Next Article in Journal
Valorization of Onion-Processing Waste: Digestive Fate, Bioavailability, and Cellular Antioxidant Properties of Red and Yellow Peels Polyphenols
Previous Article in Journal
Dietary Red and Grey Selenium Nanoparticles: Effects on Tissue Selenium Distribution, Antioxidant Capacity, and Retention in Japanese Quails
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Antioxidants
Volume 15
Issue 1
10.3390/antiox15010006
antioxidants-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Itaconic Acid Activates Lysosomal Biogenesis and Autophagy Flux and Mitigates High-Fat Diet-Induced Liver Lipid Accumulation in Largemouth Bass (Micropterus salmoides)

by
Xue Li
1,2,
Shidong Wang
3,
Muzi Zhang
1,2,
Ming Li
4 and
Chao Chen
1,2,*
1
Key Laboratory of Animal Genetics, Breeding and Reproduction in the Plateau Mountainous Region, Ministry of Education, Guizhou University, Guiyang 550025, China
2
College of Animal Science, Guizhou University, Guiyang 550025, China
3
College of Biosystems Engineering and Food Science, Zhejiang University, Hangzhou 310058, China
4
School of Marine Sciences, Ningbo University, Ningbo 315211, China
*
Author to whom correspondence should be addressed.
Antioxidants 2026, 15(1), 6; https://doi.org/10.3390/antiox15010006
Submission received: 9 November 2025 / Revised: 12 December 2025 / Accepted: 18 December 2025 / Published: 20 December 2025
(This article belongs to the Section Health Outcomes of Antioxidants and Oxidative Stress)
Browse Figures
Versions Notes

Abstract

This study investigated the interventional effects of dietary itaconic acid (ITA) on high-fat diet (HFD)-induced lipid deposition in largemouth bass (Micropterus salmoides) and the underlying mechanisms. Results showed that ITA supplementation significantly alleviated HFD-induced growth performance inhibition, as indicated by increased weight gain rate, increased specific growth rate, and reduced feed conversion ratio. ITA supplementation effectively reversed the HFD-induced increase in the hepatosomatic index, intraperitoneal fat ratio, serum triglycerides, total cholesterol, low-density lipoprotein/high-density lipoprotein ratio, hepatic lipid droplet accumulation, and hepatocyte vacuolation. Importantly, ITA ameliorated HFD-induced impairment of antioxidant capacity and reduced liver alanine aminotransferase and aspartate aminotransferase activities. Liver metabolomics revealed that ITA reduced levels of 20 fatty acids, 14 acylcarnitines, and 13 glycerides, suggesting enhanced fatty acid oxidation and reduced lipid esterification. Transcriptome sequencing and q-PCR validation demonstrated that ITA activated the AMPK/mTOR pathway, upregulating autophagy-related genes (prkaa1, ulk2, map1lc3a, sqstm1) and lysosomal biogenesis-related genes (ap3s2, igf2r, lgmn, ctso), thereby enhancing autophagic-lysosomal flux and promoting lipid degradation. In conclusion, ITA reduces hepatic lipid accumulation by synergistically activating autophagy and lysosomal biogenesis, thereby facilitating the oxidative degradation of fatty acids within lysosomes. This study provides a theoretical basis for the application of ITA as a functional feed additive in aquaculture.

1. Introduction

Fish fatty liver disease (FLD) refers to a range of physiological abnormalities and metabolic disturbances characterized by excessive accumulation of lipids within the liver tissue. It has become a prevalent nutritional disorder in global aquaculture, especially within Chinese aquaculture systems. FLD negatively impacts cultured fish by impairing growth metrics and feed conversion efficiency, compromising immune and stress response mechanisms, deteriorating flesh quality, and indirectly encouraging antibiotic overuse, consequently raising food safety concerns [1]. The pathogenesis of FLD is multifactorial, encompassing: nutritional and diet-related factors such as high dietary energy levels [2], deficiencies in essential nutrients [3,4], and feed oxidation processes [5]; environmental pollutants, including heavy metals [6,7] and organic contaminants [8,9], which interfere with lipid metabolic pathways; physiological variables like age and sex, which influence hepatic lipid accumulation [10,11]; interspecific variations in nutritional tolerance and lipid storage strategies [12,13]; and genetic factors, including specific gene mutations linked to fatty liver development [14]. Despite the complexity of FLD etiology, early diagnosis and targeted management strategies are crucial for mitigating its impact on aquaculture productivity.
Significant progress has been made in preventing and alleviating FLD in farmed fish. Sedum sarmentosum Bunge extract (FSSB) has been shown to markedly upregulate PPARα to promote fatty acid oxidation while downregulating PPARγ to inhibit lipid storage, thereby stimulating lipid breakdown and suppressing synthesis. Furthermore, FSSB upregulates apolipoprotein ApoA1 and fatty acid-binding proteins FABP1 and FABP3, which are involved in lipid digestion and absorption, thereby facilitating intracellular fatty acid transport and utilization. FSSB also exerts precise regulation on the expression of stearoyl-CoA desaturase and acyl-CoA-binding protein, influencing fatty acid desaturation and β-oxidation rates, which collectively promote lipid catabolism [15]. Metformin decreases hepatic lipid accumulation by inhibiting gluconeogenesis and reducing glucose-to-lipid conversion, while enhancing peripheral glucose and fatty acid utilization. It also upregulates PPARα to promote fatty acid oxidation, downregulates SREBP-1c to suppress lipogenesis, and increases apolipoprotein expression, thereby improving lipid metabolism [16]. Furthermore, Chinese herbal medicine (CHM) modulates the PPAR signaling, inducing the expression of acsl6 to promote fatty acid β-oxidation, while concurrently downregulating critical lipogenic enzymes such as FASN and ACC-2. CHM also upregulates GCK and GYS2, facilitating the diversion of glucose toward glycogen biosynthesis rather than lipogenesis. These integrated mechanisms synergistically mitigate hepatic lipid accumulation [17]. Supplementation of high-fat diets with 0.3 mg/kg selenium has been found to mitigate excessive liver lipid deposition by activating lipophagy—the autophagic degradation of lipid droplets [18]. Therefore, the modification and optimization of feed through dietary additives represent a promising strategy for ameliorating fatty liver disease in largemouth bass.
Itaconic acid (ITA) is an endogenous metabolite derived from the tricarboxylic acid (TCA) cycle, produced via the decarboxylation of cis-aconitate by aconitate decarboxylase 1, which is encoded by the immune-responsive gene 1 [19,20]. ITA has been recognized for its regulatory functions in systemic energy homeostasis and resistance to obesity [21], with growing evidence suggesting its involvement in modulating lipid metabolic pathways through multiple coordinated biochemical mechanisms. Due to its structural analogy to succinate, ITA competitively inhibits succinate dehydrogenase, thereby influencing mitochondrial metabolic flux [22]. Additionally, ITA can modify key glycolytic enzymes such as glyceraldehyde-3-phosphate dehydrogenase, aldolase A, and lactate dehydrogenase A, leading to suppressed glycolytic activity and reduced diversion of energy toward lipogenesis [23,24]. Within hepatocytes, ITA is further metabolized into itaconyl-CoA via an ATP-dependent reaction catalyzed by succinyl-CoA ligase, disrupting intracellular energy homeostasis and prompting compensatory upregulation of fatty acid β-oxidation [25]. Moreover, ITA supports mitochondrial fatty acid transport by stabilizing the CPT1a/SLC25A20/CPT2 axis; it prevents ubiquitination-mediated degradation of CPT1a, thereby maintaining sustained acylcarnitine production and ongoing β-oxidation [26]. Overall, these properties position ITA as a safe, biocompatible metabolic regulator with significant potential as a feed additive to enhance hepatic lipid metabolism and mitigate hepatic lipid accumulation.
The largemouth bass (Micropterus salmoides), originally native to North America, has emerged as a significant aquaculture species in China owing to its rapid growth rate, robust disease resistance, high-quality flesh, large size, and remarkable adaptability to diverse environmental conditions [27,28]. However, the widespread use of high-energy diets, coupled with the voracious feeding behavior of largemouth bass, has led to excessive lipid accumulation in the liver, emerging as one of the major challenges in its cultivation. This study systematically evaluated the therapeutic effects of ITA on FLD in largemouth bass fed a high-fat diet. The evaluation encompassed liver histological alterations, lipid deposition, liver enzyme activities, and antioxidant capacity. Additionally, transcriptomic sequencing was employed to investigate the molecular mechanisms underlying the protective role of ITA in mitigating lipid accumulation. The findings present a novel, safe intervention for FLD prevention and treatment in largemouth bass, providing essential experimental evidence and theoretical support for sustainable aquaculture development.

2. Materials and Methods

2.1. Feed Preparation

Three experimental diets were formulated using fish meal, soybean meal, and soy protein concentrate as protein sources, along with fish oil and soybean oil as lipid sources. The control diet (CON) contained 10% lipid, while the high-fat diet (HF) had a lipid content of 18%. The high-fat + itaconic acid diet (HF + ITA) also contained 18% lipid and was supplemented with 0.4% itaconic acid. The detailed feed formulations and proximate composition are presented in Table 1. The feeds were prepared as follows: all ingredients were thoroughly mixed according to the respective formulations, and then ground through an 80-mesh sieve. An appropriate amount of water was added to the mixture, which was subsequently pelleted into 2 mm diameter pellets using a laboratory pellet mill. The pellets were dried in a feed dryer and stored at −20 °C until use.

2.2. Experimental Fish and Sample Collection

Largemouth bass were purchased from a farm in Huzhou City, Zhejiang Province, and acclimated for two weeks in an indoor recirculating aquaculture system. At the start of the trial, 270 healthy fish of uniform size (initial body weight: 2.25 ± 0.01 g) were randomly assigned to 9 tanks, with three replicate tanks per treatment and 30 fish per tank. Fish were fed to apparent satiation twice daily at 08:30 and 16:30. Water quality was monitored twice weekly and maintained within the following ranges: temperature 27.3–29.4 °C, pH 7.70–7.83, dissolved oxygen ≥ 8.00 mg/L, and total ammonia nitrogen ≤ 0.05 mg/L. The feeding trial lasted for 8 weeks. Before sampling, fish were fasted for 24 h. The total number of fish and final individual body weight in each tank were recorded, after which fish were anesthetized with MS-222 (100 mg/L). Three fish per tank were randomly collected and stored at −20 °C for whole-body proximate composition analysis, with data averaged at the tank level. Another three fish per tank were sampled, weighed, and dissected on ice to obtain body length, body weight, liver weight, and intraperitoneal fat weight for calculating the hepatosomatic index (HSI) and lipid-to-body weight ratio; the corresponding liver samples were preserved for physiological and biochemical analyses, with all measurements averaged per tank. An additional three fish per tank were sampled, and their livers were collected and stored at −80 °C for transcriptomic, metabolomic, and gene expression analyses, all conducted on a per-tank basis. Finally, two fish per tank were randomly selected for histological assessment, and their liver and intestinal tissues were fixed in 4% paraformaldehyde for hematoxylin-eosin (H&E) and Oil Red O staining protocols. All statistical analyses were performed using tank means, with n = 3 representing the three independent tank replicates per treatment.

2.3. Whole Fish and Feed Proximate Composition Determination

The proximate analysis of both the whole fish and diets was conducted following the AOAC [29]. Moisture content was quantified gravimetrically through oven drying at 105 °C until a stable weight was attained. Crude protein levels were determined using the Kjeldahl method with a Kjeltec 2300 Analyzer (FOSS, Hillerød, Denmark). Crude lipid was extracted using petroleum ether in a Soxtec System HT6 (Tecator, Höganäs, Sweden). Ash content was measured by incineration in a muffle furnace at 550 °C for 12 h.

2.4. Analysis of Liver Biochemical Parameters and Serum Antioxidant Capacity

Liver and serum biochemical biomarkers, along with antioxidant enzyme activities, were quantified utilizing commercially available assay kits (Jiancheng Bioengineering Institute, Nanjing, China). According to the manufacturers’ protocols, the following parameters were quantified: total plasma protein (TP), serum triglycerides (TG, A110-1-1), total cholesterol (TCHO, A111-1-1), low-density and high-density lipoprotein cholesterol (LDL, HDL), alanine and aspartate aminotransferase (ALT, AST), along with key antioxidant and oxidative stress markers (total antioxidant capacity, T-AOC; glutathione peroxidase, GPx; superoxide dismutase; SOD; malondialdehyde, MDA; catalase, CAT). Absorbance measurements were acquired utilizing a PT-3502C microplate spectrophotometer (Beijing Putian New Bridge Technology Co., Ltd., Beijing, China), and analyte concentrations were determined based on the respective calibration curves supplied within the assay kits.

2.5. Histopathological Examination

Liver samples (n = 3 per group) were fixed in 4% formaldehyde for 24 h, then paraffin-embedded and sectioned (4 μm thickness) for hematoxylin and eosin staining. The sections were deparaffinized in xylene, rehydrated through a graded ethanol series, stained with hematoxylin for 5 min and eosin for 2 min, followed by dehydration, clearing, and mounting with neutral balsam. Separately, additional liver tissues were fixed in 4% paraformaldehyde at 4 °C overnight, followed by PBS washing, dehydration in 60% isopropanol, and Oil Red O staining for 3 h in darkness. Post-staining, samples were rinsed, dehydrated, and mounted with glycerin. Imaging was conducted with an HTC5.0 CCD camera integrated with WT1000GM imaging software, version 3.5. Oil Red O-stained droplets and vacuoles were observed under a light microscope (Leica Microsystems, Wetzlar, Germany), and their percentage area was quantified using ImageJ. Ten random fields per sample were further analyzed with ImageJ software, version 2.

2.6. Untargeted Metabolomics Analysis

Liver tissue samples from the CON, HF, and HF + ITA groups were collected, with three biological replicates (individual fish) randomly selected per group for analysis. The frozen samples stored at −80 °C were thawed at 4 °C. Metabolomic profiling was performed by Applied Protein Technology Co., Ltd. (Shanghai, China). The raw mass spectrometry data were converted to the mzXML format using MSConvert. Peak detection, alignment, and quantification were conducted using XCMS. Differential metabolites between comparison groups were identified using MetaboAnalyst (https://www.metaboanalyst.ca/, accessed on 21 June 2025). Specifically, a two-sided multiple t-test followed by Benjamini–Hochberg false discovery rate (FDR) correction was applied. Metabolites meeting the criteria of |fold change| > 1.0 and an FDR-adjusted q-value < 0.05 were considered statistically significant. Subsequently, KEGG pathway enrichment analysis was performed on these significant metabolites, and pathways with a p < 0.05 (from the enrichment analysis) were identified as significantly perturbed.

2.7. Transcriptomics Analysis

Liver tissue samples were obtained from the CON, HF, and HF + ITA groups, with three biological replicates randomly selected per group. Total RNA was extracted using Trizol reagent according to the manufacturer’s instructions, and its concentration was quantified by NanoDrop spectrophotometry (Thermo Fisher Scientific, Wilmington, Delaware, USA). The sequencing libraries and high-throughput sequencing were performed by Applied Protein Technology Co., Ltd. (Shanghai, China) following the standard Illumina workflow. Libraries were prepared using a poly(A) enrichment strategy. Briefly, mRNA was fragmented and reverse-transcribed into cDNA using random hexamer primers, followed by second-strand synthesis, AMPure XP bead purification, size selection, and PCR amplification. After passing quality control, the libraries were sequenced on an Illumina platform to generate 150 bp paired-end reads, yielding approximately 40 million raw reads per sample. To ensure reproducibility, data processing followed a standardized pipeline. Raw reads were first filtered and trimmed using FASTP (v0.23.2). Clean reads were then aligned to the largemouth bass reference genome using HISAT2 (v2.2.1) with default settings. Gene-level read counts were obtained with FeatureCounts (subread v2.0.3). Gene expression was estimated as fragments per kilobase of transcript per million mapped fragments (FPKM). Differential expression analysis was performed using DESeq2 (v1.40.2). Group comparisons were conducted using a likelihood ratio test based on a negative binomial generalized linear model, and p-values were adjusted by the Benjamini–Hochberg method. Genes with |log2 fold change| > 1 and adjusted p-value < 0.05 were considered significantly differentially expressed. For downstream functional analysis, largemouth bass transcripts were aligned to the zebrafish proteome using BLASTX (v2.13.0) to identify homologous genes. Based on zebrafish annotations, GO and KEGG enrichment analyses were performed using ClueGO with all expressed genes as the background set.

2.8. RNA Extraction and qPCR Analysis

Upon confirmation of RNA quality by NanoDrop and gel electrophoresis, cDNA was synthesized (TransScript® kit, TransGen Biotech Co., Ltd., Beijing, Beijing, China). The qPCR was carried out on an Applied Biosystems StepOnePlus instrument (Thermo Fisher Scientific, Foster City, California, USA) with Green qPCR Master Mix in a 20 μL volume. The protocol included a 60 s hot start at 95 °C and 40 cycles of denaturation (95 °C, 10 s) combined with annealing/extension (60 °C, 30 s). Gene expression was normalized to β-actin and EF1α and quantified using the 2−ΔΔCt method [30]. All primers (Table 2) were supplied by Sangon Biotech (Shanghai, China).

2.9. Statistical Analysis

Statistical analysis and graphing were performed using GraphPad Prism software (version 9.0.2, Franklin Street, Boston, MA, USA). For comparisons between two groups, statistical significance was assessed using Student’s t-test. For comparisons involving three or more groups, a one-way ANOVA was employed. Prior to ANOVA, the assumptions of normality and homogeneity of variance were verified using the Shapiro–Wilk and Levene’s tests, respectively. If the overall ANOVA was significant, post hoc Duncan’s multiple range test was applied for pairwise comparisons. A p-value of less than 0.05 was considered statistically significant. Each experiment included three biological replicates. Data are presented as mean ± standard deviation (mean ± SEM).

3. Results

3.1. Effects of ITA Supplementation in HFD on the Growth Performance

Compared to the CON group, the HF group exhibited significantly reduced growth metrics (final body weight, FBW; weight gain, WG; weight gain rate, WGR; specific growth rate, SGR) and increased feed conversion ratio (FCR) (p < 0.05). The HF + ITA group showed significant improvements in these parameters relative to HF (p < 0.05), with no difference in feed intake (Table 3; p > 0.05). Body length (BL) was lower in HF than CON (p < 0.05), while liver weight (LW), hepatosomatic index (HSI), condition factor (CF), abdominal fat weight (AFW), and the ratio of abdominal fat weight to body weight (ABR) were higher (p < 0.05). The HF + ITA group had increased BL and decreased LW, HSI, CF, AFW, and ABR compared to HF (Table 4; p < 0.05).

3.2. Effects of ITA Supplementation in HFD on Liver Physiological Indicators of Largemouth Bass

Compared with the CON, the HF showed significant increases in TP, TG, TCHO, LDL, HDL, ALT, and AST levels (p < 0.05). In contrast, the HF + ITA group showed significant decreases in these parameters compared to the HF group (Table 5; p < 0.05).

3.3. Effects of ITA Supplementation in HFD on Serum Antioxidant Indexes and Whole-Body Composition of Largemouth Bass

The HF group exhibited markedly elevated levels of H2O2 and MDA relative to the CON group, accompanied by a significant suppression of key antioxidant enzyme activities including T-AOC, SOD, CAT, and GPX (p < 0.05). Conversely, supplementation with ITA in the HF + ITA group effectively mitigated oxidative stress, as evidenced by decreased H2O2 and MDA concentrations and a concurrent restoration of antioxidant enzyme activities compared to the HF group (p < 0.05, Table 6). The crude lipid content in HF group was significantly higher than that in the CON group (p < 0.05, Table 7), while the crude lipid content in the HF + ITA group was significantly lower than that in the HF group (p < 0.05, Table 7).

3.4. Effects of ITA Supplementation in HFD on Liver Tissue Morphology of Largemouth Bass

Histological H&E staining revealed significant hepatocellular vacuolization progression in the HF group compared to CON (Figure 1A,B), indicating HFD-induced hepatic injury. Notably, this morphological abnormality was remarkably mitigated by ITA supplementation (Figure 1C,D). These results suggest that ITA can alleviate the structural liver damage induced by HFD. Assessment of Oil Red O-stained liver sections revealed that the area of lipid droplet accumulation (red-stained areas) was markedly increased in the HF group compared with the CON group (Figure 1E,F). In contrast, this lipid deposition was substantially reduced in the HF + ITA group relative to the HF group (Figure 1G,H). Collectively, these data indicate that ITA alleviates the pathological lipid deposition in the liver induced by a high-fat diet.

3.5. Effects of ITA Supplementation in HFD on Liver Lipid Metabolomics

This study conducted a heatmap analysis on metabolites related to fatty acid metabolism in the liver. The HF group exhibited higher relative levels of 19 fatty acids (such as ricinoleic acid and cis-9,10-epoxystearic acid) than the CON group (p < 0.05), as summarized in Figure 2. The HF + ITA group demonstrated a marked decline in the levels of 24 fatty acids (such as cis-13,16-docosadienoic acid and cis-11,14-eicosadienoic acid) compared to the HF group (Figure 2). As shown in Figure 3, compared to the CON group, the relative abundance of 16 acylcarnitines (Dodecanoylcarnitine, 2-Octanoylcarnitine, etc.) significantly increased in the HF group (p < 0.05). Compared to the HF group, 14 acylcarnitines significantly decreased in the HF + ITA group (Dodecanoylcarnitine, 2-Octanoylcarnitine, etc.) (p < 0.05). Compared to the CON group, 13 glycerides (MG (0:0/10:0/0:0), TG (20:3/15:0/20:4), etc.) relative abundance were significantly increased in the HF group (Figure 3, p < 0.05). Compared to the HF group, 14 glycerides significantly decreased in the HF + ITA group (MG (0:0/10:0/0:0), TG (20:3/15:0/20:4), etc.) (Figure 3, p < 0.05).

3.6. Effects of ITA Supplementation in HFD on Liver Transcriptomics

As shown in Figure 4A, a total of 2206 differentially expressed genes (DEGs) were detected in the comparison between CON vs. HF groups, including 570 significantly down-regulated genes and 1636 significantly up-regulated genes (p < 0.05). Analysis of the HF and HF + ITA comparison revealed 1463 differentially expressed genes, with a distribution of 1021 significantly down-regulated and 442 up-regulated genes (Figure 4B) (p < 0.05). Enrichment analysis of DEGs (Figure 4C,D) indicates that HF significantly modulates hepatic Transport, Catabolism, and Signal Transduction pathways. Specifically, in Transport and Catabolism, pathways such as Lysosome, Endocytosis, Autophagy-animal, and Phagosome are enriched. In Signal Transduction, pathways including mTOR and MAPK are prominently affected. The addition of ITA to HFD similarly influences these pathways, with enrichment in six Signal Transduction pathways and four in Transport and Catabolism.
Antioxidants 15 00006 g004aAntioxidants 15 00006 g004b
Figure 4. Effects of dietary supplementation with 0.4% ITA on liver gene transcription in largemouth bass fed a high-fat diet. Volcano map of differentially expressed genes (DEGs) between (A) CON vs. HF and (B) HF vs. HF + ITA groups. KEGG enrichment analysis of DEGs between (C) CON vs. HF and (D) HF vs. HF + ITA groups.
Figure 4. Effects of dietary supplementation with 0.4% ITA on liver gene transcription in largemouth bass fed a high-fat diet. Volcano map of differentially expressed genes (DEGs) between (A) CON vs. HF and (B) HF vs. HF + ITA groups. KEGG enrichment analysis of DEGs between (C) CON vs. HF and (D) HF vs. HF + ITA groups.
Antioxidants 15 00006 g004aAntioxidants 15 00006 g004b

3.7. Effects of ITA Supplementation in HFD on mTOR Signaling Pathway

Transcriptome analysis (Figure 5) revealed that, relative to CON, the HF group exhibited significant upregulation of mTOR, telo2, wdr59, and mlst8, while ulk2, tsc1b, tsc1a, tsc2, and rheb were markedly downregulated (p < 0.05). The fragment counts of genes such as mlst8, telo2, mTOR, and deptor were significantly decreased in the HF + ITA group compared with the HF group, while the fragment counts of genes such as tsc1a, tsc2, rheb, ulk2, and rptor were significantly up-regulated (p < 0.05). HFD markedly down-regulated the expression of multiple genes in the “mTOR signaling pathway”, an effect that was significantly reversed upon ITA supplementation (Supplemental Figure S1A,B).

3.8. Effects of ITA Supplementation in HFD on the Autophagy-Animal

We found that “Autophagy-animal” was present in both comparison pairs: CON vs. HF and HF vs. HF + ITA. Transcriptome data (Figure 6) showed that the fragment counts of atg10, atg16l1, atg13, atg5, mTOR, and other genes were significantly upregulated in the HF group compared to the CON group (p < 0.05). The fragment counts of atg9b, tsc1a, tsc2, akt1, rheb, tsc1b, wipi1, sqstm1, map1lc3a, map1lc3cl, ulk2, map1lc3b and other genes were significantly down-regulated (p < 0.05). The fragment counts of tsc1a, tsc2, sqstm1, map1lc3b, atg9b, map1lc3a, rheb, ulk2, atg7, atg4da, wipi1, rptor, and atg3 were significantly upregulated in the HF + ITA group compared to the HF group (p < 0.05). The mTOR, deptor, and mlst8 were significantly decreased in the HF + ITA compared to HF (p < 0.05) groups. HFD markedly suppressed multiple “Autophagy-animal” genes (Supplemental Figure S2A), with ITA supplementation significantly reversing these reductions (Supplemental Figure S2B).

3.9. Effects of ITA Supplementation in HFD on the Lysosome

We found that “Lysosome” was present in both comparison pairs: CON vs. HF and HF vs. HF + ITA. Transcriptome data showed (Figure 7) that compared with the CON group, the fragment counts of genes dmxl2 and entpd4 were increased in the HF group, while ap1g1, ap3s2, atp6v0a1a, lgmn, ctso, ap1m2, igf2r, gnsb, and ctsk were significantly decreased (p < 0.05). Compared with the HF group, the fragment counts of genes such as nots and nagpa were significantly down-regulated in the HF + ITA group (p < 0.05), while the fragment counts of genes such as gnsa, ap4m1, lgmn, igf2r, ap1g1, ap3s2, ap1m2, ap4s1, ctso, ctsc, and ctsk were significantly up-regulated (p < 0.05). Mapping the genes contained in “Lysosome” to KEGG signaling pathways (Supplemental Figure S3A) revealed that HFD significantly reduced the expression of multiple genes in “Lysosome”. As shown in Supplemental Figure S3B, these reduced gene fragments were significantly reversed after supplementing ITA in the HFD.

3.10. Quantitative PCR Analysis

Coordinated downregulation was observed in the HF group for genes spanning the AMPK/mTOR-Autophagy-Lysosome axis (prkaa1, ulk2, map1lc3a, igf2r, ap3s2, lgmn, ctso), while mTOR expression was conversely upregulated. These expression trends were significantly reversed by dietary ITA supplementation (p < 0.05; Figure 8).

4. Discussion

FLD has historically posed a significant challenge in aquaculture [31]. Under intensive rearing conditions, declining water quality and overfeeding with high-energy diets rapidly induce hepatic lipid accumulation, impairing product quality and economic profitability while compromising immune defenses and threatening industry sustainability. Current research on ITA in aquatic species primarily focuses on its anti-inflammatory properties [32], with limited evidence regarding its role in lipid metabolism [33]. Our findings demonstrate that ITA alleviates hepatic lipid accumulation induced by high-fat diets through activation of the AMPK/mTOR signaling pathway, promoting lipophagy and upregulating genes involved in lysosome biogenesis.
Numerous studies have confirmed that long-term consumption of HFD suppresses the growth performance of largemouth bass by impairing intestinal health and mitochondrial function [34,35]. The HF group displayed significantly depressed growth metrics (WG, WGR, SGR) and a concomitant increase in FCR compared to the CON group. Collectively, these findings demonstrate that the high-fat diet markedly impaired growth and compromised feed efficiency in largemouth bass. In contrast, dietary supplementation with ITA significantly enhanced WG, WGR%, and SGR%, and reduced FCR compared to the HF group, demonstrating that ITA alleviates the impaired growth performance induced by the HFD. These findings are consistent with previous research showing that the addition of the 4-octyl itaconate significantly improved growth performance in Nile tilapia [32]. The HFD group showed significantly higher LW, HSI, CF, AFW, and ABR compared to the CON group. Furthermore, H&E staining indicated increased white vacuoles in the HFD group, and Oil Red O staining showed larger red areas, indicative of lipid droplets. These results suggest that the HFD induced abnormal lipid accumulation in the liver, which aligns with observations reported in gibel carp (Carassius gibelio) [36]. ITA can effectively alleviate fatty liver-related pathological conditions and mitigate associated adverse physiological effects in mammals [25,37]. In the present study, fish in the HF + ITA group exhibited significantly lower LW, HSI, CF, AFW, and ABR compared to the HF group. H&E-stained liver sections showed a reduced number of white vacuoles, and Oil Red O staining indicated a significant decrease in the red areas corresponding to lipid droplets. These findings demonstrate that ITA effectively alleviates HFD-induced lipid accumulation. Previous studies have also reported that ITA ameliorates HFD-induced obesity and lipid deposition in mammals [38].
Serum levels of TCHO, TG, ALT, and AST are key parameters for evaluating liver health [39,40] and lipid metabolism status in largemouth bass [41]. In the present study, significantly elevated levels of TG, TCHO, ALT, and AST were observed in the HF group compared to the CON group, indicating that the HFD induced both lipid accumulation and liver tissue damage in largemouth bass. In contrast, these parameters were significantly reduced in the HF + ITA group compared to the HF group, demonstrating that ITA supplementation effectively ameliorated liver steatosis and injury caused by the HFD. Our results are in line with previous work demonstrating that ITA counteracts HFD-induced increases in serum ALT/AST [42] and attenuates liver accumulation of TG and TCHO [43], reinforcing its well-established role in mitigating metabolic disturbances. LDL primarily mediates liver-to-peripheral cholesterol transport, while HDL facilitates reverse cholesterol transport, returning peripheral cholesterol to the liver for catabolism [44]. In the current study, HFD was found to significantly reduce LDL levels while increasing HDL levels in the liver, indicating a disruption in liver lipid transport functions. Supplementation with ITA reversed this trend, indicating that ITA enhances the efficiency of fatty acid transport and metabolism in the liver. Antioxidant capacity is an important indicator for assessing growth and physiological status in fish, and it directly reflects whether oxidative stress occurs during cultivation [45]. In this study, the HFD significantly increased the levels of H2O2 and MDA, while decreasing the activities of T-AOC, SOD, CAT, and GPX, indicating that the HFD induced severe oxidative stress. ITA reversed these changes, suggesting that ITA effectively alleviates the decline in antioxidant capacity caused by the HFD. Previous studies have shown that HFD can cause mitochondrial rupture and inhibit mitophagy in the liver of spotted seabass (Lateolabrax maculatus) [46]. The damaged mitochondria then produce excessive ROS, which further aggravates hepatocellular injury. In contrast, ITA has been reported to promote lysosomal biogenesis [47] and mitophagy [48], thereby enhancing the removal of damaged mitochondria, reducing ROS accumulation resulting from mitochondrial disruption, and mitigating subsequent cellular and mitochondrial damage. This mechanism may partially explain how ITA improves antioxidant capacity, although further studies are needed to confirm this pathway. In addition, earlier reports have also demonstrated that ITA can reduce oxidative stress induced by heat stress [49] and pathogenic bacteria [50], further supporting its beneficial role in maintaining cellular redox balance.
To further investigate the impact of ITA on liver lipid metabolism, we quantitatively analyzed the composition and content of fatty acids in the liver using metabolomics techniques. The results revealed that among the 34 fatty acids detected in both the CON and HF groups, 20 were significantly elevated in the HF group compared to the CON group, indicating that the HFD markedly suppressed fatty acid catabolism in the liver. Consistent with previous studies, HFD has been shown to significantly increase the levels of polyunsaturated fatty acids such as DHA and EPA in the liver of blunt snout bream (Megalobrama amblycephala) [51,52]. Acylcarnitines are vital carriers facilitating mitochondrial entry of long-chain fatty acids for β-oxidation, playing a crucial role in fatty acid metabolic pathways. Among the 18 acylcarnitines detected in this study, 14 were significantly increased in the HF group compared to the CON group. This suggests that the HFD led to a substantial influx of exogenous fatty acids into the liver. In response to this lipid overload, the liver employs both enhanced fatty acid oxidation and esterification storage pathways to maintain metabolic homeostasis [53]. The observed increase in acylcarnitine levels suggests an enhanced transport of fatty acids into the mitochondria for subsequent β-oxidation. However, the persistent and abnormal rise in acylcarnitines also reflects mitochondrial overload and a saturation of oxidative capacity, implying a potential bottleneck in the metabolic flux [54,55]. When the fatty acid oxidation pathway becomes saturated, excess lipids are redirected into esterification, promoting glyceride synthesis and accumulation in the liver, which can ultimately lead to liver steatosis [18]. Among the 17 glycerides detected, 13 showed a significant increase in the HF group compared to the CON group. This result indicates that HFD induces substantial exogenous fatty acid influx, and the liver capacity for fatty acid oxidation becomes relatively insufficient. As β-oxidation and other oxidative pathways approach saturation, surplus fatty acids are shunted into esterification, promoting glyceride synthesis. This process represents a compensatory adaptive mechanism whereby the liver stores excess fatty acids as glycerides to alleviate lipotoxicity caused by free fatty acid accumulation [56]. Notably, ITA can significantly reduce the levels of fatty acids, acylcarnitines, and glycerides in the liver fed HFD, demonstrating that ITA effectively alleviates liver lipid deposition. In line with previous findings, ITA may mitigate liver lipid burden by promoting fatty acid catabolism [25,26] and optimizing the distribution of lipid metabolic fluxes [24], suggesting its potential role in maintaining lipid metabolic homeostasis.
To elucidate the molecular mechanisms by which ITA facilitates fatty acid degradation, we conducted transcriptomic sequencing of liver tissues to examine lipid-related regulatory pathways. Compared with the CON group, 2206 DEGs were identified in the HF group and 1463 DEGs in the HF + ITA group relative to the HF group. KEGG enrichment analysis showed that these DEGs were significantly concentrated in the autophagy–lysosome pathway, with mTOR signaling annotated as an upstream regulator [57,58], suggesting that dietary ITA modulates transcriptional activity within the hepatic mTOR/autophagy/lysosome axis. To clarify these associations, we analyzed the mTOR/autophagy pathway and lysosomal biogenesis separately. HFD reduced the transcription of autophagy-initiation genes (prkaa1, ulk2, map1lc3a, sqstm1) while upregulating mTOR. It also markedly decreased the expression of lysosomal biogenesis-related genes (ap3s2, igf2r, ap1g1, ap1m2) and lysosomal hydrolase-encoding genes (lgmn, ctso, ctsk). These changes indicate that HFD may inhibit hepatic autophagy initiation via AMPK/mTOR signaling and impair lysosome formation and hydrolase production, thereby restricting autophagosome–lysosome fusion. Given the central role of autophagy in clearing hepatic lipid deposits [59,60], such disruption likely contributes to lipid accumulation under HFD conditions. qPCR validation confirmed that ITA counteracted these effects by upregulating prkaa1, ulk2, map1lc3a, igf2r, ap3s2, lgmn, and ctso while suppressing mTOR expression. These results indicate that ITA enhances the transcription of autophagy-initiation and lysosomal biogenesis-related genes through AMPK/mTOR-associated regulation, consistent with its observed capacity to reduce hepatic lipid accumulation. Previous work has shown that ITA alkylates Cys212 of TFEB, disrupts its interaction with mTOR and 14-3-3 proteins, and promotes TFEB nuclear translocation, where it activates lysosomal biogenesis programs [47]. Thus, by simultaneously promoting autophagy initiation and lysosomal formation, ITA may reinforce hepatic autophagic flux. This interpretation aligns with prior evidence that autophagy activation effectively alleviates hepatic lipotoxicity in fish [61,62]. Nonetheless, several experimental limitations must be acknowledged. The transcriptomic profiling was performed with a limited biological replicate (n = 3), and only a single ITA intratumoral administration dosage was examined, constraining the robustness and extrapolation of the findings. Furthermore, critical functional assays—such as quantification of protein phosphorylation states in the AMPK/mTOR pathway, autophagic flux markers, and lysosomal enzymatic activity assays—were not conducted. Future investigations should incorporate protein phosphorylation analyses, autophagic flux assessments, and lysosomal enzymatic function measurements to substantiate the mechanistic hypotheses presented.
In summary, ITA mitigates HFD-induced hepatic steatosis by activating autophagy via the AMPK/mTOR pathway and upregulating lysosome biogenesis genes, thereby enhancing lipophagy and decreasing liver lipid accumulation. Given the conserved AMPK/mTOR–lysosome pathway, ITA may offer comparable hepatoprotective effects in other aquaculture species, guiding future research on its development as a broad-spectrum lipid-lowering feed additive. ITA can be mass-produced via microbial fermentation at low cost, and its inclusion at 0.4% in feed is feasible and economical. Compared to other functional additives for FLD (plant extracts, selenium, organic acids, and L-carnitine), ITA exhibits superior availability, affordability, bio-compatibility, and a direct lipid-lowering mechanism, indicating strong commercialization potential. However, potential interactions between ITA and environmental stressors (temperature, hypoxia, crowding) under high-energy feeding conditions require further investigation.

5. Conclusions

The results of this study demonstrate that ITA effectively alleviates HFD-induced liver lipid accumulation in largemouth bass. The underlying mechanism primarily involves the AMPK/mTOR signaling pathway, through which ITA promotes the expression of autophagy initiation and lysosome biogenesis, thereby increasing autophagic flux and accelerating lipid degradation. Furthermore, ITA ameliorates HFD-induced growth suppression, improves fatty acid metabolism and physiological function in the liver, and enhances antioxidant capacity. In conclusion, as a safe and effective feed additive, itaconic acid shows potential application value in preventing and treating FLD in fish.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/antiox15010006/s1.

Author Contributions

X.L.: Project administration, Methodology, Writing—review & editing. S.W.: Project administration, Methodology. M.Z.: Project administration, Methodology. M.L.: Supervision, Methodology. C.C.: Supervision, Methodology, Funding acquisition. All authors have read and agreed to the published version of the manuscript.

Funding

The research received funding from the Guizhou Provincial Science and Technology Innovation Talent Team for Grassland Resources Development and Utilization (Platform Talent Project of Guizhou Science and Technology Department: CXTD [2022]011), Hundred-Level Talent Project (Platform Talent Project of Guizhou Science and Technology Department: GCC [2023]012), and the National Natural Science Foundation of China (32202908).

Institutional Review Board Statement

The animal study protocol, which involved the use of Largemouth bass (Micropterus salmoides) for investigating the regulatory mechanism of itaconic acid on liver lipid metabolism, was approved by the Institutional Animal Care and Use Committee at Guizhou University (Approval No. EAE-62V-2025-T049, the approval date is 7 March 2025). All methods were performed in full compliance with the institution’s ethical guidelines.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article and Supplementary Materials. Further inquiries can be directed to the corresponding author.

Conflicts of Interest

The authors state that they have no competing financial interests or personal relationships that could have influenced the work presented in this study.

Abbreviations

The following abbreviations are used in this manuscript:
ITAItaconic Acid
HFDHigh-Fat Diet
CONControl Diet
HF + ITAHigh-Fat Diet with ITA supplementation
FBWFinal Body Weight
IBWInitial Body Weight
WGWeight Gain
WGRWeight Gain Rate
SGRSpecific Growth Rate
FIFeed Intake
FCRFeed Conversion Ratio
BLBody Length
LWLiver Weight
HSIHepatosomatic Index
CFCondition Factor
AFWAbdominal Fat Weight
ABRAbdominal Fat to Body Weight Ratio
TPTotal Protein
TGTriglycerides
TCHOTotal Cholesterol
LDLLow-Density Lipoprotein
HDLHigh-Density Lipoprotein
ALTAlanine Aminotransferase
ASTAspartate Aminotransferase
H2O2Hydrogen Peroxide
T-AOCTotal Antioxidant Capacity
SODSuperoxide Dismutase
CATCatalase
MDAMalondialdehyde
GPXGlutathione Peroxidase
q-PCRQuantitative Real-Time PCR
DEGsDifferentially Expressed Genes
KEGGKyoto Encyclopedia of Genes and Genomes
PCRPolymerase Chain Reaction
cDNAComplementary DNA
RNARibonucleic Acid
AOACAssociation of Official Agricultural Chemists
SEMStandard Error of the Mean
AMPKAMP-activated Protein Kinase
mTORMechanistic Target of Rapamycin
prkaa1Protein Kinase AMP-Activated Catalytic Subunit Alpha 1
ulk2Unc-51 Like Autophagy Activating Kinase 2
map1lc3Microtubule Associated Protein 1 Light Chain 3
sqstm1Sequestosome 1
igf2rInsulin Like Growth Factor 2 Receptor
ap3s2Adaptor Related Protein Complex 3 Subunit Sigma 2
lgmnLegumain
ctsoCathepsin O
ctskCathepsin K
ap1g1Adaptor Related Protein Complex 1 Subunit Gamma 1
ap1m2Adaptor Related Protein Complex 1 Subunit mu 2

References

  1. Schlegel, A. Studying non-alcoholic fatty liver disease with zebrafish: A confluence of optics, genetics, and physiology. Cell. Mol. Life Sci. 2012, 69, 3953–3961. [Google Scholar] [CrossRef]
  2. Tainaka, T.; Shimada, Y.; Kuroyanagi, J.; Zang, L.Q.; Oka, T.; Nishimura, Y.; Nishimura, N.; Tanaka, T. Transcriptome analysis of anti-fatty liver action by Campari tomato using a zebrafish diet-induced obesity model. Nutr. Metab. 2011, 8, 88. [Google Scholar] [CrossRef]
  3. Tocher, D.R.; Bendiksen, E.Å.; Campbell, P.J.; Bell, J.G. The role of phospholipids in nutrition and metabolism of teleost fish. Aquaculture 2008, 280, 21–34. [Google Scholar] [CrossRef]
  4. Bransden, M.P.; Cobcroft, J.M.; Battaglene, S.C.; Morehead, D.T.; Dunstan, G.A.; Nichols, P.D.; Kolkovski, S. Dietary 22:6n-3 alters gut and liver structure and behaviour in larval striped trumpeter (Latris lineata). Aquaculture 2005, 248, 275–285. [Google Scholar] [CrossRef]
  5. Chen, Y.J.; Liu, Y.J.; Yang, H.J.; Yuan, Y.; Liu, F.J.; Tian, L.X.; Liang, G.Y.; Yuan, R.M. Effect of dietary oxidized fish oil on growth performance, body composition, antioxidant defence mechanism and liver histology of juvenile largemouth bass Micropterus salmoides. Aquac. Nutr. 2012, 18, 321–331. [Google Scholar] [CrossRef]
  6. Chen, Q.L.; Gong, Y.; Luo, Z.; Zheng, J.L.; Zhu, Q.L. Differential effect of waterborne cadmium exposure on lipid metabolism in liver and muscle of yellow catfish Pelteobagrus fulvidraco. Aquat. Toxicol. 2013, 142–143, 380–386. [Google Scholar] [CrossRef]
  7. Pierron, F.; Baudrimont, M.; Bossy, A.; Bourdineaud, J.P.; Brèthes, D.; Elie, P.; Massabuau, J.C. Impairment of lipid storage by cadmium in the European eel (Anguilla anguilla). Aquat. Toxicol. 2007, 81, 304–311. [Google Scholar] [CrossRef]
  8. Ruzzin, J.; Petersen, R.; Meugnier, E.; Madsen, L.; Lock, E.J.; Lillefosse, H.; Ma, T.; Pesenti, S.; Sonne, S.B.; Marstrand, T.T.; et al. Persistent Organic Pollutant Exposure Leads to Insulin Resistance Syndrome. Environ. Health Persp. 2010, 118, 465–471. [Google Scholar] [CrossRef]
  9. Crinnion, W.J. The Role of Persistent Organic Pollutants in the Worldwide Epidemic of Type 2 Diabetes Mellitus and the Possible Connection to Farmed Atlantic Salmon (Salmo solar). Altern. Med. Rev. 2011, 16, 301. [Google Scholar]
  10. Hatlen, B.; Grisdale-Helland, B.; Helland, S.J. Growth, feed utilization and body composition in two size groups of Atlantic halibut (Hippoglossus hippoglossus) fed diets differing in protein and carbohydrate content. Aquaculture 2005, 249, 401–408. [Google Scholar] [CrossRef]
  11. Zhang, W.; Zhang, Y.T.; Zhang, H.X.; Wang, J.S.; Cui, R.N.; Dai, J.Y. Sex Differences in Transcriptional Expression of FABPs in Zebrafish Liver after Chronic Perfluorononanoic Acid Exposure. Environ. Sci. Technol. 2012, 46, 5175–5182. [Google Scholar] [CrossRef] [PubMed]
  12. Zeng, D.; Mai, K.; Ai, Q.; Milley, J.E.; Lall, S.P. Lipid and fatty acid compositions of cod (Gadus morhua), haddock (Melanogrammus aeglefinus) and halibut (Hippoglossus hippoglossus). J. Ocean Univ. China 2010, 9, 381–388. [Google Scholar] [CrossRef]
  13. Deng, S.X.; Tian, L.X.; Liu, F.J.; Jin, S.J.; Liang, G.Y.; Yang, H.J.; Du, Z.Y.; Liu, Y.J. Toxic effects and residue of aflatoxin B1 in tilapia (Oreochromis niloticus × O. aureus) during long- term dietary exposure. Aquaculture 2010, 307, 233–240. [Google Scholar] [CrossRef]
  14. Hugo, S.E.; Cruz-Garcia, L.; Karanth, S.; Anderson, R.M.; Stainier, D.Y.R.; Schlegel, A. A monocarboxylate transporter required for hepatocyte secretion of ketone bodies during fasting. Gene Dev. 2012, 26, 282–293. [Google Scholar] [CrossRef]
  15. Yu, K.; Huang, K.; Jiang, S.; Tang, X.; Huang, X.; Sun, L.; Pang, L.; Mo, C. Protective function on liver and proteomic analysis of the improvement mechanism of Sedum sarmentosum Bunge extract on nonalcoholic fatty liver disease in Nile tilapia. Aquaculture 2021, 531, 735977. [Google Scholar] [CrossRef]
  16. Espe, M.; Xie, S.W.; Chen, S.J.; Pedro, A.; Holen, E. Development of a fatty liver model using oleic acid in primary liver cells isolated from Atlantic salmon and the prevention of lipid accumulation using metformin. Aquac. Nutr. 2019, 25, 737–746. [Google Scholar] [CrossRef]
  17. Xu, X.R.; Sun, W.B.; Yin, S.; Long, X.D.; Zhao, H.Y.; Yang, H.; Zhang, Y.Y. Improvement effects and mechanism of compound Chinese herbal medicine on fatty liver in largemouth bass Micropterus salmoides. Aquaculture 2025, 598, 742075. [Google Scholar] [CrossRef]
  18. Zhang, X.T.; Yu, H.B.; Yan, X.F.; Li, P.J.; Wang, C.; Zhang, C.; Ji, H. Selenium reduces hepatopancreas lipid accumulation of grass carp fed high-fat diet via lipophagy activation. Anim. Nutr. 2023, 15, 126–136. [Google Scholar] [CrossRef]
  19. Swain, A.; Bambouskova, M.; Kim, H.; Andhey, P.S.; Duncan, D.; Auclair, K.; Chubukov, V.; Simons, D.M.; Roddy, T.P.; Stewart, K.M.; et al. Comparative evaluation of itaconate and its derivatives reveals divergent inflammasome and type I interferon regulation in macrophages. Nat. Metab. 2020, 2, 594–602. [Google Scholar] [CrossRef]
  20. O’Carroll, S.M.; Peace, C.G.; Toller-Kawahisa, J.E.; Min, Y.K.; Hooftman, A.; Charki, S.; Kehoe, L.; O’Sullivan, M.J.; Zoller, A.; Mcgettrick, A.F.; et al. Itaconate drives mtRNA-mediated type I interferon production through inhibition of succinate dehydrogenase. Nat. Metab. 2024, 6, 2060–2069. [Google Scholar] [CrossRef]
  21. Frieler, R.A.; Vigil, T.M.; Song, J.R.; Leung, C.; Goldstein, D.R.; Lumeng, C.N.; Mortensen, R.M. Aconitate decarboxylase 1 regulates glucose homeostasis and obesity in mice. Obesity 2022, 30, 1818–1830. [Google Scholar] [CrossRef]
  22. Lampropoulou, V.; Sergushichev, A.; Bambouskova, M.; Nair, S.; Vincent, E.E.; Loginicheva, E.; Cervantes-Barragan, L.; Ma, X.C.; Huang, S.C.C.; Griss, T.; et al. Itaconate Links Inhibition of Succinate Dehydrogenase with Macrophage Metabolic Remodeling and Regulation of Inflammation. Cell Metab. 2016, 24, 158–166. [Google Scholar] [CrossRef] [PubMed]
  23. Qin, W.; Qin, K.; Zhang, Y.L.; Jia, W.T.; Chen, Y.; Cheng, B.; Peng, L.H.; Chen, N.; Liu, Y.; Zhou, W.; et al. S-glycosylation-based cysteine profiling reveals regulation of glycolysis by itaconate. Nat. Chem. Biol. 2019, 15, 983–991. [Google Scholar] [CrossRef] [PubMed]
  24. Soto-Heredero, G.; de las Heras, M.G.M.; Gabandé-Rodríguez, E.; Oller, J.; Mittelbrunn, M. Glycolysis—A key player in the inflammatory response. FEBS J. 2020, 287, 3350–3369. [Google Scholar] [CrossRef] [PubMed]
  25. Weiss, J.M.; Palmieri, E.M.; Gonzalez-Cotto, M.; Bettencourt, I.A.; Megill, E.L.; Snyder, N.W.; McVicar, D.W. Itaconic acid underpins hepatocyte lipid metabolism in non-alcoholic fatty liver disease in male mice. Nat. Metab. 2023, 5, 981–995. [Google Scholar] [CrossRef]
  26. Mainali, R.; Buechler, N.; Otero, C.; Edwards, L.; Key, C.C.; Furdui, C.; Quinn, M.A. Itaconate stabilizes CPT1a to enhance lipid utilization during inflammation. Elife 2024, 12, RP92420. [Google Scholar] [CrossRef]
  27. Chen, Z.L.; Ye, Z.Y.; Ji, M.D.; Zhou, F.; Ding, X.Y.; Zhu, S.M.; Zhao, J. Effects of flow velocity on growth and physiology of juvenile largemouth bass (Micropterus salmoides) in recirculating aquaculture systems. Aquac. Res. 2021, 52, 3093–3100. [Google Scholar] [CrossRef]
  28. Wu, Y.B.; Wang, Y.; Ren, X.; Huang, D.; Si, G.R.E.; Chen, J.M. Replacement of fish meal with gamma-ray irradiated soybean meal in the diets of largemouth bass. Aquac. Nutr. 2021, 27, 977–985. [Google Scholar] [CrossRef]
  29. AOAC International. Official Methods of Analysis of AOAC International; CD-ROMs; AOAC International: Rockville, MD, USA, 2005. [Google Scholar]
  30. Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative C(T) method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef]
  31. Zhao, X.; Chen, W.; Chang, K.; Sun, P.; Gao, S. Etiology and Treatment of the Nutritional Fatty Liver in Fish: A Review. Pak. J. Zool 2025, 57, 961. [Google Scholar] [CrossRef]
  32. Mathew, R.T.; Alkhamis, Y.A.; Alngada, R.S.; Whed, R.A.; Aljaafari, N.A.; Eissa, E.H.; Algammal, A.M.; Munir, M.B.; Eissa, M.E.H.; Abdelnour, S.A. 4-octyl itaconate improves water quality, growth, immunity, blood parameters, and disease resistance of Nile tilapia (Oreochromis niloticus) infected with Aeromonas hydrophila. Aquac. Int. 2025, 33, 87. [Google Scholar] [CrossRef]
  33. Fu, L.; Liu, H.; Cai, W.; Han, D.; Zhu, X.; Yang, Y.; Xie, S. 4-Octyl Itaconate Supplementation Relieves Soybean Diet-Induced Liver Inflammation and Glycolipid Metabolic Disorders by Activating the Nrf2-Pparγ Pathway in Juvenile Gibel Carp. J. Agric. Food Chem. 2022, 70, 520–531. [Google Scholar] [CrossRef]
  34. Zhang, L.L.; Yang, M.Q.; Jiang, D.H.; Xiao, Z.Y.; He, Y.; Chen, W.Q.; Lai, W.B.; Chen, K.; Lu, L.M.; Xie, Y.B.; et al. Condensed tannin ameliorates intestinal damage and mitochondrial dysfunction induced by high-fat diets in largemouth bass (Micropterus salmoides). Int. J. Biol. Macromol. 2025, 311, 143642. [Google Scholar] [CrossRef] [PubMed]
  35. Chen, W.J.; Gao, S.Y.; Sun, P.; Han, L.; Zhang, Z.Y. Sodium butyrate ameliorates high-fat diet-induced growth retardation and gut injury in largemouth bass (Micropterus salmoides) by modulating gut mucosal barrier and microbiota. Anim. Feed Sci. Technol. 2025, 323, 116283. [Google Scholar] [CrossRef]
  36. Dong, X.J.; Qin, W.H.; Fu, Y.Y.; Ji, P.; Wang, J.Q.; Du, X.D.; Miao, S.Y.; Sun, L.S. Effects of dietary betaine on cholesterol metabolism and hepatopancreas function in gibel carp (Carassius gibelio) fed with a high-fat diet. Aquac. Nutr. 2021, 27, 1789–1797. [Google Scholar] [CrossRef]
  37. McGettrick, A.F.; Bourner, L.A.; Dorsey, F.C.; O’Neill, L.A.J. Metabolic Messengers: Itaconate. Nat. Metab. 2024, 6, 1661–1667. [Google Scholar] [CrossRef] [PubMed]
  38. Yu, Z.H.; Li, X.J.; Quan, Y.N.; Chen, J.W.; Liu, J.R.; Zheng, N.R.; Liu, S.W.; Wang, Y.N.; Liu, W.L.; Qiu, C.; et al. Itaconate alleviates diet-induced obesity via activation of brown adipocyte thermogenesis. Cell Rep. 2024, 43, 114142. [Google Scholar] [CrossRef]
  39. Xie, Y.X.; Yang, X.M.; Kaneko, G.; Liang, J.N.; Wen, L.T.; Li, Y.J.; Ao, Q.W.; Huang, L.M.; Li, P.; Min, W.W.; et al. Effects of different stocking densities and feeding frequencies on growth, physiological and biochemical indexes, and intestinal microflora of largemouth bass (Micropterus Salmoides) under land-based round pond. Aquaculture 2024, 580, 740385. [Google Scholar] [CrossRef]
  40. Lin, Y.J.; Li, X.N.; Chen, X.M.; Chen, J.M.; Jin, X.Y.; Sun, J.X.; Niu, X.T.; Kong, Y.D.; Li, M.; Wang, G.Q. γ-Aminobutyric Acid Effectively Modulate Growth Performance, Physiological Response of Largemouth Bass (Micropterus Salmoides) Under Combined Stress of Flow Velocity and Density. Aquac. Nutr. 2024, 2024, 9180554. [Google Scholar] [CrossRef]
  41. Guo, J.L.; Zhou, Y.L.; Zhao, H.; Chen, W.Y.; Chen, Y.J.; Lin, S.M. Effect of dietary lipid level on growth, lipid metabolism and oxidative status of largemouth bass. Aquaculture 2019, 506, 394–400. [Google Scholar] [CrossRef]
  42. Zhang, X.; Zhi, Y.; Zan, X.Y.; Fan, K.R.; Chen, K.; Zhao, S.; Dai, X.Y.; Li, L.J.; Yang, Y.Q.; Hu, K.; et al. Immune response gene 1 deficiency aggravates high fat diet-induced nonalcoholic fatty liver disease via promotion of redox-sensitive AKT suppression. Bba-Mol. Basis Dis. 2023, 1869, 166656. [Google Scholar] [CrossRef]
  43. An, Y.M.; Zheng, L.Z.; Zhang, S.A.; Zhang, H.Z.; Zhang, Y.T.; Shao, H.W.; Tong, W.X.; Chen, Z.Y.; Yao, H.; Wen, Z.K.; et al. Hydrogen activates ACOD1-itaconate pathway to ameliorate steroid-associated osteonecrosis. Biomaterials 2025, 323, 123428. [Google Scholar] [CrossRef] [PubMed]
  44. Liu, L.P.; Gao, W.Y.; Li, Q.W.; Xu, Y.L.; Xie, M.X.; Wu, C.L.; Liu, Y. Calcium pyruvate supplementation ameliorates fat accumulation and hepatic health by enhancing lipid utilization and inhibiting gluconeogenesis in Nile tilapia fed high-fat diets. Aquac. Rep. 2025, 42, 102738. [Google Scholar] [CrossRef]
  45. Zhou, Y.H.; Liang, H.L.; Ren, M.C.; Huang, D.Y.; Gu, J.Z. Impacts of Substituting Fish Meal With Hydrolyzed Feather Meal on the Growth Performance, Immunity, and Antioxidant Capacity of Juvenile Largemouth Bass (Micropterus salmoides). Aquac. Nutr. 2025, 2025, 6564426. [Google Scholar] [CrossRef]
  46. Dong, Y.Z.; Xia, T.; Lin, J.B.; Wang, L.; Song, K.; Zhang, C.X. Quercetin Attenuates High-Fat Diet-Induced Excessive Fat Deposition of Spotted Seabass (Lateolabrax maculatus) Through the Regulatory for Mitochondria and Endoplasmic Reticulum. Front. Mar. Sci. 2021, 8, 746811. [Google Scholar] [CrossRef]
  47. Zhang, Z.X.; Chen, C.; Yang, F.; Zeng, Y.X.; Sun, P.K.; Liu, P.; Li, X.J. Itaconate is a lysosomal inducer that promotes antibacterial innate immunity. Mol. Cell 2022, 82, 2844–2857. [Google Scholar] [CrossRef]
  48. Wang, G.; Li, Z.; Han, W.; Tian, Q.; Liu, C.; Jiang, S.; Xiang, X.; Zhao, X.; Wang, L.; Liao, J.; et al. Itaconate promotes mitophagy to inhibit neuronal ferroptosis after subarachnoid hemorrhage. Apoptosis 2025, 30, 991–1004. [Google Scholar] [CrossRef]
  49. Wang, H.H.; Yang, Y.; Huang, B.Z.; Cui, Z.Y.; Li, L.L. Protective effects of dietary dimethyl itaconate supplementation on oxidative stress, inflammation, and apoptosis in broilers under chronic heat stress. J. Anim. Sci. 2023, 101, skad356. [Google Scholar] [CrossRef]
  50. Sendra, M.; Saco, A.; Rey-Campos, M.; Novoa, B.; Figueras, A. Immune-responsive gene 1 (IRG1) and dimethyl itaconate are involved in the mussel immune response. Fish. Shellfish. Immun. 2020, 106, 645–655. [Google Scholar] [CrossRef] [PubMed]
  51. Lu, K.L.; Xu, W.N.; Li, X.F.; Liu, W.B.; Wang, L.N.; Zhang, C.N. Hepatic triacylglycerol secretion, lipid transport and tissue lipid uptake in blunt snout bream (Megalobrama amblycephala) fed high-fat diet. Aquaculture 2013, 408, 160–168. [Google Scholar] [CrossRef]
  52. Kobori, M.; Akimoto, Y.; Takahashi, Y.; Kimura, T. Combined Effect of Quercetin and Fish Oil on Oxidative Stress in the Liver of Mice Fed a Western-Style Diet. J. Agric. Food Chem. 2020, 68, 13267–13275. [Google Scholar] [CrossRef] [PubMed]
  53. Li, J.M.; Li, L.Y.; Zhang, Y.X.; Jiang, Z.Y.; Limbu, S.M.; Qiao, F.; Degrace, P.; Chen, L.Q.; Zhang, M.L.; Du, Z.Y. Functional differences between l- and d-carnitine in metabolic regulation evaluated using a low-carnitine Nile tilapia model. Brit. J. Nutr. 2019, 122, 625–638. [Google Scholar] [CrossRef]
  54. Ozório, R.O.A.; Uktoseja, J.L.A.; Huisman, E.A.; Verreth, J.A.J. Changes in fatty acid concentrations in tissues of African catfish, Clarias gariepinus Burchell, as a consequence of dietary carnitine, fat and lysine supplementation. Brit. J. Nutr. 2001, 86, 623–636. [Google Scholar] [CrossRef]
  55. Dias, J.; Arzel, J.; Corraze, G.; Kaushik, J. Effects of dietary L-carnitine supplementation on growth and lipid metabolism in European seabass (Dicentrarchus labrax). Aquac. Res. 2001, 32, 206–215. [Google Scholar] [CrossRef]
  56. Ding, L.G.; Sun, W.F.; Balaz, M.; He, A.Y.; Klug, M.; Wieland, S.; Caiazzo, R.; Raverdy, V.; Pattou, F.; Lefebvre, P.; et al. Peroxisomal β-oxidation acts as a sensor for intracellular fatty acids and regulates lipolysis. Nat. Metab. 2021, 3, 1648–1661. [Google Scholar] [CrossRef]
  57. He, Y.; Yu, H.D.; Zhang, Z.Y.; Zhang, J.Y.; Kang, S.C.; Zhang, X.Z. Effects of chronic hypoxia on growth performance, antioxidant capacity and protein turnover of largemouth bass (Micropterus salmoides). Aquaculture 2022, 561, 738673. [Google Scholar] [CrossRef]
  58. Zhou, X.Y.; Lai, Y.H.; Zhang, J.; Li, Y.; Wu, X.M.; Yang, Y.Z.; Zhang, X.F.; Ma, L.Z.; Zheng, K.M.; Liu, Y.D.; et al. Advanced oxidation protein products attenuate the autophagy-lysosome pathway in ovarian granulosa cells by modulating the ROS-dependent mTOR-TFEB pathway. Cell Death Dis. 2024, 15, 161. [Google Scholar] [CrossRef]
  59. Settembre, C.; Ballabio, A. Lysosome: Regulator of lipid degradation pathways. Trends Cell Biol. 2014, 24, 743–750. [Google Scholar] [CrossRef] [PubMed]
  60. Zi, Z.Z.; Zhang, Z.Z.; Feng, Q.; Kim, C.; Wang, X.D.; Scherer, P.E.; Gao, J.M.; Levine, B.; Yu, Y.H. Quantitative phosphoproteomic analyses identify STK11IP as a lysosome-specific substrate of mTORC1 that regulates lysosomal acidification. Nat. Commun. 2022, 13, 1760. [Google Scholar] [CrossRef]
  61. Phadwal, K.; Haggarty, J.; Kurian, D.; Martí, J.A.; Sun, J.X.; Houston, R.D.; Betancor, M.B.; MacRae, V.E.; Whitfield, P.D.; Macqueen, D.J. Rapamycin induced autophagy enhances lipid breakdown and ameliorates lipotoxicity in Atlantic salmon cells. Biochim. Biophys. Acta (BBA) Mol. Cell Biol. Lipids 2025, 1870, 159636. [Google Scholar] [CrossRef]
  62. Zhong, C.C.; Zhao, T.; Hogstrand, C.; Chen, F.; Song, C.C.; Luo, Z. Copper (Cu) induced changes of lipid metabolism through oxidative stress-me diated autophagy and Nrf2/PPARγ pathways. J. Nutr. Biochem. 2022, 100, 108883. [Google Scholar] [CrossRef]
Antioxidants 15 00006 g001aAntioxidants 15 00006 g001b
Figure 1. Effects of dietary supplementation with 0.4% ITA on liver histopathological sections in largemouth bass fed a high-fat diet. Representative H&E staining of liver tissue sections in (A) CON, (B) HF and (C) HF + ITA groups (scale bar, 100 μm). (D) Quantitative analysis of vacuolization area in liver sections. ORO staining of liver tissue sections in the (E) CON, (F) HF and (G) HF + ITA groups (scale bar, 100 μm). (H) Quantitative analysis of the area of lipid droplets in liver sections. Lipids appear red and nuclei appear blue after Oil Red O staining. The depth of red color and the size of the lipid droplets were positively correlated with the lipid content. Statistical differences are represented by different letters (p < 0.05).
Figure 1. Effects of dietary supplementation with 0.4% ITA on liver histopathological sections in largemouth bass fed a high-fat diet. Representative H&E staining of liver tissue sections in (A) CON, (B) HF and (C) HF + ITA groups (scale bar, 100 μm). (D) Quantitative analysis of vacuolization area in liver sections. ORO staining of liver tissue sections in the (E) CON, (F) HF and (G) HF + ITA groups (scale bar, 100 μm). (H) Quantitative analysis of the area of lipid droplets in liver sections. Lipids appear red and nuclei appear blue after Oil Red O staining. The depth of red color and the size of the lipid droplets were positively correlated with the lipid content. Statistical differences are represented by different letters (p < 0.05).
Antioxidants 15 00006 g001aAntioxidants 15 00006 g001b
Antioxidants 15 00006 g002
Figure 2. Effects of dietary supplementation with 0.4% ITA on metabolites related to lipid metabolism (fatty acids) in the liver of largemouth bass fed a high-fat diet (n = 3). Metabolomic profiling of the liver was performed on three randomly selected specimens from the CON, HF, and HF + ITA. The heat map illustrates the normalized intensities of fatty acids. Statistical significance was determined at p < 0.05 for comparisons between (A) CON vs. HF and (B) HF vs. HF + ITA.
Figure 2. Effects of dietary supplementation with 0.4% ITA on metabolites related to lipid metabolism (fatty acids) in the liver of largemouth bass fed a high-fat diet (n = 3). Metabolomic profiling of the liver was performed on three randomly selected specimens from the CON, HF, and HF + ITA. The heat map illustrates the normalized intensities of fatty acids. Statistical significance was determined at p < 0.05 for comparisons between (A) CON vs. HF and (B) HF vs. HF + ITA.
Antioxidants 15 00006 g002
Antioxidants 15 00006 g003aAntioxidants 15 00006 g003b
Figure 3. Effects of dietary supplementation with 0.4% ITA on metabolites related to lipid metabolism (acylcarnitine and glyceride) in the liver of largemouth bass fed a high-fat diet (n = 3). The relative abundance of liver acylcarnitine in (A) CON vs. HF and (B) HF vs. HF + ITA. The relative abundance of liver glyceride in (C) CON vs. HF and (D) HF vs. HF + ITA. Livers from three fish from the CON, HF, and HF + ITA groups were analyzed for metabolomics using mass spectrometry. The heat map depicts the normalized value. A significant difference in the CON vs. HF and HF vs. HF + ITA groups was considered when p < 0.05, as determined by two-sided multiple t-tests (one per row).
Figure 3. Effects of dietary supplementation with 0.4% ITA on metabolites related to lipid metabolism (acylcarnitine and glyceride) in the liver of largemouth bass fed a high-fat diet (n = 3). The relative abundance of liver acylcarnitine in (A) CON vs. HF and (B) HF vs. HF + ITA. The relative abundance of liver glyceride in (C) CON vs. HF and (D) HF vs. HF + ITA. Livers from three fish from the CON, HF, and HF + ITA groups were analyzed for metabolomics using mass spectrometry. The heat map depicts the normalized value. A significant difference in the CON vs. HF and HF vs. HF + ITA groups was considered when p < 0.05, as determined by two-sided multiple t-tests (one per row).
Antioxidants 15 00006 g003aAntioxidants 15 00006 g003b
Antioxidants 15 00006 g005
Figure 5. Effects of dietary supplementation with 0.4% ITA on the liver mTOR signalling pathway in largemouth bass fed a high-fat diet (n = 3). Gene expression profiles in CON vs. HF and HF vs. HF + ITA groups.
Figure 5. Effects of dietary supplementation with 0.4% ITA on the liver mTOR signalling pathway in largemouth bass fed a high-fat diet (n = 3). Gene expression profiles in CON vs. HF and HF vs. HF + ITA groups.
Antioxidants 15 00006 g005
Antioxidants 15 00006 g006
Figure 6. Effects of dietary supplementation with 0.4% ITA on liver autophagy genes in largemouth bass fed a high-fat diet (n = 3). Gene expression profiles in CON vs. HF and HF vs. HF + ITA groups.
Figure 6. Effects of dietary supplementation with 0.4% ITA on liver autophagy genes in largemouth bass fed a high-fat diet (n = 3). Gene expression profiles in CON vs. HF and HF vs. HF + ITA groups.
Antioxidants 15 00006 g006
Antioxidants 15 00006 g007
Figure 7. Effects of dietary supplementation with 0.4% ITA on liver lysosomes of largemouth bass fed a high-fat diet (n = 3). Gene expression profiles in CON vs. HF and HF vs. HF + ITA.
Figure 7. Effects of dietary supplementation with 0.4% ITA on liver lysosomes of largemouth bass fed a high-fat diet (n = 3). Gene expression profiles in CON vs. HF and HF vs. HF + ITA.
Antioxidants 15 00006 g007
Antioxidants 15 00006 g008
Figure 8. Quantitative PCR analysis of key genes involved in the AMPK/mTOR-lysosome/autophagy pathway and lysosome pathway (n = 3). Differences were deemed statistically significant at a p-value threshold of less than 0.05 (marked by different letters).
Figure 8. Quantitative PCR analysis of key genes involved in the AMPK/mTOR-lysosome/autophagy pathway and lysosome pathway (n = 3). Differences were deemed statistically significant at a p-value threshold of less than 0.05 (marked by different letters).
Antioxidants 15 00006 g008
Table 1. Ingredients and nutrient composition of 3 experimental diets (%, as air-dried basis).
Table 1. Ingredients and nutrient composition of 3 experimental diets (%, as air-dried basis).
Ingredients (%)ConHFHF + ITA
Peru fish meal b50.0050.0050.00
Soybean protein concentrate b13.0013.0013.00
Soybean meal b10.0010.0010.00
Wheat flour7.007.007.00
Soybean oil3.007.007.00
Fish oil3.007.007.00
Vitamin C0.200.200.20
Sodium carboxymethyl cellulose1.001.001.00
Vitamin premix c0.750.750.75
Mineral premix d0.750.750.75
Ca(H2PO4)21.501.501.50
Microcrystalline cellulose9.801.801.40
ITA a0.000.000.40
Total100.00100.00100.00
Nutrition analysis, % dry matter
Crude protein47.8946.9046.92
Crude lipid10.5617.8818.03
Ash12.3813.9816.60
Moisture7.957.937.85
a Purchased from Beijing Solarbio Science & Technology Co., Ltd. (Beijing, China), purity ≥ 98%. b Purchased from Tongwei Group Co., Ltd. (Chengdu, China), Peru fish meal: crude protein, 67.2%, crude lipid, 7.63%; soybean protein concentrate: crude protein, 65.16%; crude lipid, 0.52%; soybean meal: crude protein, 45.44%, crude lipid, 1.26%. c Vitamin premix (mg/kg): Vitamin B1, 17.80; Vitamin A, 16,000 IU; Vitamin B2, 48; Vitamin B6, 29.52; Vitamin B12, 0.24; Vitamin C, 800; Vitamin D3, 8000 IU; Vitamin E, 160; Vitamin K3, 14.72; Choline 1500 chloride; Folate, 6.40; Nicotinamide, 79.20; Inositol, 320; Calcium pantothenate, 73.60; Biotin, 0.64. d Mineral premix (mg/kg): iodine (Ca(IO3)2), 1.63; Manganese (MnSO4), 6.20; Copper (CuSO4), 2.00; Iron (FeSO4), 21.10; Selenium (Na2SeO3), 0.18; Cobalt (CoCl2), 0.24; Zinc (ZnSO4), 34.40.
Table 2. Juvenile largemouth bass primers for qRT-PCR analysis.
Table 2. Juvenile largemouth bass primers for qRT-PCR analysis.
Target GenePrimer Sequence (5′–3′)Size (bp)Accession
maplc3aF: TTTGCTGACCGGTGCAAAGA173XM_038697699.1
 R: CGACGCCTGATGATCTTGAC  
ulk2F: CGATGTCCAGGAAACACCCA213XM_038694231.1
 R: CCCGCATATGACAGCAGGAT  
prkaa1F: GAATTAGCAAGCCCCACCCT197XM_038734014.1
 R: CTGTTTCATTGCACGGCACA  
lgmnF: AAAGTACTGAAGAGCGGCCC183XM_038728731.1
 R: AGACTCGCATGCCTCAATGT  
ap3s2F: GATCGTAGCCCAGGTCGAAG109XM_038700750.1
 R: CTCGGGCAGGTTCATGTTCT  
ctsoF: ACCAACAAGCATGTGGAAGT239XM_038699159.1
 R: GCAGATTCCTGTCTTGGCCT  
mTORF: ATCGTGACGACAGGGTCCAT266XM_038723321.1
 R: GGTGAGGAAGCCTTGAGGTG  
igf2rF: ATGACTGTCGGGTTCGTGAC206XM_038727258.1
 R: TGCCATTCCTGCGATCTTGT  
β-actinF: CTCTGCATACATGCCTACAC117XM_038695351.1
 R: GTAGAGTTTCTCCCCATCAGG  
EF1αF: TGCTGCTGGTGTTGGTGAGTT147XM_038724777.1
 R: TTCTGGCTGTAAGGGGGCTC  
Note: maplc3a: microtubule-associated protein 1 light chain 3 alpha; ulk2: unc-51 like autophagy activating kinase 2; prkaa1: protein kinase, AMP-activated, alpha 1 catalytic subunit; lgmn: legumain; ap3s2: adaptor related protein complex 3 subunit sigma 2; ctso: cathepsin O; mTOR: serine/threonine-protein kinase mTOR; igf2r: insulin-like growth factor 2 receptor. The capital “F” in the table denotes the forward primer, while the capital “R” denotes the reverse primer.
Table 3. Effect of ITA supplementation on growth performance of juvenile largemouth bass fed a high-fat diet.
Table 3. Effect of ITA supplementation on growth performance of juvenile largemouth bass fed a high-fat diet.
ParametersCONHFHF + ITA
IBW g/per fish2.25 ± 0.012.25 ± 0.002.25 ± 0.01
FBW g/per fish17.96 ± 0.57 c13.84 ± 0.32 a15.51 ± 0.24 b
WG g/per fish15.71 ± 0.57 c11.59 ± 0.32 a13.26 ± 0.24 b
WGR%698.48 ± 26.33 c514.36 ± 13.33 a588.38 ± 11.08 b
SGR%/d2.87 ± 0.03 c2.61 ± 0.02 a2.73 ± 0.02 b
FI g/per fish17.32 ± 0.81 b16.52 ± 0.20 ab15.49 ± 0.12 a
FCR1.15 ± 0.03 a1.51 ± 0.04 b1.27 ± 0.01 a
Note: ITA = Itaconic acid; FBW = final mean body weight; IBW = initial mean body weight; FCR = feed conversion ratio; FI = food intake; SGR = specific growth rate; WGR = weight gain rate; WG = weight gain. CON: The feed contains 10% lipid without the addition of ITA. HF: The feed contains 18% lipid without the addition of ITA. HF + ITA: The feed contains 18% lipid with the addition of 0.4% ITA. Data are presented as mean ± SEM (n = 3). Statistical differences are represented by different letters (p < 0.05).
Table 4. Effect of ITA supplementation on liver lipid metabolism-related parameters of juvenile largemouth bass fed a high-fat diet.
Table 4. Effect of ITA supplementation on liver lipid metabolism-related parameters of juvenile largemouth bass fed a high-fat diet.
ParametersCONHFHF + ITA
BL cm11.30 ± 0.15 c9.72 ± 0.04 a10.67 ± 0.04 b
LW g0.15 ± 0.00 a0.19 ± 0.00 c0.17 ± 0.00 b
HSI (%)0.83 ± 0.01 a1.37 ± 0.02 c1.07 ± 0.03 b
CF (%)1.24 ± 0.01 a1.51 ± 0.02 b1.28 ± 0.03 a
AFW g0.11 ± 0.00 a0.22 ± 0.02 b0.14 ± 0.00 a
ABR0.63 ± 0.02 a1.59 ± 0.09 c0.90 ± 0.01 b
Note: ITA = Itaconic acid; ; BL = body length; LW = liver weight; HSI = hepatic steatosis index; CF = condition factor; AFW = abdominal fat weight; ABR = ratio of abdominal fat weight to body weight. CON: The feed contains 10% lipid without the addition of ITA. HF: The feed contains 18% lipid without the addition of ITA. HF + ITA: The feed contains 18% lipid with the addition of 0.4% ITA. Data are presented as mean ± SEM (n = 3). Statistical differences are represented by different letters (p < 0.05).
Table 5. Effect of ITA supplementation on liver biochemical parameters of juvenile largemouth bass fed a high-fat diet.
Table 5. Effect of ITA supplementation on liver biochemical parameters of juvenile largemouth bass fed a high-fat diet.
ParametersCONHFHF + ITA
TP g/L10.77 ± 0.789.28 ± 1.2610.35 ± 0.35
TG mmol/g prot0.25 ± 0.02 a0.49 ± 0.04 b0.30 ± 0.02 a
TCHO mmol/g prot0.02 ± 0.00 a0.04 ± 0.00 b0.03 ± 0.00 a
LDL μmol/g prot0.06 ± 0.010.03 ± 0.000.06 ± 0.01
HDL μmol/mg prot17.55 ± 1.32 a40.59 ± 1.85 b23.03 ± 2.43 a
ALT U/g prot64.64 ± 3.20 a103.90 ± 2.03 b62.31 ± 1.25 a
AST U/g prot83.57 ± 1.28 a108.24 ± 1.86 b89.19 ± 5.69 a
Note: ITA = Itaconic acid; TP = total protein content; TG = total triglycerides; TCHO = total cholesterol; LDL = low-density lipoprotein; HDL = high-density lipoprotein; ALT = alanine aminotransferase; AST = aspartate aminotransferase. CON: The feed contains 10% lipid without the addition of ITA. HF: The feed contains 18% lipid without the addition of ITA. HF + ITA: The feed contains 18% lipid with the addition of 0.4% ITA. Data are presented as mean ± SEM (n = 3). Statistical differences are represented by different letters (p < 0.05).
Table 6. Effect of ITA supplementation on serum antioxidant indexes of juvenile largemouth bass fed a high-fat diet.
Table 6. Effect of ITA supplementation on serum antioxidant indexes of juvenile largemouth bass fed a high-fat diet.
ParametersCONHFHF + ITA
H2O2 mmol/L71.21 ± 4.19 a93.63 ± 6.40 b56.97 ± 3.90 a
T-AOC mM0.35 ± 0.02 c0.19 ± 0.00 a0.25 ± 0.01 b
SOD U/L3.21 ± 0.13 b2.34 ± 0.15 a3.16 ± 0.04 b
CAT U/mL6.14 ± 0.87 b3.23 ± 0.42 a5.58 ± 0.91 ab
MDA nmol/L8.83 ± 2.12 a25.41 ± 1.74 b9.19 ± 1.43 a
GPX U/L339.10 ± 8.36 b282.99 ± 3.10 a342.69 ± 11.39 b
Note: ITA = Itaconic acid; H2O2 = hydrogen peroxide; T-AOC = total antioxidant capacity; SOD = superoxide dismutase; CAT = catalase; MDA = malondialdehyde; GPX = glutathione peroxidase. CON: The feed contains 10% lipid without the addition of ITA. HF: The feed contains 18% lipid without the addition of ITA. HF + ITA: The feed contains 18% lipid with the addition of 0.4% ITA. Data are presented as mean ± SEM (n = 3). Statistical differences are represented by different letters (p < 0.05).
Table 7. Effect of ITA supplementation on whole-body proximate composition of juvenile largemouth bass fed a high-fat diet.
Table 7. Effect of ITA supplementation on whole-body proximate composition of juvenile largemouth bass fed a high-fat diet.
ParametersCONHFHF + ITA
Moisture71.77 ± 0.3170.20 ± 1.3270.87 ± 1.19
Crude protein48.52 ± 0.2848.38 ± 0.5547.24 ± 0.33
Crude lipid31.52 ± 0.83 a37.63 ± 0.59 b33.50 ± 0.55 a
Ash16.32 ± 0.3814.61 ± 0.4914.00 ± 0.71
Note: ITA = Itaconic acid. CON: The feed contains 10% lipid without the addition of ITA. HF: The feed contains 18% lipid without the addition of ITA. HF + ITA: The feed contains 18% lipid with the addition of 0.4% ITA. Data are presented as mean ± SEM (n = 3). Statistical differences are represented by different letters (p < 0.05).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Li, X.; Wang, S.; Zhang, M.; Li, M.; Chen, C. Itaconic Acid Activates Lysosomal Biogenesis and Autophagy Flux and Mitigates High-Fat Diet-Induced Liver Lipid Accumulation in Largemouth Bass (Micropterus salmoides). Antioxidants 2026, 15, 6. https://doi.org/10.3390/antiox15010006

AMA Style

Li X, Wang S, Zhang M, Li M, Chen C. Itaconic Acid Activates Lysosomal Biogenesis and Autophagy Flux and Mitigates High-Fat Diet-Induced Liver Lipid Accumulation in Largemouth Bass (Micropterus salmoides). Antioxidants. 2026; 15(1):6. https://doi.org/10.3390/antiox15010006

Chicago/Turabian Style

Li, Xue, Shidong Wang, Muzi Zhang, Ming Li, and Chao Chen. 2026. "Itaconic Acid Activates Lysosomal Biogenesis and Autophagy Flux and Mitigates High-Fat Diet-Induced Liver Lipid Accumulation in Largemouth Bass (Micropterus salmoides)" Antioxidants 15, no. 1: 6. https://doi.org/10.3390/antiox15010006

APA Style

Li, X., Wang, S., Zhang, M., Li, M., & Chen, C. (2026). Itaconic Acid Activates Lysosomal Biogenesis and Autophagy Flux and Mitigates High-Fat Diet-Induced Liver Lipid Accumulation in Largemouth Bass (Micropterus salmoides). Antioxidants, 15(1), 6. https://doi.org/10.3390/antiox15010006

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop