Coptidis Rhizoma Alkaloids Alleviate Acetaminophen-Induced Liver Injury by Regulating GSH Metabolism and the TNF Signaling Pathway
Abstract
1. Introduction
2. Materials and Methods
2.1. Drugs and Reagents
2.2. Preparation of CRA
2.3. Cell Culture and Treatment
2.4. Untargeted Metabolomics Analysis
2.5. UHPLC-MS/MS Analysis of CRA
2.6. Network Pharmacological Analysis
2.7. Immunofluorescence Staining
2.8. Animals and Treatments
2.9. Histopathological Analysis of Liver Injury
2.10. Quantitative Real-Time PCR (qRT-PCR) Analysis
2.11. Western Blotting Analysis
2.12. Statistical Analysis
3. Results
3.1. Metabolomics Analysis Indicated That CRA Influenced the GSH Metabolism Pathway
3.2. Identification of Phytochemical Compounds in CRA
3.3. Network Pharmacological Analysis Revealed That CRA Modulated the TNF Signaling Pathway
3.4. CRA Mitigated APAP-Induced Oxidative Stress by Promoting GSH Synthesis in Cells
3.5. CRA Ameliorated APAP-Induced Inflammatory Responses by Regulating the TNF Signaling Pathway in Cells
3.6. CRA Alleviated APAP-Induced Liver Injury In Vivo

3.7. CRA Exerted Antioxidant Effects by Promoting GSH Synthesis In Vivo
3.8. CRAs Exert Anti-Inflammatory Effects by Modulating the TNF Signaling Pathway In Vivo
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
| ALT | Alanine aminotransferase |
| APAP | Acetaminophen |
| AST | Aspartate aminotransferase |
| BP | Biological processes |
| CAT | Catalase |
| CC | Cellular components |
| CR | Coptidis Rhizoma |
| CRAs | Coptidis Rhizoma alkaloids |
| CTD | Comparative toxicogenomic database |
| DAMPs | Damage-associated molecular patterns |
| DILI | Drug-induced liver injury |
| Glu | Glutamate |
| GSH | Glutathione |
| GPX1 | Glutathione peroxidase 1 |
| GSR | Glutathione reductase |
| GSS | Glutathione synthetase |
| GSTM1 | Glutathione S-transferase Mu 1 |
| IL-1β | Interleukin 1 beta |
| IL-6 | Interleukin 6 |
| L-Cys | L-cysteine |
| MDA | Malondialdehyde |
| MF | Molecular functions |
| MPO | Myeloperoxidase |
| NAC | N-acetylcysteine |
| NAPQI | N-acetyl-p-quinone imine |
| PPARγ | Peroxisome proliferator-activated receptor gamma |
| PRDX1 | Peroxiredoxin-1 |
| PRDX2 | Peroxiredoxin-2 |
| qRT-PCR | quantitative real-time PCR |
| ROS | Reactive oxygen species |
| TCM | Traditional Chinese medicine |
| TCMSP | Traditional Chinese medicine systems pharmacology |
| TNF | Tumor necrosis factor |
| γ-Glu-Cys | γ-L-Glutamyl-L-cysteine |
References
- Zhao, M.; Ma, J.; Li, M.; Zhang, Y.; Jiang, B.; Zhao, X.; Huai, C.; Shen, L.; Zhang, N.; He, L.; et al. Cytochrome P450 Enzymes and Drug Metabolism in Humans. Int. J. Mol. Sci. 2021, 22, 12808. [Google Scholar] [CrossRef] [Scilit]
- Liu, J.; Zhang, Y.; Wu, H.; Yang, P.; Wang, W.; Li, C.; Cao, H.; Wu, J.; Sun, X. Chelerythrine Protects Against Acetaminophen-Induced Acute Liver Injury: Insights from Gut Microbiota and Multi-Omics Analysis. Antioxidants 2025, 14, 1063. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sahu, P.; Satapathy, T. Bioactive Herbs for Liver Disorders: A Phyto-Pharmacological Review. Curr. Drug Metab. 2025, 25, 523–547. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, X.; Tang, J.; Mao, Y. Incidence and risk factors of drug-induced liver injury. Liver Int. 2022, 42, 1999–2014. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bao, Y.; Phan, M.; Zhu, J.; Ma, X.; Manautou, J.E.; Zhong, X.-B. Alterations of Cytochrome P450–Mediated Drug Metabolism during Liver Repair and Regeneration after Acetaminophen-Induced Liver Injury in Mice. Drug Metab. Dispos. 2022, 50, 694–703. [Google Scholar] [CrossRef] [Scilit]
- Dannesboe, J.; Bastrup, J.A.; Nielsen, K.H.; Munck, P.; Thomsen, M.B.; Hawkins, C.L.; Jepps, T.A. Paracetamol metabolism by endothelial cells—Potential mechanism underlying intravenous paracetamol-induced hypotension. Pharmacol. Res. 2025, 211, 107540. [Google Scholar] [CrossRef] [Scilit]
- Fang, Z.; Xu, Y.; Liu, G.; Shao, Q.; Niu, X.; Tai, W.; Shen, T.; Fan, M.; Chen, M.; Lei, L.; et al. Narirutin activates TFEB (transcription factor EB) to protect against Acetaminophen-induced liver injury by targeting PPP3/calcineurin. Autophagy 2023, 19, 2240–2256. [Google Scholar] [CrossRef] [Scilit]
- Zhao, J.; Zhao, Y.; Song, S.; Zhang, S.; Yang, G.; Qiu, Y.; Tian, W. Gallic Acid Alleviates Acetaminophen-Induced Acute Liver Injury by Regulating Inflammatory and Oxidative Stress Signaling Proteins. Antioxidants 2025, 14, 860. [Google Scholar] [CrossRef] [Scilit]
- Ohashi, N.; Kohno, T. Analgesic Effect of Acetaminophen: A Review of Known and Novel Mechanisms of Action. Front. Pharmacol. 2020, 11, 580289. [Google Scholar] [CrossRef] [Scilit]
- Jiang, X.; Wu, B.; Xie, L.; Li, H.; Chen, C.; Huang, P.; Chen, X.; Zhu, Q.; Wang, H.; Hu, C. Targeting fatty acid metabolism in hepatic macrophages mitigates acetaminophen-induced liver injury and promotes regeneration in mice. Hepatol. Commun. 2026, 10, e0865. [Google Scholar] [CrossRef] [Scilit]
- Liou, G.-G.; Hsieh, C.-C.; Lee, Y.-J.; Li, P.-H.; Tsai, M.-S.; Li, C.-T.; Wang, S.-H. N-Acetyl Cysteine Overdose Inducing Hepatic Steatosis and Systemic Inflammation in Both Propacetamol-Induced Hepatotoxic and Normal Mice. Antioxidants 2021, 10, 442. [Google Scholar] [CrossRef] [Scilit]
- Licata, A.; Minissale, M.G.; Stankevičiūtė, S.; Sanabria-Cabrera, J.; Lucena, M.I.; Andrade, R.J.; Almasio, P.L. N-Acetylcysteine for Preventing Acetaminophen-Induced Liver Injury: A Comprehensive Review. Front. Pharmacol. 2022, 13, 828565. [Google Scholar] [CrossRef] [Scilit]
- Jaeschke, H.; Ramachandran, A. Acetaminophen Hepatotoxicity: Paradigm for Understanding Mechanisms of Drug-Induced Liver Injury. Annu. Rev. Pathol. 2024, 19, 453–478. [Google Scholar] [CrossRef] [Scilit]
- Guo, M.; Fu, W.; Zhang, X.; Li, T.; Ma, W.; Wang, H.; Wang, X.; Feng, S.; Sun, H.; Zhang, Z.; et al. Total flavonoids extracted from the leaves of Murraya paniculata (L.) Jack prevents acetaminophen-induced liver injury by activating Keap1/Nrf2 and PI3K/AKT/mTOR signaling pathway. J. Ethnopharmacol. 2025, 344, 119562. [Google Scholar] [CrossRef] [Scilit]
- Cui, W.; Cao, Q.; Liu, L.; Yin, X.; Wang, X.; Zhao, Y.; Wang, Y.; Wei, B.; Xu, X.; Tang, Y. Artemisia Argyi essential oil ameliorates acetaminophen-induced hepatotoxicity via CYP2E1 and γ-glutamyl cycle reprogramming. Phytomedicine 2024, 135, 156106. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, Q.; Zhang, W.; Cheng, N.; Zhu, Y.; Li, H.; Zhang, S.; Guo, W.; Ge, G. Pectolinarigenin ameliorates acetaminophen-induced acute liver injury via attenuating oxidative stress and inflammatory response in Nrf2 and PPARa dependent manners. Phytomedicine 2023, 113, 154726. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, S.; Zhang, Y.; Wen, Z.; Chen, Y.; Bu, T.; Yang, Y.; Ni, Q. Enhancing β-cell function and identity in type 2 diabetes: The protective role of Coptis deltoidea C. Y. Cheng et Hsiao via glucose metabolism modulation and AMPK signaling activation. Phytomedicine 2024, 128, 155396. [Google Scholar] [CrossRef] [Scilit]
- Xie, Q.; Chen, J.; Yang, H.; Liang, J.; Ma, R.; Guo, J.; Zeng, X. A Comprehensive Review of Coptidis Rhizoma and Magnoliae Officinalis Cortex Drug Pair and Their Chemical Composition, Pharmacological Effects and Pharmacokinetics Analysis. Drug Des. Dev. Ther. 2024, 18, 4413–4426. [Google Scholar] [CrossRef] [Scilit]
- Wu, Z.; Yang, W.; Wu, T.; Liu, Y.; Pu, Y.; Hu, W.; Jiang, Y.; Zhang, J.; Zhu, H.; Li, X.; et al. Long term Coptidis Rhizoma intake induce gastrointestinal emptying inhibition and colon barrier weaken via bitter taste receptors activation in mice. Phytomedicine 2025, 136, 156292. [Google Scholar] [CrossRef] [Scilit]
- Zhang, H.Y.; Wang, H.L.; Zhong, G.Y.; Zhu, J.X. Molecular mechanism and research progress on pharmacology of traditional Chinese medicine in liver injury. Pharm. Biol. 2018, 56, 594–611. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, J.; Wang, L.; Lou, G.H.; Zeng, H.R.; Hu, J.; Huang, Q.W.; Peng, W.; Yang, X.B. Coptidis Rhizoma: A comprehensive review of its traditional uses, botany, phytochemistry, pharmacology and toxicology. Pharm. Biol. 2019, 57, 193–225. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, G.; Zhang, C.; Zou, J.; Zhou, Z.; Zhang, J.; Yan, Y.; Liang, Y.; Tang, G.; Chen, G.; Xu, X.; et al. Coptidis rhizoma and berberine as anti-cancer drugs: A 10-year updates and future perspectives. Pharmacol. Res. 2025, 216, 107742. [Google Scholar] [CrossRef] [Scilit]
- Ye, X.; Feng, Y.; Tong, Y.; Ng, K.-M.; Tsao, S.; Lau, G.K.K.; Sze, C.; Zhang, Y.; Tang, J.; Shen, J.; et al. Hepatoprotective effects of Coptidis rhizoma aqueous extract on carbon tetrachloride-induced acute liver hepatotoxicity in rats. J. Ethnopharmacol. 2009, 124, 130–136. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Feng, Y.; Wang, N.; Ye, X.; Li, H.; Feng, Y.; Cheung, F.; Nagamatsu, T. Hepatoprotective effect and its possible mechanism of Coptidis rhizoma aqueous extract on carbon tetrachloride-induced chronic liver hepatotoxicity in rats. J. Ethnopharmacol. 2011, 138, 683–690. [Google Scholar] [CrossRef] [Scilit]
- Meng, X.; Tang, G.-Y.; Liu, P.-H.; Zhao, C.-J.; Liu, Q.; Li, H.-B. Antioxidant activity and hepatoprotective effect of 10 medicinal herbs on CCl4-induced liver injury in mice. World J. Gastroenterol. 2020, 26, 5629–5645. [Google Scholar] [CrossRef] [Scilit]
- Yousefi-Manesh, H.; Shirooie, S.; Partoazar, A.; Nikoui, V.; Estakhri, M.R.A.; Bakhtiarian, A. Hepatoprotective effects of phosphatidylserine liposomes on carbon tetrachloride-induced hepatotoxicity in rats. J. Cell. Biochem. 2019, 120, 11853–11858. [Google Scholar] [CrossRef] [Scilit]
- Ma, X.; Zhang, Y.; Wang, Z.; Shen, Y.; Zhang, M.; Nie, Q.; Hou, Y.; Bai, G. Ursolic Acid, a Natural Nutraceutical Agent, Targets Caspase3 and Alleviates Inflammation-Associated Downstream Signal Transduction. Mol. Nutr. Food Res. 2017, 61, 1700332. [Google Scholar] [CrossRef] [Scilit]
- Teng, H.; Choi, Y.H. Optimization of ultrasonic-assisted extraction of bioactive alkaloid compounds from rhizoma coptidis (Coptis chinensis Franch.) using response surface methodology. Food Chem. 2014, 142, 299–305. [Google Scholar] [CrossRef] [Scilit]
- Wang, X.; Liu, J.; Zhang, X.; Zhao, S.; Zou, K.; Xie, J.; Wang, X.; Liu, C.; Wang, J.; Wang, Y. Seabuckthorn berry polysaccharide extracts protect against acetaminophen induced hepatotoxicity in mice via activating the Nrf-2/HO-1-SOD-2 signaling pathway. Phytomedicine 2018, 38, 90–97. [Google Scholar] [CrossRef] [Scilit]
- Xu, X.-Y.; Wang, Z.; Ren, S.; Leng, J.; Hu, J.-N.; Liu, Z.; Chen, C.; Li, W. Improved protective effects of American ginseng berry against acetaminophen-induced liver toxicity through TNF-α-mediated caspase-3/-8/-9 signaling pathways. Phytomedicine 2018, 51, 128–138. [Google Scholar] [CrossRef] [Scilit]
- Kim, S.H.; Choi, H.J.; Seo, H.; Kwon, D.; Yun, J.; Jung, Y.-S. Downregulation of Glutathione-Mediated Detoxification Capacity by Binge Drinking Aggravates Acetaminophen-Induced Liver Injury through IRE1α ER Stress Signaling. Antioxidants 2021, 10, 1949. [Google Scholar] [CrossRef] [Scilit]
- Lin, W.; Gu, B.; Gu, Y.; Zhao, R.; Huang, Y.; Fan, R.; Rong, W.; Liu, Z. Taraxasterol protects against acetaminophen-induced hepatotoxicity by reducing liver inflammatory response and ameliorating oxidative stress in mice. Int. Immunopharmacol. 2024, 138, 112580. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Björnsson, E.S. The Epidemiology of Newly Recognized Causes of Drug-Induced Liver Injury: An Update. Pharmaceuticals 2024, 17, 520. [Google Scholar] [CrossRef] [Scilit]
- Hionides-Gutierrez, A.; Goikoetxea-Usandizaga, N.; Sanz-García, C.; Martínez-Chantar, M.L.; Cubero, F.J. Novel Emerging Mechanisms in Acetaminophen (APAP) Hepatotoxicity. Liver Int. 2024, 45, e16167. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lucena, M.I.; Villanueva-Paz, M.; Alvarez-Alvarez, I.; Aithal, G.P.; Björnsson, E.S.; Cakan-Akdogan, G.; Cubero, F.J.; Esteves, F.; Falcon-Perez, J.M.; Fromenty, B.; et al. Roadmap to DILI research in Europe. A proposal from COST action ProEuroDILINet. Pharmacol. Res. 2024, 200, 107046. [Google Scholar] [CrossRef] [Scilit]
- McGill, M.R.; Jaeschke, H. Biomarkers of drug-induced liver injury: Progress and utility in research, medicine, and regulation. Expert Rev. Mol. Diagn. 2018, 18, 797–807. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Meng, F.-C.; Wu, Z.-F.; Yin, Z.-Q.; Lin, L.-G.; Wang, R.; Zhang, Q.-W. Coptidis rhizoma and its main bioactive components: Recent advances in chemical investigation, quality evaluation and pharmacological activity. Chin. Med. 2018, 13, 13. [Google Scholar] [CrossRef] [Scilit]
- Su, G.; Wang, H.; Gao, Y.; Chen, G.; Pei, Y.; Bai, J. 1H-NMR-Based Metabonomics of the Protective Effect of Coptis chinensis and Berberine on Cinnabar-Induced Hepatotoxicity and Nephrotoxicity in Rats. Molecules 2017, 22, 1855. [Google Scholar] [CrossRef] [Scilit]
- Du, K.; Ramachandran, A.; Jaeschke, H. Oxidative stress during acetaminophen hepatotoxicity: Sources, pathophysiological role and therapeutic potential. Redox Biol. 2016, 10, 148–156. [Google Scholar] [CrossRef] [Scilit]
- Xing, R.; Liu, R.; Man, Y.; Liu, C.; Zhang, Y.; Gao, H.; Yang, W. MAPK13 phosphorylates PHGDH and promotes its degradation via chaperone-mediated autophagy during liver injury. Cell Discov. 2025, 11, 15. [Google Scholar] [CrossRef] [Scilit]
- Han, Y.K.; Kim, J.S.; Jang, G.; Park, K.M. Cisplatin induces lung cell cilia disruption and lung damage via oxidative stress. Free Radic. Biol. Med. 2021, 177, 270–277. [Google Scholar] [CrossRef] [Scilit]
- Ramalingam, A.; Budin, S.B.; Mohd Fauzi, N.; Ritchie, R.H.; Zainalabidin, S. Targeting mitochondrial reactive oxygen species-mediated oxidative stress attenuates nicotine-induced cardiac remodeling and dysfunction. Sci. Rep. 2021, 11, 13845. [Google Scholar] [CrossRef] [Scilit]
- Wang, R.; Zhao, Y.; Zhou, L.; Lin, F.; Wan, M.; Gan, A.; Wu, B.; Yan, T.; Jia, Y. Costunolide ameliorates MNNG-induced chronic atrophic gastritis through inhibiting oxidative stress and DNA damage via activation of Nrf2. Phytomedicine 2024, 130, 155581. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shi, Y.; Xu, N.; Liu, B.; Ma, Y.; Fu, X.; Shang, Y.; Huang, Q.; Yao, Q.; Chen, J.; Li, H. Mifepristone protects acetaminophen induced liver injury through NRF2/GSH/GST mediated ferroptosis suppression. Free Radic. Biol. Med. 2024, 222, 229–243. [Google Scholar] [CrossRef] [Scilit]
- Guo, Y.; Chen, Y.; Tan, Z.R.; Klaassen, C.D.; Zhou, H.H. Repeated administration of berberine inhibits cytochromes P450 in humans. Eur. J. Clin. Pharmacol. 2012, 68, 213–217. [Google Scholar] [CrossRef] [Scilit]
- Bathaei, P.; Imenshahidi, M.; Hosseinzadeh, H. Effects of Berberis vulgaris, and its active constituent berberine on cytochrome P450: A review. Naunyn Schmiedebergs Arch. Pharmacol. 2025, 398, 179–202. [Google Scholar] [CrossRef] [Scilit]
- Rom, O.; Liu, Y.; Finney, A.C.; Ghrayeb, A.; Zhao, Y.; Shukha, Y.; Wang, L.; Rajanayake, K.K.; Das, S.; Rashdan, N.A.; et al. Induction of glutathione biosynthesis by glycine-based treatment mitigates atherosclerosis. Redox Biol. 2022, 52, 102313. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, L.H.; Tang, M.; Tao, X.; Shao, Q.; Thomas, V.; Shimizu, S.; Kasano, M.; Ishikawa, Y.; Inukai, T.; Nomura, D.K. Covalent Targeting of Glutamate Cysteine Ligase to Inhibit Glutathione Synthesis. ChemBioChem 2023, 24, e202300371. [Google Scholar] [CrossRef] [Scilit]
- Vairetti, M.; Di Pasqua, L.G.; Cagna, M.; Richelmi, P.; Ferrigno, A.; Berardo, C. Changes in Glutathione Content in Liver Diseases: An Update. Antioxidants 2021, 10, 364. [Google Scholar] [CrossRef] [Scilit]
- Asantewaa, G.; Tuttle, E.T.; Ward, N.P.; Kang, Y.P.; Kim, Y.; Kavanagh, M.E.; Girnius, N.; Chen, Y.; Rodriguez, K.; Hecht, F.; et al. Glutathione synthesis in the mouse liver supports lipid abundance through NRF2 repression. Nat. Commun. 2024, 15, 6152. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lai, W.; Zhou, S.; Bai, Y.; Che, Q.; Cao, H.; Guo, J.; Su, Z. Glucosamine attenuates alcohol-induced acute liver injury via inhibiting oxidative stress and inflammation. Curr. Res. Food Sci. 2024, 8, 100699. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mao, J.; Zhan, H.; Meng, F.; Wang, G.; Huang, D.; Liao, Z.; Chen, M. Costunolide protects against alcohol-induced liver injury by regulating gut microbiota, oxidative stress and attenuating inflammation in vivo and in vitro. Phytother. Res. 2022, 36, 1268–1283. [Google Scholar] [CrossRef] [Scilit]
- Li, Y.; Yang, X.; Li, X.; Wang, S.; Chen, P.; Ma, T.; Zhang, B. Astragaloside IV and cycloastragenol promote liver regeneration through regulation of hepatic oxidative homeostasis and glucose/lipid metabolism. Phytomedicine 2024, 135, 156165. [Google Scholar] [CrossRef] [Scilit]
- He, J.; Chen, L.; Wang, P.; Cen, B.; Li, J.; Wei, Y.; Yao, X.; Xu, Z. Network pharmacology and experimental validation of effects of total saponins extracted from Abrus cantoniensis Hance on acetaminophen-induced liver injury. J. Ethnopharmacol. 2024, 324, 117740. [Google Scholar] [CrossRef] [Scilit]
- Liu, A.; Walter, M.; Wright, P.; Bartosik, A.; Dolciami, D.; Elbasir, A.; Yang, H.; Bender, A. Prediction and mechanistic analysis of drug-induced liver injury (DILI) based on chemical structure. Biol. Direct 2021, 16, 6. [Google Scholar] [CrossRef] [Scilit]
- Raevens, S.; Van Campenhout, S.; Debacker, P.-J.; Lefere, S.; Verhelst, X.; Geerts, A.; Van Vlierberghe, H.; Colle, I.; Devisscher, L. Combination of sivelestat and N-acetylcysteine alleviates the inflammatory response and exceeds standard treatment for acetaminophen-induced liver injury. J. Leukoc. Biol. 2020, 107, 341–355. [Google Scholar] [CrossRef] [Scilit]
- Wang, Z.; Hao, W.; Hu, J.; Mi, X.; Han, Y.; Ren, S.; Jiang, S.; Wang, Y.; Li, X.; Li, W. Maltol Improves APAP-Induced Hepatotoxicity by Inhibiting Oxidative Stress and Inflammation Response via NF-κB and PI3K/Akt Signal Pathways. Antioxidants 2019, 8, 395. [Google Scholar] [CrossRef] [Scilit]
- Zhang, T.; Zhong, Y.; Shi, Y.; Feng, C.; Xu, L.; Chen, Z.; Sun, X.; Zhao, Y.; Sun, X. Multi-omics reveals that 5-O-methylvisammioside prevention acute liver injury in mice by regulating the TNF/MAPK/NF-κB/arachidonic acid pathway. Phytomedicine 2024, 128, 155550. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shen, X.; Ishaq, S.M.; Wang, Q.; Yuan, J.; Gao, J.; Lu, Z. DDAH1 Protects against Acetaminophen-Induced Liver Hepatoxicity in Mice. Antioxidants 2022, 11, 880. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, X.; Sun, R.; Liu, R. Natural products in licorice for the therapy of liver diseases: Progress and future opportunities. Pharmacol. Res. 2019, 144, 210–226. [Google Scholar] [CrossRef] [Scilit]
- Rani, J.; Dhull, S.B.; Rose, P.K.; Kidwai, M.K. Drug-induced liver injury and anti-hepatotoxic effect of herbal compounds: A metabolic mechanism perspective. Phytomedicine 2024, 122, 155142. [Google Scholar] [CrossRef] [Scilit]
- Sun, Y.-K.; Zhang, Y.-F.; Xie, L.; Rong, F.; Zhu, X.-Y.; Xie, J.; Zhou, H.; Xu, T. Progress in the treatment of drug-induced liver injury with natural products. Pharmacol. Res. 2022, 183, 106361. [Google Scholar] [CrossRef] [Scilit]
- Liao, A.; Han, M.; Chen, S.; Gao, C.; Wei, W.; Li, J.; Du, K.; Chang, Y. A Comprehensive Review on Botany, Ethnopharmacology, Phytochemistry, Biosynthesis, Pharmacology, Toxicity, Quality Control and Metabolomics of Coptidis Rhizome. Am. J. Chin. Med. 2025, 53, 1711–1754. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jaeschke, H.; Xie, Y.; McGill, M.R. Acetaminophen-induced Liver Injury: From Animal Models to Humans. J. Clin. Transl. Hepatol. 2014, 2, 153–161. [Google Scholar] [CrossRef] [Scilit] [PubMed]







| Gene | Forward Primer (5′–3′) | Reverse Primer (5′–3′) | GenBank Number | Reference |
|---|---|---|---|---|
| h-GAPDH | GTCTCCTCTGACTTCAACAGCG | ACCACCCTGTTGCTGTAGCCAA | NM_001357943.2 | [16] |
| h-TNF- | CTTCCAGCTGGAGAAGGGTG | CCCAAAGTAGACCTGCCCAG | NM_000594.4 | |
| h-IL-6 | AGTGAGGAACAAGCCAGAGC | GGTCAGGGGTGGTTATTGCA | NM_000600.5 | |
| h-IL-1 | CCACCTCCAGGGACAGGATA | TCAACACGCAGGACAGGTAC | NM_000576.3 | |
| m-GAPDH | TCAGGAGAGTGTTTCCTCGTC | CCGTTGAATTTGCCGTGAGT | NM_001289726.2 | [16] |
| m-TNF- | CTGGGACAGTGACCTGGACT | GCACCTCAGGGAAGAGTCTG | Y00467.1 | [16] |
| m-IL-6 | TAGTCCTTCCTACCCCAATTTCC | TTGGTCCTTAGCCACTCCTTC | NM_031168.2 | [16] |
| m-IL-1 | GCAACTGTTCCTGAACTCAACT | ATCTTTTGGGGTCCGTCAACT | NM_008361.4 | [16] |
| No. | Molecule Name | Molecular Formula | RT (Min) | Calculated Mass | Measured Mass | Mass Error (ppm) | Adducts | MS/MS |
|---|---|---|---|---|---|---|---|---|
| 1 | Magnoflorine | C20H23NO4 | 3.21 | 342.4080 | 342.1696 | −1.08 | [M + H]+ | 91.05422, 297.1116, 265.0857, 237.0915, 282.0877 |
| 2 | 8-Oxocoptisine | C19H13NO5 | 3.83 | 335.310 | 336.0865 | −0.15 | [M + H]+ | 336.0863, 308.0911, 293.0681 |
| 3 | Demethyleneberberine | C19H18NO4+ | 4.06 | 323.3430 | 324.1229 | −0.43 | [M]+ | 309.0994, 308.0905, 294.0762, 280.0961 |
| 4 | D-tetrahydropalmatine | C21H25NO4 | 4.18 | 355.4280 | 356.1857 | 0.10 | [M + H]+ | 192.1026, 356.1848, 165.0547 |
| 5 | Protopine | C20H19NO5 | 5.17 | 353.3690 | 354.1336 | 0.31 | [M + H]+ | 354.1333, 339.1468, 188.0707, 189.0783, 165.0547 |
| 6 | 13-Methylberberine | C21H20NO4+ | 5.88 | 350.3880 | 350.1388 | 0.71 | [M]+ | 335.1141, 334.1082, 306.1122, 320.0910 |
| 7 | Coptisine | C19H14NO4+ | 6.54 | 320.3200 | 320.0916 | −0.19 | [M]+ | 320.0917, 292.0967, 318.0757, 277.0736, 262.0862 |
| 8 | Epiberberine | C20H17NO4+ | 6.76 | 336.3600 | 336.1228 | −0.78 | [M]+ | 336.1227, 320.0916, 321.0973, 292.0962, |
| 9 | Jatrorrhizine | C20H20NO4+ | 7.03 | 338.3770 | 338.1383 | −0.86 | [M]+ | 323.1137, 322.1071, 294.1121, 308.0911 |
| 10 | 8-Oxyepiberberine | C20H17NO5 | 7.32 | 351.3530 | 352.1177 | −0.69 | [M + H]+ | 352.1186, 336.0871, 308.0924, 280.1871 |
| 11 | Berberrubine | C19H16NO4+ | 7.58 | 322.3350 | 322.1072 | −0.74 | [M]+ | 322.1072, 307.0837, 279.0888, 278.0824 |
| 12 | Canadine | C20H21NO4 | 7.92 | 339.3850 | 340.1541 | −0.86 | [M + H]+ | 176.0710, 338.1384, 323.1145, 308.0922 |
| 13 | Berberine | C20H18NO4 | 8.93 | 336.3610 | 336.1228 | −0.68 | [M]+ | 321.0992, 292.0966, 322.1028, 306.0768, 304.0971 |
| 14 | Palmatine | C21H22NO4+ | 9.56 | 352.4030 | 352.1541 | −0.60 | [M]+ | 352.1543, 336.1231, 337.1298, 308.1281, 322.1075 |
| 15 | Dihydropalmatine | C21H23NO4 | 10.14 | 353.4120 | 354.1696 | −1.04 | [M + H]+ | 338.1335, 322.1069, 323.1123, 354.1623 |
| 16 | Berberastine | C20H18NO5+ | 10.41 | 352.3610 | 352.1186 | 1.68 | [M + H]+ | 336.1234, 308.0916, 337.0936 |
| 17 | Dehydrocorydaline | C22H24NO4+ | 10.98 | 366.1699 | 366.4300 | 0.22 | [M]+ | 350.1382, 366.1699, 351.1452, 308.1267, 322.1432 |
| 18 | 8-Oxyberberine | C20H17NO5 | 12.92 | 351.3530 | 352.1178 | −0.55 | [M + H]+ | 322.0708, 337.0943, 308.0914, 336.0863 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Ma, X.; Rao, J.; Li, X.; Li, Z.; Lu, X.; Lu, Y.; Guo, J.; Feng, B. Coptidis Rhizoma Alkaloids Alleviate Acetaminophen-Induced Liver Injury by Regulating GSH Metabolism and the TNF Signaling Pathway. Antioxidants 2026, 15, 223. https://doi.org/10.3390/antiox15020223
Ma X, Rao J, Li X, Li Z, Lu X, Lu Y, Guo J, Feng B. Coptidis Rhizoma Alkaloids Alleviate Acetaminophen-Induced Liver Injury by Regulating GSH Metabolism and the TNF Signaling Pathway. Antioxidants. 2026; 15(2):223. https://doi.org/10.3390/antiox15020223
Chicago/Turabian StyleMa, Xiaoyao, Jiali Rao, Xuefei Li, Zibin Li, Xuan Lu, Yujie Lu, Juan Guo, and Baomin Feng. 2026. "Coptidis Rhizoma Alkaloids Alleviate Acetaminophen-Induced Liver Injury by Regulating GSH Metabolism and the TNF Signaling Pathway" Antioxidants 15, no. 2: 223. https://doi.org/10.3390/antiox15020223
APA StyleMa, X., Rao, J., Li, X., Li, Z., Lu, X., Lu, Y., Guo, J., & Feng, B. (2026). Coptidis Rhizoma Alkaloids Alleviate Acetaminophen-Induced Liver Injury by Regulating GSH Metabolism and the TNF Signaling Pathway. Antioxidants, 15(2), 223. https://doi.org/10.3390/antiox15020223
