 °C for 10 s, annealing at a primer-specific temperature (Table 6) for 15 s and elongation at 72 °C for 20 s.
The Ct values detected of genes of interest were normalized to the mean of expression of the three housekeeping genes ribosomal protein L13a (RPL13A), succinate dehydrogenase complex flavoprotein subunit A (SDHA) and beta-2-microglobulin (β2M) using the efficiency-corrected delta-delta Ct method.

2.9. Statistical Analysis

Statistical analysis was performed using the GraphPad Prism 10 software (GraphPad, San Diego, CA, USA). All experiments were performed in biological and technical triplicates. The data shown are presented as mean values ± standard error of mean and statistical significance was calculated using three-way ANOVA and Tukey’s multiple comparisons test with probability (p) values equal or below 0.05 being considered statistically significant.

3. Results

3.1. Elevated Levels of Reactive Species May Be the Cause of the Senescence-like Phenotype

Based on our previous work, a CRISPR/Cas9-based approach for ABCC6 knockdown was chosen [26]. This gene editing model was chosen to achieve a stable reduction in ABCC6 mRNA expression over several passages. An efficiency of the knockdown of above 70% was determined using the T7 endonuclease I assay, TA-cloning and qRT-PCR (Figures S1–S3).
Evaluation of the effect of ABCC6-knockdown on reactive species levels was performed by detecting different fluorescent probes using flow cytometry (Figure S4).
Total reactive oxygen species (ROS) was detected as 4.3-fold (±0.5) higher in H2O2-treated control cells compared to the untreated cells. The additional incubation with Trolox resulted in a 63% (±10%) decreased ROS level compared to H2O2-treated control cells. The knockdown of ABCC6 led to a 2.9-fold (±0.3) increase in the level of total ROS compared to untreated control cells and the incubation of knockdown cells with Trolox led to an 80% (±4%) reduction in the total ROS level compared to untreated knockdown cells. Hydrogen peroxide elevated the total ROS level 1.8-fold (±0.2) in relation to untreated knockdown cells, while the additional treatment with Trolox led to a 65% (±10%) decrease in the ROS level (Figure 1A).
The incubation of control cells with H2O2 elevated the nitric oxide (NO) level 5.7-fold (±0.6) compared to untreated cells, while the combined treatment of H2O2 and Trolox decreased the NO level to 54% (±2%) in relation to H2O2-treated cells. Due to the knockdown of ABCC6, a 2.8-fold (±0.4) higher DAF-FM fluorescence compared to control cells was detected. The incubation with H2O2 led to a 2.4-fold (±0.2) increase in the fluorescence intensity in knockdown cells compared to untreated knockdown cells and following treatment with H2O2 and Trolox, a 57% (±3%) decrease in the relative fluorescence intensity was detected compared to H2O2-treated knockdown cells. The incubation of control and knockdown cells with Trolox reduced the fluorescence intensity to the level of the internal unstained control, consequently, no measurable results were obtained (Figure 1B).

3.2. ABCC6 Knockdown hMSCs Reveal a Senescence-like Phenotype

A potential senescence-like phenotype in knockdown hMSCs was evaluated by measuring the senescence-associated β-galactosidase activity and the mRNA expression of the cell cycle inhibitors p21 and p53.
The incubation of control cells with H2O2 resulted in a 1.3-fold (±0.1) increase in the relative β-galactosidase activity compared to untreated control cells. The treatment of control cells with Trolox decreased the relative β-galactosidase activity by 30% (±2%) in relation to untreated control cells and the additional treatment of H2O2 incubated cells with Trolox reduced the β-galactosidase activity by 37% (±3%) compared to H2O2-treated cells. Due to the knockdown of ABCC6, a 1.3-fold (±0.1) increase in the β-galactosidase activity compared to control cells was detectable. In contrast to control cells, a treatment with H2O2 resulted in no significantly altered β-galactosidase activity in knockdown cells in comparison to untreated knockdown cells. Treating the knockdown cells with Trolox caused a 40% (±4%) reduction in the relative β-galactosidase activity compared to untreated cells. The combined treatment with H2O2 and Trolox resulted in a 26% (±6%) decreased activity relative to H2O2-treated knockdown cells (Figure 2A).
Due to the incubation of control cells with H2O2, a 104-fold (±25.2) increase in p21 mRNA expression was detected compared to untreated control cells, while the additional treatment with Trolox led to a 95% (±1%) decrease in mRNA expression in relation to H2O2-treated cells. The cultivation of control cells with Trolox alone did not alter the p21 mRNA expression compared to untreated cells. The knockdown of ABCC6 resulted in a 67.2-fold (±21.6) increase in p21 mRNA expression relative to untreated control cells, while none of the treatments tested had a significant effect on the p21 mRNA expression of the knockdown cells (Figure 2B).
After the incubation of control cells with H2O2, the p53 mRNA expression was detected as 30.4-fold (±6.1) increased compared to untreated control cells, whereas the additional treatment with Trolox resulted a 93% (±1%) decrease in the p53 mRNA expression in relation to H2O2-treated cells. The treatment of control cells with Trolox did not lead to any significant changes in the mRNA expression due to the knockdown of ABCC6; a 22.6-fold (±6.2) elevated p53 mRNA expression was measured compared to control cells. None of the treatments performed resulted in an altered p53 mRNA expression of the knockdown cells compared to the untreated knockdown cells (Figure 2C).
The senescent phenotype was further investigated by immunofluorescent staining of the cell cycle inhibitors p21 and p53, to validate the transcriptional data on the protein level. Using the nucleic counterstain, the area of the nucleus was marked and the fluorescence intensity of the stained cell cycle inhibitors was quantified exclusively in that area.
Following the treatment of control cells with H2O2, a 1.1-fold (±0.01) increase in relative fluorescence intensity compared to untreated cells was detected. Additional treatment with Trolox resulted in a 1.2-fold (±0.02) increase compared to the H2O2-treated control cells. Incubation with Trolox resulted in a 1.1-fold (±0.03) elevated fluorescence intensity compared to untreated cells. The knockdown of ABCC6 resulted in a 20% (±2%) reduction in the fluorescence intensity compared to control cells. The H2O2-treated cells exhibited a 1.5-fold (±0.03) increase in fluorescence intensity relative to untreated knockdown cells, while the additional treatment with Trolox resulted in a 1.1-fold (±0.02) elevated fluorescence intensity compared to H2O2-treated cells. Incubation of the knockdown cells with Trolox showed a 1.2-fold (±0.02) elevated relative fluorescence intensity (Figure 3A).
The cultivation of control cells with H2O2 increased the fluorescence intensity of p53 1.5-fold (±0.05) compared to untreated cells, while the additional treatment with Trolox resulted in a 34% (±2%) reduction in the fluorescence intensity compared to H2O2-treated control cells. The incubation of control cells with Trolox did not result in any significant changes in the fluorescence intensity in relation to untreated cells. Following the ABCC6 knockdown, an increase in the fluorescence intensity of 1.7-fold (±0.05) relative to untreated control cells was detected. The treatment of knockdown cells with H2O2 resulted in a 1.3-fold (±0.04) elevation of the p53 fluorescence intensity compared to untreated knockdown cells. The additional incubation with Trolox led to a 22% (±2%) decrease in the fluorescence intensity compared to H2O2-treated knockdown cells. The treatment of knockdown cells with Trolox did not induce any changes in the p53 fluorescence intensity in knockdown cells (Figure 3B).

3.3. Knockdown hMSCs Exhibit Differential Patterns of Oxidative Stress

An assessment of the oxidative damage was performed using immunofluorescence staining of the lipid peroxidation product 4-hydroxynonenal (4-HNE) (Figure 4A).
The incubation of control cells with H2O2 did not reveal any significant changes in the 4-HNE fluorescence intensity compared to the untreated control. The treatment of control cells with Trolox led to a 69% (±8%) decrease in the fluorescence intensity relative to untreated cells, while the incubation of H2O2-treated cells with Trolox resulted in a 66% (±8%) decrease in the fluorescence intensity compared to control cells. Following the knockdown of ABCC6, a 1.7-fold (±0.1) increase in the 4-HNE fluorescence intensity was detected. The treatment of knockdown cells with H2O2 did not alter the fluorescence intensity measured compared to untreated knockdown cells, while the additional incubation with Trolox did not result in any changes either compared to H2O2-treated cells. The treatment of knockdown cells with Trolox led to a 50% (±7%) decrease in the fluorescence intensity detected relative to untreated knockdown cells (Figure 4B).
The influence of the ABCC6 knockdown on the mRNA expression of different genes associated with oxidative stress defense, reactive species (RS) production and RS elimination was investigated using qRT-PCR.
Firstly, the mRNA expression of genes of the sirtuin (SIRT) family was evaluated. Following the H2O2 treatment, the SIRT2 mRNA expression of control cells was 17.9-fold (±2.9) increased compared to untreated control cells, while the additional treatment with Trolox resulted in a 93% (±1%) reduction in mRNA expression compared to H2O2-treated cells. The incubation of control cells with Trolox did not alter the mRNA expression in relation to untreated cells. The ABCC6 deficiency resulted in a 13.4-fold (±2.0) elevated SIRT2 mRNA expression relative to untreated control cells, while none of the conditions tested altered the mRNA expression in knockdown cells (Figure 5A).
Regarding the SIRT3 mRNA expression, the incubation of control cells with H2O2 resulted in a 3.4-fold (±0.6) increased expression. Additional treatment with Trolox resulted in a 36% (±14%) reduction in mRNA expression compared to H2O2-treated cells, while the knockdown of ABCC6 led to a 2.4-fold (±0.5) increase compared to untreated control cells. The other conditions tested did not show any changes in mRNA expression (Figure 5B).
The SIRT6 mRNA expression was not significantly altered in control cells after treatment with H2O2, Trolox or their combination. Due to the knockdown of ABCC6, a 22.3-fold (±7.8) elevation in SIRT6 mRNA expression compared to untreated control cells, was observed. The treatment of knockdown cells with H2O2 led to a 95% (±1%) reduction in SIRT6 mRNA expression compared to untreated knockdown cells, while the additional incubation with Trolox led to an 8.9-fold (±3.5) elevated SIRT6 mRNA expression compared to H2O2-treated knockdown cells (Figure 5C).
Following the H2O2 treatment, the mRNA expression of SIRT7 was detected as 11.5-fold (±2.5) increased relative to the untreated control. The additional incubation with Trolox resulted in an 81% (±5%) reduction compared to H2O2-treated control cells, while Trolox alone did not alter the mRNA expression in relation to untreated control cells. The knockdown of ABCC6 led to a 6.1-fold (±2.1) elevated SIRT7 mRNA expression compared to untreated control cells. None of the conditions tested resulted in changes in the SIRT7 mRNA expression in knockdown cells compared to untreated knockdown cells (Figure 5D).
The mRNA expression of glutathione synthetase (GSS) was detected as 6.9-fold (±2.3) increased due to the incubation of control cells with H2O2 compared to the untreated cells, while the additional incubation with Trolox led to a 71% (±4%) reduction in relation to H2O2-treated cells. The treatment of control cells with Trolox did not result in any changes in mRNA expression relative to the untreated control. Following the knockdown of ABCC6, the mRNA expression of GSS was detected as 4.3-fold (±1.4) elevated compared to control cells. None of the treatments performed led to an altered GSS mRNA expression in knockdown cells relative to untreated knockdown cells (Figure 6A).
After the incubation of control cells with H2O2, the mRNA expression of glutathione peroxidase 1 (GPX1) was detected as 6.4-fold (±1.4) increased compared to the untreated control. The additional treatment with Trolox led to an 84% (±4%) reduction in relation to H2O2-treated cells. The incubation of control cells with Trolox did not result in any changes in mRNA expression compared to control cells. The mRNA expression of GPX1 was measured as 6.0-fold (±1.3) elevated in knockdown cells compared to control cells, while none of the treatments performed was shown to have an effect on GPX1 mRNA expression in knockdown cells (Figure 6B).
A 2.6-fold (±0.3) increase in the mRNA expression of GPX4 was detected in control cells following the H2O2-treatment relative to the untreated control, while the additional treatment with Trolox reduced the mRNA expression to 60% (±6%) relative to H2O2-treated cells. The knockdown of ABCC6 led to a 2.0-fold (±0.2) elevated mRNA expression of GPX4 compared to control cells. No alterations in GPX4 mRNA expression were present compared to the respective control for the other conditions tested (Figure 6C).
The incubation of control cells with H2O2 induced a 2.1-fold (±0.3) increase in the mRNA expression of catalase (CAT) compared to untreated control cells, while the additional Trolox treatment reduced the expression to 73% (±4%) relative to H2O2-treated cells. The incubation of control cells with Trolox alone led to a 60% (±9%) reduction in mRNA expression. Neither the knockdown of ABCC6, nor the additional treatments resulted in any alterations in mRNA expression (Figure 7A).
The treatment with H2O2 led to a 34.1-fold (±6.5) increase in TNF receptor associated protein 1 (TRAP1) mRNA expression in control cells relative to untreated cells. Trolox alone did not induce any changes in TRAP1 mRNA expression, while the treatment with H2O2 and Trolox resulted in a 91% (±2%) reduction in mRNA expression compared to H2O2-treated cells. Due to the knockdown of ABCC6, a 29.4-fold (±5.9) elevation in mRNA expression compared to control cells was detected. The treatment of knockdown cells with H2O2 or Trolox resulted in 63% (±11%) and 62% (±10%) decreased TRAP1 mRNA expression, relatively, compared to untreated knockdown cells, while the combination of H2O2 and Trolox left the mRNA expression in knockdown cells unchanged in relation to H2O2-treated cells (Figure 7B).

4. Discussion

Pseudoxanthoma elasticum (PXE) is a complex disorder with an impact on both the systemic and cellular levels. Oxidative stress seems to play a vital role in the pathomechanism of PXE but still needs to be further investigated. There has been evidence of systemic oxidative stress, supporting the metabolic hypothesis of PXE pathogenesis. Furthermore, investigations on patient-derived fibroblasts indicated oxidative stress on the cellular level as well, which provides evidence for the cellular hypothesis. Analyses on ABCC6-deficient human mesenchymal stem cells (hMSCs) regarding their oxidative status and senescence were performed to gain further insight into the cellular component of PXE pathogenesis.
A recent publication from Brampton et al. points to the bone marrow as a potential contributing factor in the PXE pathogenesis [10]. They were able to show that restoring the bone marrow of Abbc6-deficient mice with that of wildtype mice led to a significant reduction in the calcification of the whiskers and kidney. Interestingly, the transplantation of bone marrow from Abcc6-deficient mice into wildtype mice did not increase calcification [10]. Furthermore, Plümers et al. detected impairments in lipid trafficking, intra- and extracellular lipolysis, release of lipids and fatty acid neogenesis in adipocytes generated from ABCC6-deficient human mesenchymal stem cells (hMSCs) [25]. Due to these findings linking MSCs to the pathogenesis of PXE, hMSCs were chosen for this investigation. In accordance with Plümers et al., a CRISPR/Cas9-based approach for an ABCC6 knockdown was chosen [25]. Due to the inability to generate single cell cultures, a cell pool containing homozygous, heterozygous and wildtype cells was used here and must be taken into account when interpreting the results of this study. Nevertheless, based on the results of this study regarding the CRISPR efficiency, the fraction of wildtype cells in the pool can be considered small. A knockdown efficiency of approximately 70% was confirmed using a T7 endonuclease I assay, TA-cloning and qRT-PCR. No mutations were detected in the three most common off-target gene regions, so off-target effects can be ruled out (Figure S2). However, it was not possible to confirm the knockdown at the protein level due to the lack of appropriate antibodies against human ABCC6 or ABCC6-specific activity assays. Given the sample size of n = 2, the results generated here were used solely to gain initial insights into the relationship between ABCC6 and oxidative stress in hMSCs. The consistency of the observed trends confirms the biological relevance of our results. Nevertheless, a larger sample size will be required for future studies in order to further confirm the observations made here.
The reactive oxygen species (ROS) and nitric oxide (NO) were investigated using fluorescent dyes to evaluate the oxidative status of knockdown cells in comparison to control cells. The incubation with H2O2 was chosen to mimic the systemic oxidative stress reported in PXE patients and the vitamin E derivate Trolox was used to counteract a potential increase in reactive species (RS) levels following ABCC6 knockdown or H2O2 induction. The incubation with H2O2 increased the levels of total ROS and nitric oxide in both control and knockdown cells. This can be explained by the RS-inducing properties of H2O2 reported in the literature [26,27,28]. The additional treatment with Trolox reduced the levels of ROS and NO, emphasizing its antioxidative properties. After the knockdown of ABCC6, total ROS and NO were determined to be increased, possibly indicating oxidative stress in knockdown cells by induced production or reduced degradation of nitric oxide. Nitric oxide in mesenchymal stem cells is reported to have opposite effects depending on the concentration. While small concentrations were shown to promote cell survival and proliferation, higher concentrations can induce cell cycle arrest and senescence [29,30,31]. This suggests the hypothesis that the increased NO levels following the knockdown of ABCC6 may induce a senescence-like phenotype. It should be noted that the fluorescent dyes used in this study may be influenced by experimental artefacts. The fluorescence of DCFDA may be influenced by pH or metal ions, while it has been shown that DAF-FM may form fluorescent products through auto-oxidation or superoxide [32,33]. Therefore, the results shown here must be interpreted with caution. A higher β-galactosidase activity was detected for knockdown cells, indicating the presence of a senescence-like phenotype, therefore, the expression of NO synthetase could be investigated in future studies. Furthermore, the specific inhibition of NO formation by asymmetric dimethylarginine could give further insights into the possible association of NO levels and the senescence-like phenotype following ABCC6 knockdown [34,35]. An indication of this connection was made by the incubation of knockdown cells with the antioxidant Trolox, resulting in decreased β-galactosidase activity and an attenuated senescence-like phenotype. This suggests that a decrease in oxidative stress in ABCC6 knockdown cells may result in the reversal of the senescence-like phenotype detected. In addition, the β-galactosidase assay did not reveal any elevated activity for knockdown cells incubated with H2O2, indicating a possible resistance to additional oxidative stress. The senescence-like phenotype associated with PXE was also detected in patient-derived dermal fibroblasts, with elevated β-galactosidase activity in addition to increased secretion of interleukin 6 (IL-6) and a higher mRNA expression of p21 but not p53 [36]. In this study, an elevated mRNA expression of p21 and p53 was detected. The differences between this study and that of Tiemann et al. could be explained by the use of different cell types, since the senescence-associated secretory phenotype is highly cell-type specific [37]. The decrease in β-galactosidase activity by incubation with Trolox was not accompanied by a decreased mRNA expression of p21 and p53 in knockdown cells, which could be explained by post-transcriptional regulations influencing protein synthesis and activity. Immunofluorescence staining of p21 and p53 was performed to further investigate the influence of the cell cycle inhibitors on the senescence-like phenotype, revealing a strong increase in protein abundance for p53. In contrast to the β-galactosidase assay, the treatment of knockdown cells with H2O2 further increased the fluorescence signal of p53, while the additional treatment with Trolox counteracted this increase. It might be useful here to investigate the protein abundance and localization of phosphorylated p53 using immunofluorescence or a Western blot, since phosphorylated p53 is the transcriptionally active form [38,39]. The discrepancy between mRNA and protein expression observed for p21 indicates pronounced post-transcriptional regulation, which has already been demonstrated for p21 [40].
The oxidative damage was evaluated using immunofluorescence staining with antibodies specific to 4-hydroxynonenal (4-HNE), a product of lipid peroxidation by oxidative stress [41]. It was shown that the knockdown of ABCC6 resulted in increased lipid peroxidation, possibly due to the elevated ROS levels. Surprisingly, the incubation of cells with H2O2 did not result in any increased lipid peroxidation. This could be explained by the degradation of 4-HNE with time, which can be mediated by proteins such as aldose reductase, glutathione-S-transferases and aldehyde dehydrogenases. The expression or activity of these proteins could be investigated in future studies to better understand the absence of lipid peroxidation products in H2O2-treated control cells. The same procedure could also be applicable in knockdown cells incubated with H2O2, since they show no increase in lipid peroxidation either. Regarding the knockdown cells, the unaltered level of lipid peroxidation after H2O2 treatment could also be in accordance with the results of the β-galactosidase assay, showing no increased activity after treatment. Trolox was shown to decrease the level of 4-HNE fluorescence in knockdown cells, proving to be a suitable inhibitor of oxidative stress damage induced by ABCC6 deficiency. In contrast to this, the additional treatment with Trolox reduced the 4-HNE fluorescence signal only in control cells.
Sirtuins (SIRT) are a family of histone deacetylases with different functions in processes associated with oxidative stress defense [19,20]. The mRNA expression of SIRT2, SIRT3, SIRT6 and SIRT7 was shown to be upregulated by incubation with H2O2 in control cells and following ABCC6 knockdown, while no change in mRNA expression was detectable in H2O2-treated knockdown cells. SIRT2 was shown to increase the expression of superoxide dismutase 1/2 and decrease oxidative stress and senescence through the inhibition of the p21/p53 pathway in nucleus pulposus cells [42]. In this study, mRNA expression of SIRT2 could be a compensatory mechanism for the senescence-like phenotype following the H2O2 treatment of control cells and ABCC6 knockdown. The sirtuins 3, 4 and 5 are localized in the mitochondria. Only the mRNA expression of SIRT3 is altered by incubation with H2O2 or ABCC6 knockdown; therefore, only a mildly, if any, altered mitochondrial oxidative stress can be assumed following H2O2-treatment and knockdown. Furthermore, SIRT3 was shown to deacetylate specific components of the electron transport chain to increase the oxidative phosphorylation and decrease its sensitivity to RS [43,44,45]. In addition, SIRT3 is an activator of fatty-acid oxidation in the mitochondria [46,47]. In accordance with the literature, these results suggest alterations in the mitochondrial energy metabolism and fatty-acid oxidation that require further investigation [7]. Knockout of SIRT6 promotes premature aging in mice [48]. It was shown that SIRT6 protects cells against oxidative stress-induced DNA damage and exerts highly cell type specific effects on proliferation [49,50,51]. Furthermore, a SIRT6 deficiency promotes the switch to anaerobic glycolysis, resulting in lactate generation and a decrease in mitochondrial oxidative phosphorylation [52]. In light of these reported functions of SIRT6, a compensatory upregulation due to the ABCC6 knockdown and the increase in RS levels would be possible. In addition, the increased mRNA expression of SIRT6 could be a sign of elevated aerobic glycolysis and ATP generation in mitochondria. This possibility has to be investigated in future studies. The function of SIRT7 is largely unknown, though it seems to regulate cell growth and metabolism, may be required for cell viability and modulates the stress response of cells to difficult circumstances [53,54,55,56]. A possible explanation for the upregulated mRNA expression of SIRT7 would be the adaptation to the increased oxidative stress following ABCC6 knockdown.
Regarding the mRNA expression of GSS, GPX1 and GPX4, the same pattern of induced expression following H2O2 treatment and ABCC6 knockdown with a lack of induction after the incubation of knockdown cells with H2O2 was detected. Glutathione is a very important cellular antioxidant protein that is synthesized by glutathione synthetase (GSS), whereby its antioxidant property is mostly mediated by glutathione peroxidases (GPX). Glutathione can be used to degrade H2O2 and lipid peroxides, generating glutathione disulfide that can be restored to maintain the cells’ antioxidant defense [57]. The upregulation of mRNA expression detected could be a compensatory mechanism due to the induction of oxidative stress by incubation with H2O2 or ABCC6 knockdown. Since no further elevation in mRNA expression was detectable after the H2O2 treatment of knockdown cells, the maximum induction may be reached due to the knockdown with no further elevation possible. The protective effects of increased GSS or GPX1 mRNA expression against oxidative stress were shown in genetically engineered mice and chicken embryo fibroblasts [58,59]. The redox status of the knockdown hMSCs could be evaluated in further studies to investigate changes by the application of additional oxidative stress.
Regarding the mRNA expression of catalase (CAT), no changes were detected following ABCC6 knockdown, indicating that the advanced oxidative defense of knockdown cells is based mainly on the glutathione system. The mRNA expression of TNF receptor associated protein 1 (TRAP1) was induced after the incubation of control cells with H2O2 and ABCC6 knockdown. Since TRAP1 is a mitochondria-localized protein that protects against oxidative stress, these results seem to contradict the lack of elevation of mitochondrial superoxide. However, there are different postulated functions of TRAP1 in the endoplasmic reticulum and the cytosol. TRAP1 seems to be a part of the tumor necrosis factor-α pathway and activates the transcription factor signal transducer and activator of transcription 3 (STAT3) [60]. In previous work, the JAK/STAT3 signaling pathway was shown to be activated in fibroblasts derived from PXE patients, resulting in increased inflammation [61]. The elevated expression of TRAP1 may be one contributing factor of STAT3 activation.

5. Conclusions

The data obtained in this study suggest that knockdown of ABCC6 leads to a p53-mediated senescence-like phenotype due to increased levels of reactive species. This is accompanied by increased lipid peroxidation and enhanced oxidative stress defenses, making knockdown cells insensitive to further oxidative stress. Some results point to defects in mitochondrial energy generation and fatty-acid oxidation that require further investigation. The antioxidant Trolox was shown to reduce reactive species levels in knockdown cells, leading to an attenuated senescence-like phenotype and lipid peroxidation but leaving the elevated oxidative stress defense unaltered. This study further emphasizes the impact of oxidative stress on the PXE phenotype and provides new indications for the use of antioxidants as a potential treatment for PXE.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/antiox15020241/s1. Figure S1. Validation of CRISPR-Cas9 mediated ABCC6 knockdown. Figure S2. Sanger sequencing of possible off-targets. Figure S3. Mutational diversity in knockdown pools. Figure S4. Gating strategy of reactive species detection using flow cytometry. Table S1. Characteristics of the sequencing primers used in this study. Included are gene names, primer sequences, annealing temperatures and product sizes.

Author Contributions

Conceptualization, C.K. and D.H.; methodology, M.R.O.; validation, M.R.O.; formal analysis, M.R.O.; investigation, M.R.O.; resources, C.K. and D.H.; data curation, M.R.O.; writing—original draft preparation, M.R.O.; writing—review and editing, C.K. and D.H.; visualization, M.R.O.; supervision, C.K.; project administration, D.H. All authors have read and agreed to the published version of the manuscript.

Funding

Publication was funded by Open Access (OA) Fund of the Ruhr-Universität Bochum.

Institutional Review Board Statement

Ethical review and approval were waived for this study due to the use of commercial human cell lines.

Informed Consent Statement

Patient consent was waived due to the use of commercial human cell lines.

Data Availability Statement

The original raw data and materials presented in the study will be made available upon request. Further inquiries can be directed to the corresponding author.

Acknowledgments

We thank Philip Saunders for his linguistic advice.

Conflicts of Interest

The authors declare no conflicts of interest.

Abbreviations

The following abbreviations are used in this manuscript:
·O2-Superoxide
4-HNE4-Hydroxynonenal
ABCC6ATP binding cassette subfamily C member 6
ANOVAAnalysis of variance
ATPAdenosine triphosphate
CATCatalase
CRISPRClustered regularly interspaced short palindromic repeat
crRNACRISPR RNA
DAF-FM4-Amino-5-methylamino-2’,7’-difluorofluorescein diacetate
DCFCA6-Carboxy-2’,7’-dichlordihydrofluorescein-diacetat
GPXGlutathione peroxidase
GSSGlutathione synthetase
H2O2Hydrogen peroxide
hMSCsHuman mesenchymal stem cells
ILInterleukin
JAKJanus kinase
NONitric oxide
PXEPseudoxanthoma elasticum
qRT-PCRQuantitative real time polymerase chain reaction
ROSReactive oxygen species
RSReactive species
SEMStandard error of mean
SIRTSirtuin
STATSignal transducer and activator of transcription
TRAP1Tumor necrosis factor receptor associated protein 1

References

  1. Le Saux, O.; Martin, L.; Aherrahrou, Z.; Leftheriotis, G.; Váradi, A.; Brampton, C.N. The molecular and physiological roles of ABCC6: More than meets the eye. Front. Genet. 2012, 3, 289. [Google Scholar] [CrossRef]
  2. Bergen, A.A.B.; Plomp, A.S.; Schuurman, E.J.; Terry, S.; Breuning, M.; Dauwerse, H.; Swart, J.; Kool, M.; van Soest, S.; Baas, F.; et al. Mutations in ABCC6 cause Pseudoxanthoma elasticum. Nat. Genet. 2000, 25, 228–231. [Google Scholar] [CrossRef]
  3. Madon, J.; Hagenbuch, B.; Landmann, L.; Meier, P.J.; Stieger, B. Transport function and hepatocellular localization of mrp6 in rat liver. Mol. Pharmacol. 2000, 57, 634–641. [Google Scholar] [CrossRef]
  4. Beck, K.; Hayashi, K.; Nishiguchi, B.; Le Saux, O.; Hayashi, M.; Boyd, D.B. The distribution of Abcc6 in normal mouse tissues suggests multiple functions for this ABC transporter. J. Histochem. Cytochem. 2003, 51, 887–902. [Google Scholar] [CrossRef]
  5. Moitra, K.; Garcia, S.; Jaldin, M.; Etoundi, C.; Cooper, D.; Roland, A.; Dixon, P.; Reyes, S.; Turan, S.; Terry, S.; et al. ABCC6 and Pseudoxanthoma elasticum: The face of a rare disease from genetics to advocacy. Int. J. Mol. Sci. 2017, 18, 1488. [Google Scholar] [CrossRef] [PubMed]
  6. Li, Q.; Jiang, Q.; Pfendner, E.; Váradi, A.; Uitto, J. Pseudoxanthoma elasticum: Clinical phenotypes, molecular genetics and putative pathomechanisms. Exp. Dermatol. 2009, 18, 1–11. [Google Scholar] [CrossRef]
  7. Lofaro, F.D.; Boraldi, F.; Garcia-Fernandez, M.; Estrella, L.; Valdivieslo, P.; Quaglino, D. Relationship between mitochondrial structure and bioenergetics in Pseudoxanthoma elasticum dermal fibroblasts. Front. Cell Dev. Biol. 2020, 8, 610266. [Google Scholar] [CrossRef]
  8. Pasquali-Ronchetti, I.; Garcia-Fernandez, M.; Boraldi, F.; Quaglino, D.; Gheduzzi, D.; De Vincenzi Paolinelli, C.; Tiozzo, R.; Bergamini, S.; Ceccarelli, D.; Muscatello, U. Oxidative stress in fibroblasts from patients with Pseudoxanthoma elasticum: Possible role in the pathogenesis of clinical manifestations. J. Pathol. 2006, 208, 54–61. [Google Scholar] [CrossRef]
  9. Garcia-Fernandez, M.I.; Gheduzi, D.; Boraldi, F.; Devincenzi Paolinelli, C.; Sanchez, P.; Valdovielso, P.; Morilla, M.J.; Quaglino, D.; Guerra, D.; Casolari, S.; et al. Parameters of oxidative stress are present in the circulation of PXE patients. Biochim. Biophys. Acta BBA-Mol. Basis Dis. 2008, 1782, 474–481. [Google Scholar] [CrossRef] [PubMed]
  10. Takai, H.; Smogorzewska, A.; De Lange, T. DNA damage foci at dysfunctional telomeres. Curr. Biol. 2003, 13, 1549–1556. [Google Scholar] [CrossRef] [PubMed]
  11. Zhang, L.; Pitcher, L.E.; Yousefzadeh, M.J.; Niederhofer, L.J.; Robbins, P.D.; Zhu, Y. Cellular senescence: A key therapeutic target in aging and diseases. J. Clin. Investig. 2022, 132, e158450. [Google Scholar] [CrossRef]
  12. Rodier, F.; Campisi, J. Four faces of cellular senescence. J. Cell Biol. 2022, 192, 547–556. [Google Scholar] [CrossRef]
  13. Lee, A.C.; Fenster, B.E.; Ito, H.; Takeda, K.; Bae, N.S.; Hirai, T.; Yu, Z.-X.; Ferrans, V.J.; Howard, B.N.; Finkel, T. Ras Proteins induce senescence by altering the intracellular levels of reactive oxygen species. J. Biol. Chem. 1999, 274, 7936–7940. [Google Scholar] [CrossRef]
  14. Passos, J.F.; Nelson, G.; Wang, C.; Richter, T.; Simillion, C.; Proctor, C.J.; Miwa, S.; Olijslagers, S.; Hallinan, J.; Wipat, A.; et al. Feedback between p21 and reactive oxygen production is necessary for cell senescence. Mol. Syst. Biol. 2010, 6, MSB20105. [Google Scholar] [CrossRef]
  15. Park, J.-H.; Kim, T.-Y.; Jong, H.-S.; Kim, T.Y.; Chun, Y.-S.; Park, J.-W.; Lee, C.-T.; Jung, H.C.; Kim, N.K.; Bang, Y.-J. Gastric epithelial reactive oxygen species prevent normoxic degradation of hypoxia-inducible factor-1 in gastric cancer cells. Clin. Cancer Res. 2003, 9, 433–440. [Google Scholar]
  16. Meyer, M.; Schreck, R.; Baeuerle, P.A. H202 and antioxidants have opposite effects on activation of NF-xB and AP-1 in intact cells: AP-1 as secondary antioxidant-responsive factor. EMBO J. 1993, 12, 2005–2015. [Google Scholar] [CrossRef] [PubMed]
  17. Simon, A.R.; Rai, U.; Fanburg, B.L.; Cochran, B.H. Activation of the JAK-STAT pathway by reactive oxygen species. Am. J. Physiol.-Cell Physiol. 1998, 275, C1640–C1652. [Google Scholar] [CrossRef] [PubMed]
  18. Davalli, P.; Mitic, T.; Caporali, A.; Lauriola, A.; D’Arca, D. ROS, cell senescence, and novel molecular mechanisms in aging and age-related diseases. Oxidative Med. Cell. Longev. 2016, 2016, 3565127. [Google Scholar] [CrossRef]
  19. Singh, C.K.; Chhabra, G.; Ndiaye, M.A.; Garcia-Peterson, L.M.; Mack, N.J.; Ahmad, N. The role of sirtuins in antioxidant and redox signaling. Antioxid. Redox Signal. 2018, 28, 643–661. [Google Scholar] [CrossRef]
  20. Imai, S.; Armstrong, C.M.; Kaeberlein, M.; Guarente, L. Transcriptional silencing and longevity protein Sir2 is an NAD-dependent histone deacetylase. Nature 2000, 403, 795–800. [Google Scholar] [CrossRef]
  21. Standing, A.S.; Hong, Y.; Paisan-Ruiz, C.; Omoyinmi, E.; Medlar, A.; Stanescu, H.; Kleta, R.; Rowcenzio, D.; Hawkins, P.; Lachmann, H.; et al. TRAP1 chaperone protein mutations and autoinflammation. Life Sci. Alliance 2020, 3, e201900376. [Google Scholar] [CrossRef]
  22. Kuilman, T.; Nichaloglou, C.; Vredeveld, L.C.W.; Douma, S.; van Doorn, R.; Desmet, C.J.; Arden, L.A.; Mooi, W.J.; Peeper, D.S. Oncogene-induced senescence relayed by an interleukin-dependent inflammatory network. Cell 2008, 133, 1019–1031. [Google Scholar] [CrossRef]
  23. Lee, B.Y.; Han, J.A.; Im, J.S.; Morrone, A.; Johung, K.; Goodwin, E.C.; Kleijer, W.J.; DiMaio, D.; Hwang, E.S. Senescence-associated β-galactosidase is lysosomal β-galactosidase. Aging Cell 2006, 5, 187–195. [Google Scholar] [CrossRef]
  24. Brampton, C.; Pomozi, V.; Le Corre, Y.; Zoll, J.; Kauffenstein, G.; Ma, C.; Hoffman, P.R.; Martin, L.; Le Saux, O. Bone marrow–derived ABCC6 is an essential regulator of ectopic calcification in Pseudoxanthoma elasticum. J. Investig. Dermatol. 2024, 144, 1772–1783.e3. [Google Scholar] [CrossRef] [PubMed]
  25. Plümers, R.; Osterhage, M.R.; Lindenkamp, C.; Knabbe, C.; Hendig, D. Targeting ABCC6 in mesenchymal stem cells: Impairment of mature adipocyte lipid homeostasis. Int. J. Mol. Sci. 2022, 23, 9218. [Google Scholar] [CrossRef]
  26. Gary, R.K.; Kindell, S.M. Quantitative assay of senescence-associated β-galactosidase activity in mammalian cell extracts. Anal. Biochem. 2005, 343, 329–334. [Google Scholar] [CrossRef] [PubMed]
  27. Dávila, D.; Torres-Aleman, I. Neuronal death by oxidative stress involves activation of FOXO3 through a two-arm pathway that activates stress kinases and attenuates insulin-like growth factor I signaling. Mol. Biol. Cell 2008, 19, 2014–2025. [Google Scholar] [CrossRef]
  28. Chen, L.; Liu, L.; Yin, J.; Luo, Y.; Huang, S. Hydrogen peroxide-induced neuronal apoptosis is associated with inhibition of protein phosphatase 2A and 5, leading to activation of MAPK pathway. Int. J. Biochem. Cell Biol. 2009, 41, 1284–1295. [Google Scholar] [CrossRef] [PubMed]
  29. Ugusman, A.; Zakaria, Z.; Hui, C.K.; Nordin, N.A.M.M. Piper sarmentosum increases nitric oxide production in oxidative stress: A study on human umbilical vein endothelial cells. Clinics 2010, 65, 709–714. [Google Scholar] [CrossRef]
  30. Van de Wouwer, M.; Couzinié, C.; Serrano-Palero, M.; González-Fernández, Ó.; Galmés-Varela, C.; Menéndez-Antolí, P.; Grau, L.; Villalobo, A. Activation of the BRCA1/Chk1/p53/p21Cip1/Waf1 pathway by nitric oxide and cell cycle arrest in human neuroblastoma NB69 cells. Nitric Oxide 2012, 26, 182–191. [Google Scholar] [CrossRef]
  31. Bonafè, F.; Guarnieri, C.; Muscari, C. Nitric oxide regulates multiple functions and fate of adult progenitor and stem cells. J. Physiol. Biochem. 2015, 71, 141–153. [Google Scholar] [CrossRef]
  32. Thomas, D.D.; Ridnour, L.A.; Isenberg, J.S.; Flores-Santana, W.; Switzer, C.H.; Donzelli, S.; Hussain, P.; Vecoli, C.; Paolocci, N.; Ambs, A.; et al. The chemical biology of nitric oxide: Implications in cellular signaling. Free Radic. Biol. Med. 2008, 45, 18–31. [Google Scholar] [CrossRef]
  33. Balcerczyk, A.; Soszynski, M.; Bartosz, G. On the specificity of 4-amino-5-methylamino-2′,7′-difluorofluorescein as a probe for nitric oxide. Free Radic. Biol. Med. 2005, 39, 327–335. [Google Scholar] [CrossRef] [PubMed]
  34. Murphy, M.P.; Bayir, H.; Belousov, V.; Chang, C.J.; Davies, K.J.A.; Davies, M.J.; Dick, T.P.; Finkel, T.; Forman, H.J.; Janssen-Heiningeret, Y.; et al. Guidelines for measuring reactive oxygen species and oxidative damage in cells and in vivo. Nat. Metab. 2022, 4, 651–662. [Google Scholar] [CrossRef] [PubMed]
  35. MacAllister, R.J.; Whitley, G.S.J.; Vallance, P. Effects of guanidino and uremic compounds on nitric oxide pathways. Kidney Int. 1994, 45, 737–742. [Google Scholar] [CrossRef] [PubMed]
  36. Leone, A.; Moncada, S.; Vallance, P.; Calver, A.; Collier, J. Accumulation of an endogenous inhibitor of nitric oxide syn-thesis in chronic renal failure. Lancet 1992, 339, 572–575. [Google Scholar] [CrossRef]
  37. Tiemann, J.; Wagner, T.; Lindenkamp, C.; Plümers, R.; Faust, I.; Knabbe, C.; Hendig, D. Linking ABCC6 deficiency in primary human dermal fibroblasts of PXE patients to p21-mediated premature cellular senescence and the development of a proinflammatory secretory phenotype. Int. J. Mol. Sci. 2020, 21, 9665. [Google Scholar] [CrossRef]
  38. Głuchowska, A.; Cysewski, D.; Baj-Krzsworzeka, M.; Szatanek, R.; Węglarczyk, K.; Podszywałow-Bartnicka, P.; Sunderland, P.; Kozłowska, E.; Śliwińska, M.A.; Dąbrowski, M.; et al. Unbiased proteomic analysis of extracellular vesicles secreted by senescent human vascular smooth muscle cells reveals their ability to modulate immune cell functions. GeroScience 2022, 44, 2863–2884. [Google Scholar] [CrossRef]
  39. Dumaz, N.; Meek, D.W. Serine15 phosphorylation stimulates p53 transactivation but does not directly influence interaction with HDM2. EMBO J. 1999, 18, 7002–7010. [Google Scholar] [CrossRef]
  40. Jung, Y.-S.; Qian, Y.; Chen, X. Examination of the expanding pathways for the regulation of p21 expression and activity. Cell Signal. 2010, 22, 1003–1012. [Google Scholar] [CrossRef]
  41. Uchida, K. 4-Hydroxy-2-nonenal: A product and mediator of oxidative stress. Prog. Lipid Res. 2003, 42, 318–343. [Google Scholar] [CrossRef]
  42. Yang, M.; Peng, Y.; Liu, W.; Zhou, M.; Meng, Q.; Yuan, C. Sirtuin 2 expression suppresses oxidative stress and senescence of nucleus pulposus cells through inhibition of the p53/p21 pathway. Biochem. Biophys. Res. Commun. 2019, 513, 616–622. [Google Scholar] [CrossRef]
  43. Ahn, B.-H.; Kim, H.-S.; Song, S.; Lee, I.-H.; Vassilopoulos, A.; Deng, C.-X.; Finkel, T. A role for the mitochondrial deacetylase Sirt3 in regulating energy homeostasis. Proc. Natl. Acad. Sci. USA 2008, 105, 14447–14452. [Google Scholar] [CrossRef]
  44. Lombard, D.B.; Alt, F.W.; Cheng, H.-L.; Bunkenborg, J.; Streeper, R.S.; Mostoslavsky, R.; Kim, J.; Yancopoulos, G.; Valenzuela, D.; Murphy, A.; et al. Mammalian Sir2 homolog SIRT3 regulates global mitochondrial lysine acetylation. Mol. Cell. Biol. 2007, 27, 8807–8814. [Google Scholar] [CrossRef] [PubMed]
  45. Someya, S.; Yu, W.; Hallows, W.C.; Xu, J.; Vann, J.M.; Leeuwenburgh, C.; Tanokura, M.; Denu, J.M.; Prolla, T.A. Sirt3 mediates reduction of oxidative damage and prevention of age-related hearing loss under caloric restriction. Cell 2010, 143, 802–812. [Google Scholar] [CrossRef] [PubMed]
  46. Hallows, W.C.; Yu, W.; Smith, B.C.; Devires, M.K.; Ellinger, J.J.; Someya, S.; Shortreed, M.R.; Prolla, T.; Markley, J.L.; Smith, L.M.; et al. Sirt3 promotes the urea cycle and fatty acid oxidation during dietary restriction. Mol. Cell 2011, 41, 139–149. [Google Scholar] [CrossRef]
  47. Hirschey, M.D.; Shimazu, T.; Goetzman, E.; Jing, E.; Schwer, B.; Lombard, D.B.; Grueter, C.A.; Harris, C.; Biddinger, S.; Ilkayeva, O.R.; et al. SIRT3 regulates fatty acid oxidation via reversible enzyme deacetylation. Nature 2010, 464, 121–125. [Google Scholar] [CrossRef] [PubMed]
  48. Mostoslavsky, R.; Chua, K.F.; Lombard, D.B.; Pang, W.W.; Fischer, M.R.; Gellon, L.; Liu, P.; Mostoslavsky, G.; Franco, S.; Murphy, M.M.; et al. Genomic instability and aging-like phenotype in the absence of mammalian SIRT6. Cell 2006, 124, 315–329. [Google Scholar] [CrossRef]
  49. Pan, H.; Guan, D.; Liu, X.; Li, J.; Wang, L.; Wu, J.; Zhou, J.; Zhang, W.; Ren, R.; Zhang, W.; et al. SIRT6 safeguards human mesenchymal stem cells from oxidative stress by coactivating NRF2. Cell Res. 2016, 26, 190–205. [Google Scholar] [CrossRef]
  50. Mao, Z.; Hine, C.; Tian, X.; Van Meter, M.; Au, M.; Vaidya, A.; Seluanov, A.; Gorbunova, V. SIRT6 promotes DNA repair under stress by activating PARP1. Science 2011, 332, 1443–1446. [Google Scholar] [CrossRef]
  51. Van Meter, M.; Mao, Z.; Gorbunova, V.; Seluanov, A. SIRT6 overexpression induces massive apoptosis in cancer cells but not in normal cells. Cell Cycle 2011, 10, 3153–3158. [Google Scholar] [CrossRef]
  52. Zhong, L.; Mostoslavsky, R. SIRT6 A master epigenetic gatekeeper of glucose metabolism. Transcription 2010, 1, 17–21. [Google Scholar] [CrossRef]
  53. Ford, E.; Voit, R.; Liszt, G.; Magin, C.; Grummt, I.; Guarente, L. Mammalian Sir2 homolog SIRT7 is an activator of RNA polymerase I transcription. Genes Dev. 2006, 20, 1075–1080. [Google Scholar] [CrossRef] [PubMed]
  54. Haigis, M.C.; Guarente, L.P. Mammalian sirtuins—Emerging roles in physiology, aging, and calorie restriction. Genes Dev. 2006, 20, 2913–2921. [Google Scholar] [CrossRef] [PubMed]
  55. Shin, J.; He, M.; Liu, Y.; Paredes, S.; Villanova, L.; Brown, K.; Qiu, X.; Nabavi, N.; Mohrin, M.; Wojnoonski, K.; et al. SIRT7 represses myc activity to suppress ER stress and prevent fatty liver disease. Cell Rep. 2013, 5, 654–665. [Google Scholar] [CrossRef] [PubMed]
  56. Chen, H.; Yang, Z.; Sun, Y.; Yin, S.; Tang, M.; Zhang, F. Targeting the key enzymes of abnormal fatty acid β-oxidation as a potential strategy for tumor therapy. Front. Biosci. 2022, 27, 95. [Google Scholar] [CrossRef]
  57. Lu, S.C. Regulation of glutathione synthesis. Mol. Asp. Med. 2009, 30, 42–59. [Google Scholar] [CrossRef]
  58. Yun, J.-W.; Lum, K.; Lei, X.G. A novel up-regulation of glutathione peroxidase 1 by knockout of liver regenerating protein Reg3β aggravates acetaminophen-induced hepatic protein nitration. Free Radic. Biol. Med. 2013, 65, 291–300. [Google Scholar] [CrossRef]
  59. Lin, J.; Min, R.; Yi, X.; Zhuang, Y. Overexpression of glutathione synthetase gene improving redox homeostasis and chicken infectious bursal disease virus propagation in chicken embryo fibroblast DF-1. Bioresour. Bioprocess. 2023, 10, 60. [Google Scholar] [CrossRef]
  60. Ramos Rego, I.; Santos Cruz, B.; Ambrósio, A.F.; Alves, C.H. TRAP1 in oxidative stress and neurodegeneration. Antioxidants 2021, 10, 1829. [Google Scholar] [CrossRef]
  61. Lindenkamp, C.; Plümers, R.; Osterhage, M.R.; Vanakker, O.M.; Van Wynsberghe, J.; Knabbe, C.; Hendig, D. The activation of JAK/STAT3 signaling and the complement system modulate inflammation in the primary human dermal fibroblasts of PXE patients. Biomedicines 2023, 11, 2673. [Google Scholar] [CrossRef] [PubMed]
Antioxidants 15 00241 g001
Figure 1. Measurement of different types of reactive species in control and knockdown human mesenchymal stem cells (hMSCs). Control and knockdown hMSCs (n = 2) were treated with H2O2, the antioxidant Trolox, H2O2 in addition to Trolox or were left untreated for 72 h. Cells were stained using (A) 10 µM DCFDA for 1 h and (B) 10 µM DAF-FM for 1 h. Additionally, a viability stain was used to label dead cells. After incubation, cells were washed, detached and fluorescence was detected using flow cytometry. Data are shown as mean ± SEM. Statistical significance was determined using three-way ANOVA. ** p ≤ 0.01, **** p ≤ 0.0001, ns: not significant.
Figure 1. Measurement of different types of reactive species in control and knockdown human mesenchymal stem cells (hMSCs). Control and knockdown hMSCs (n = 2) were treated with H2O2, the antioxidant Trolox, H2O2 in addition to Trolox or were left untreated for 72 h. Cells were stained using (A) 10 µM DCFDA for 1 h and (B) 10 µM DAF-FM for 1 h. Additionally, a viability stain was used to label dead cells. After incubation, cells were washed, detached and fluorescence was detected using flow cytometry. Data are shown as mean ± SEM. Statistical significance was determined using three-way ANOVA. ** p ≤ 0.01, **** p ≤ 0.0001, ns: not significant.
Antioxidants 15 00241 g001
Antioxidants 15 00241 g002
Figure 2. Evaluation of the senescent phenotype of ABCC6 knockdown and control hMSCs. Control and knockdown hMSCs (n = 2) were treated with H2O2, the antioxidant Trolox, H2O2 in addition to Trolox or were left untreated for 72 h. (A) Cells were lysed and the β-galactosidase activity was measured using a fluorescence assay. The mRNA expression of the cell cycle inhibitors (B) p21 and (C) p53 was detected via qRT-PCR. Data are shown as mean ± SEM. Statistical significance was determined using three-way ANOVA. * p ≤ 0.05, ** p ≤ 0.01, **** p ≤ 0.0001, ns not significant.
Figure 2. Evaluation of the senescent phenotype of ABCC6 knockdown and control hMSCs. Control and knockdown hMSCs (n = 2) were treated with H2O2, the antioxidant Trolox, H2O2 in addition to Trolox or were left untreated for 72 h. (A) Cells were lysed and the β-galactosidase activity was measured using a fluorescence assay. The mRNA expression of the cell cycle inhibitors (B) p21 and (C) p53 was detected via qRT-PCR. Data are shown as mean ± SEM. Statistical significance was determined using three-way ANOVA. * p ≤ 0.05, ** p ≤ 0.01, **** p ≤ 0.0001, ns not significant.
Antioxidants 15 00241 g002
Antioxidants 15 00241 g003
Figure 3. Immunofluorescence images and quantification of cell cycle inhibitors. Control and knockdown hMSCs (n = 2) were treated with H2O2, the antioxidant Trolox, H2O2 in addition to Trolox or were left untreated for 72 h. Cells were reseeded for immunofluorescence and the cell cycle inhibitors (A) p21 and (B) p53 (magenta) were stained using specific antibodies. Nuclei were counterstained using Hoechst (grey). Representative images, scale bar 10 µm. Fluorescence intensity in the nucleic area was quantified via ImageJ. Data are shown as mean ± SEM. Statistical significance was determined using three-way ANOVA. *** p ≤ 0.001, **** p ≤ 0.0001, ns not significant.
Figure 3. Immunofluorescence images and quantification of cell cycle inhibitors. Control and knockdown hMSCs (n = 2) were treated with H2O2, the antioxidant Trolox, H2O2 in addition to Trolox or were left untreated for 72 h. Cells were reseeded for immunofluorescence and the cell cycle inhibitors (A) p21 and (B) p53 (magenta) were stained using specific antibodies. Nuclei were counterstained using Hoechst (grey). Representative images, scale bar 10 µm. Fluorescence intensity in the nucleic area was quantified via ImageJ. Data are shown as mean ± SEM. Statistical significance was determined using three-way ANOVA. *** p ≤ 0.001, **** p ≤ 0.0001, ns not significant.
Antioxidants 15 00241 g003
Antioxidants 15 00241 g004
Figure 4. Immunofluorescence images and quantification of lipid peroxidation marker 4-HNE. Control and knockdown hMSCs (n = 2) were treated with H2O2, the antioxidant Trolox, H2O2 in addition to Trolox or were left untreated for 72 h. (A) Cells were reseeded for immunofluorescence and the lipid peroxidation marker 4-HNE (magenta) was stained using a specific antibody. Nuclei were counterstained using Hoechst (grey). Representative images, scale bar 10 µm. (B) Fluorescence intensity per cell was measured via ImageJ. Data are shown as mean ± SEM. Statistical significance was determined using three-way ANOVA. * p ≤ 0.05, *** p ≤ 0.001, ns: not significant.
Figure 4. Immunofluorescence images and quantification of lipid peroxidation marker 4-HNE. Control and knockdown hMSCs (n = 2) were treated with H2O2, the antioxidant Trolox, H2O2 in addition to Trolox or were left untreated for 72 h. (A) Cells were reseeded for immunofluorescence and the lipid peroxidation marker 4-HNE (magenta) was stained using a specific antibody. Nuclei were counterstained using Hoechst (grey). Representative images, scale bar 10 µm. (B) Fluorescence intensity per cell was measured via ImageJ. Data are shown as mean ± SEM. Statistical significance was determined using three-way ANOVA. * p ≤ 0.05, *** p ≤ 0.001, ns: not significant.
Antioxidants 15 00241 g004
Antioxidants 15 00241 g005
Figure 5. The mRNA expression of sirtuins, a family of antioxidative proteins. Control and knockdown hMSCs (n = 2) were treated with H2O2, the antioxidant Trolox, H2O2 in addition to Trolox or were left untreated for 72 h. Cells were lysed and qRT-PCR was used to measure the mRNA expression of (A) SIRT2, (B) SIRT3, (C) SIRT6 and (D) SIRT7. Data are shown as mean ± SEM. Statistical significance was determined using three-way ANOVA. * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001, **** p≤ 0.0001, ns not significant.
Figure 5. The mRNA expression of sirtuins, a family of antioxidative proteins. Control and knockdown hMSCs (n = 2) were treated with H2O2, the antioxidant Trolox, H2O2 in addition to Trolox or were left untreated for 72 h. Cells were lysed and qRT-PCR was used to measure the mRNA expression of (A) SIRT2, (B) SIRT3, (C) SIRT6 and (D) SIRT7. Data are shown as mean ± SEM. Statistical significance was determined using three-way ANOVA. * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001, **** p≤ 0.0001, ns not significant.
Antioxidants 15 00241 g005
Antioxidants 15 00241 g006
Figure 6. The mRNA expression of glutathione-oxidative defense genes. Control and knockdown hMSCs (n = 2) were treated with H2O2, the antioxidant Trolox, H2O2 in addition to Trolox or were left untreated for 72 h. Cells were lysed and qRT-PCR was used to measure the mRNA expression of (A) GSS, (B) GPX1 and (C) GPX4. Data are shown as mean ± SEM. Statistical significance was determined using three-way ANOVA. * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001, **** p ≤ 0.0001, ns: not significant.
Figure 6. The mRNA expression of glutathione-oxidative defense genes. Control and knockdown hMSCs (n = 2) were treated with H2O2, the antioxidant Trolox, H2O2 in addition to Trolox or were left untreated for 72 h. Cells were lysed and qRT-PCR was used to measure the mRNA expression of (A) GSS, (B) GPX1 and (C) GPX4. Data are shown as mean ± SEM. Statistical significance was determined using three-way ANOVA. * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001, **** p ≤ 0.0001, ns: not significant.
Antioxidants 15 00241 g006
Antioxidants 15 00241 g007
Figure 7. The mRNA expression of oxidative stress-related genes. Control and knockdown hMSCs (n = 2) were treated with H2O2, the antioxidant Trolox, H2O2 in addition to Trolox or were left untreated for 72 h. Cells were lysed and qRT-PCR was used to measure the mRNA expression of (A) CAT and (B) TRAP1. Data are shown as mean ± SEM. Statistical significance was determined using three-way ANOVA. * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001, **** p ≤ 0.0001, ns: not significant.
Figure 7. The mRNA expression of oxidative stress-related genes. Control and knockdown hMSCs (n = 2) were treated with H2O2, the antioxidant Trolox, H2O2 in addition to Trolox or were left untreated for 72 h. Cells were lysed and qRT-PCR was used to measure the mRNA expression of (A) CAT and (B) TRAP1. Data are shown as mean ± SEM. Statistical significance was determined using three-way ANOVA. * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001, **** p ≤ 0.0001, ns: not significant.
Antioxidants 15 00241 g007
Table 1. Denotation and characteristics of the hMSCs used in this study.
Table 1. Denotation and characteristics of the hMSCs used in this study.
DenotationSexAgeLot
hMSC-fFemale66451Z012.3
hMSC-mMale68467Z023.5
Table 2. Different fluorescent probes.
Table 2. Different fluorescent probes.
Fluorescent ProbeAbbreviationWorking Concentration [µM]Incubation Time [min]
Carboxy-H2DCFDA (6-Carboxy-2’,7’-Dichlordihydrofluorescein-Diacetat)DCFDA1060
DAF-FM Diacetate (4-Amino-5-Methylamino-2’,7’-Difluorofluorescein Diacetate)DAF-FM1060
Table 3. Primary antibodies used in this study. Target protein, host species, dilution and manufacturer are included.
Table 3. Primary antibodies used in this study. Target protein, host species, dilution and manufacturer are included.
TargetHost SpeciesDilutionManufacturer
p21Rabbit1:200ab109520
Abcam, Cambridge, MA, USA
p53Mouse1:400sc-126
Santa Cruz, Dallas, TX, USA
4-HNEMouse1:50XG3647431
Invitrogen, Carlsbad, CA, USA
Table 4. Composition of the lysis buffer used for the β-galactosidase assay. Benzamidine and PMSF were added right before performing lysis.
Table 4. Composition of the lysis buffer used for the β-galactosidase assay. Benzamidine and PMSF were added right before performing lysis.
ComponentConcentration [mM]
3-[(3-Cholamidopropyl)dimethylammonio]-1-propanesulfonate (CHAPS)5
Citric acid40
Sodium phosphate40
Benzamidine0.5
Phenylmethanesulfonyl fluoride (PMSF)0.25
Water ad. 15 mL
Table 5. Composition of the 2× reaction buffer used for the β-galactosidase assay. The fluorogenic substrate MUG was dissolved in dimethyl sulfoxide (DMSO) at a concentration of 34 mM.
Table 5. Composition of the 2× reaction buffer used for the β-galactosidase assay. The fluorogenic substrate MUG was dissolved in dimethyl sulfoxide (DMSO) at a concentration of 34 mM.
ComponentConcentration/mM
Citric acid40
Sodium phosphate40
Sodium chloride300
β-mercaptoethanol10
Magnesium chloride4
4-methylumbelliferyl-β-D-galactopyranoside (MUG)1.7
Water ad. 50 mL
Table 6. Primers used for qRT-PCR in this study.
Table 6. Primers used for qRT-PCR in this study.
Gene5’-3’ SequenceAnnealing TemperatureEfficiency
CATAAACCGCACGCTATGGCTGA
AAAGTAGCCAAAGGCCCCTGC		631.99
GPX1TGGCCTCCCCTTACAGTGCT
TCTTGGCGTTCTCCTGATGCC		662.00
GPX4TCCCAGTGAGGCAAGACCGA
AGAGACGGTGTCCAAACTTGGTG		662.00
GSSTCGCGGAGGAAAGGCGAAC
GCGATTCAGGCCCAGGAACA		631.90
p21GCAGACCAGCATGACAGATTTC
ACCTCCGGGAGAGAGGAAAA		661.81
p53AGATAGCGATGGTCTGGC
TTGGGCAGTGCTCGCTTAGT		632.00
RPL13ACGGAAGGTGGTGGTCGTA
CTCGGGAAGGGTTGGTGT		631.87
SDHAAACTCGCTCTTGGACCTG
GAGTCGCAGTTCCGATGT		631.93
SIRT2ATCCCCGACTTTCGCTCTC
GGTTGGCTTGAACTGCCCA		661.86
SIRT3CCTCTGCCACCTGCACAGTC
TGGGGGCAGCCATCATCCTA		631.93
SIRT6TGCGAGCCTGCAGGGGAGA
CAGCGATGTACCCAGCGTGATG		631.77
SIRT7GGTCGTCTACACAGGCGCGG
TCCCTGTTGGGAACGCAGGA		631.86
TRAP1GTGCCGGGAGGAAAACCAA
TGTTTGGAAGTGGAACCCTGC		662.00
β2MTGTGCTCGCGCTACTCTCTCTT
CGGATGGATGAAACCCAGACA		631.85
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Osterhage, M.R.; Knabbe, C.; Hendig, D. Loss of ABCC6 in Human Mesenchymal Stem Cells Leads to Elevated Reactive Oxygen Species Formation and a Senescence-like Phenotype. Antioxidants 2026, 15, 241. https://doi.org/10.3390/antiox15020241

AMA Style

Osterhage MR, Knabbe C, Hendig D. Loss of ABCC6 in Human Mesenchymal Stem Cells Leads to Elevated Reactive Oxygen Species Formation and a Senescence-like Phenotype. Antioxidants. 2026; 15(2):241. https://doi.org/10.3390/antiox15020241

Chicago/Turabian Style

Osterhage, Michel R., Cornelius Knabbe, and Doris Hendig. 2026. "Loss of ABCC6 in Human Mesenchymal Stem Cells Leads to Elevated Reactive Oxygen Species Formation and a Senescence-like Phenotype" Antioxidants 15, no. 2: 241. https://doi.org/10.3390/antiox15020241

APA Style

Osterhage, M. R., Knabbe, C., & Hendig, D. (2026). Loss of ABCC6 in Human Mesenchymal Stem Cells Leads to Elevated Reactive Oxygen Species Formation and a Senescence-like Phenotype. Antioxidants, 15(2), 241. https://doi.org/10.3390/antiox15020241

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop