Effect of Nano-Selenium on Intestinal Oxidative Stress Induced by H2O2 in Mice
Abstract
1. Introduction
2. Materials and Methods
2.1. Preparation of Chitosan Nano-Selenium Composites
2.2. Mice and Management
2.3. Determination of Selenium Content in Feed
2.4. Sampling
2.5. Intestinal Histomorphology
2.6. Measurement of Expression Levels of Antioxidant Enzymes and Inflammatory Factors in Intestinal Tissues
2.6.1. Total RNA Isolation
2.6.2. Reverse Transcription
2.6.3. Real-Time Fluorescent Quantitative PCR
2.6.4. Measurement Indicators
2.7. Measurement of Antioxidant Indicators
2.8. Statistical Analysis
3. Results
3.1. Effect of Nano-Selenium on Organ Index
3.2. Effect of Nano-Selenium on the Morphology of Jejunum
3.3. Effect of Nano-Selenium on the Expression of Anti-Inflammatory and Antioxidant-Related Genes in the Intestine
3.3.1. Gene Expression of Intestinal Inflammatory Factors
3.3.2. Intestinal Antioxidant Gene Expression
3.4. Effect of Nano-Selenium on the Antioxidant Capacity
4. Discussion
4.1. The Role of Chitosan in Nano-Selenium Materials
4.2. Effect of Nano-Selenium on Organ Index
4.3. Effect of Nano-Selenium on the Morphology of Jejunum
4.4. Effect of Nano-Selenium on the Expression of Intestinal Inflammatory Factors
4.5. Effect of Nano-Selenium on the Expression of Intestinal Selenoproteins and Antioxidant Enzymes
4.6. Effect of Nano-Selenium on Intestinal Antioxidation
4.7. Limitations of This Study and Future Research Directions
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Bhattacharyya, A.; Chattopadhyay, R.; Mitra, S.; Crowe, S.E. Oxidative stress: An essential factor in the pathogenesis of gastrointestinal mucosal diseases. Physiol. Rev. 2014, 94, 329–354. [Google Scholar] [CrossRef] [Scilit]
- Persson, T.; Popescu, B.O.; Cedazo-Minguez, A. Oxidative stress in Alzheimer’s disease: Why did antioxidant therapy fail? Oxidative Med. Cell. Longev. 2014, 2014, 427318. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kudva, A.K.; Shay, A.E.; Prabhu, K.S. Selenium and inflammatory bowel disease. Am. J. Physiol.-Gastrointest. Liver Physiol. 2015, 309, G71–G77. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mehdi, Y.; Hornick, J.L.; Istasse, L.; Dufrasne, I. Selenium in the environment, metabolism and involvement in body functions. Molecules 2013, 18, 3292–3311. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Patra, A.; Lalhriatpuii, M. Progress and Prospect of Essential Mineral Nanoparticles in Poultry Nutrition and Feeding-a Review. Biol. Trace Elem. Res. 2020, 197, 233–253. [Google Scholar] [CrossRef] [Scilit]
- Michalak, I.; Dziergowska, K.; Alagawany, M.; Farag, M.R.; El-Shall, N.A.; Tuli, H.S.; Emran, T.B.; Dhama, K. The effect of metal-containing nanoparticles on the health, performance and production of livestock animals and poultry. Vet. Q. 2022, 42, 68–94. [Google Scholar] [CrossRef] [Scilit]
- Zhang, T.; Qi, M.; Wu, Q.; Xiang, P.; Tang, D.; Li, Q. Recent research progress on the synthesis and biological effects of selenium nanoparticles. Front. Nutr. 2023, 10, 1183487. [Google Scholar] [CrossRef] [Scilit]
- Skalickova, S.; Milosavljevic, V.; Cihalova, K.; Horky, P.; Richtera, L.; Adam, V. Selenium nanoparticles as a nutritional supplement. Nutrition 2017, 33, 83–90. [Google Scholar] [CrossRef] [Scilit]
- Abdel-Hakeem, E.A.; Abdel-Hamid, H.A.; Abdel Hafez, S.M.N. The possible protective effect of Nano-Selenium on the endocrine and exocrine pancreatic functions in a rat model of acute pancreatitis. J. Trace Elem. Med. Biol. 2020, 60, 126480. [Google Scholar] [CrossRef] [Scilit]
- Kondaparthi, P.; Deore, M.; Naqvi, S.; Flora, S.J.S. Dose-dependent hepatic toxicity and oxidative stress on exposure to nano and bulk selenium in mice. Environ. Sci. Pollut. Res. Int. 2021, 28, 53034–53044. [Google Scholar] [CrossRef] [Scilit]
- Yin, Y.; Ahmed, N.; Hassan, M.F.; Guo, K.; Shakir, Y.; Zang, J.; Lyu, J. Effect of Nano-selenium on Biological Mechanism of Goblet Cells of the Small Intestine Within Laying Hen. Biol. Trace Elem. Res. 2024, 202, 1699–1710. [Google Scholar] [CrossRef] [Scilit]
- Liu, S.; Yu, H.; Li, P.; Wang, C.; Liu, G.; Zhang, X.; Zhang, C.; Qi, M.; Ji, H. Dietary nano-selenium alleviated intestinal damage of juvenile grass carp (Ctenopharyngodon idella) induced by high-fat diet: Insight from intestinal morphology, tight junction, inflammation, anti-oxidization and intestinal microbiota. Anim. Nutr. 2022, 8, 235–248. [Google Scholar] [CrossRef] [Scilit]
- Li, H.; Tang, Y.; Wang, H.; Liu, X.; Zeng, Y.; Zhang, R.; Yang, C.; Khan, A.; Wu, B.; Wang, X.; et al. Nano-selenium alleviated immunoresponse, apoptosis and oxidative stress in Leydig cells of yak. Colloids Surf. B Biointerfaces 2025, 252, 114684. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- GB 13883-2023; Determination of selenium in feeds. State Administration for Market Regulation (SAMR) and Standardization Administration of China (SAC): Beijing, China, 2023.
- Chang, J.; Pan, X.; Wei, W.; Jiang, X.; Che, L.; Lin, Y.; Zhuo, Y.; Feng, B.; Hua, L.; Li, J.; et al. Dietary inulin supplementation in early gestation regulates uterine fluid exosomes and angiogenesis to improve embryo implantation in sows. J. Anim. Sci. Biotechnol. 2025, 16, 111. [Google Scholar] [CrossRef] [Scilit]
- Mushtaq, A.; Li, L.; Anitha, A.; Grøndahl, L. Chitosan Nanomedicine in Cancer Therapy: Targeted Delivery and Cellular Uptake. Macromol. Biosci. 2021, 21, e2100005. [Google Scholar] [CrossRef] [Scilit]
- Pathak, R.; Bhatt, S.; Punetha, V.D.; Punetha, M. Chitosan nanoparticles and based composites as a biocompatible vehicle for drug delivery: A review. Int. J. Biol. Macromol. 2023, 253, 127369. [Google Scholar] [CrossRef] [Scilit]
- Kankariya, Y.; Chatterjee, B. Biomedical Application of Chitosan and Chitosan Derivatives: A Comprehensive Review. Curr. Pharm. Des. 2023, 29, 1311–1325. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cohen, E.; Poverenov, E. Hydrophilic Chitosan Derivatives: Synthesis and Applications. Chem. –A Eur. J. 2022, 28, e202202156. [Google Scholar] [CrossRef] [Scilit]
- Jafernik, K.; Ładniak, A.; Blicharska, E.; Czarnek, K.; Ekiert, H.; Wiącek, A.E.; Szopa, A. Chitosan-Based Nanoparticles as Effective Drug Delivery Systems-A review. Molecules 2023, 28, 1963. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, L.; Lin, X.; Chen, T.; Liu, K.; Chen, Y.; Yang, Z.; Liu, D.; Xu, G.; Wang, X.; Lin, G. Systematic evaluation of CdSe/ZnS quantum dots toxicity on the reproduction and offspring health in male BALB/c mice. Ecotoxicol. Environ. Saf. 2021, 211, 111946. [Google Scholar] [CrossRef] [Scilit]
- Song, Z.; Si, X.; Zhang, X.; Chen, J.; Jia, H.; He, Y.; Liu, H.; Kou, Z.; Dai, Z.; Wu, Z. Amuc Prevents Liver Inflammation and Oxidative Stress in Mice Challenged with Salmonella Typhimurium. J. Nutr. 2023, 153, 532–542. [Google Scholar] [CrossRef] [Scilit]
- Li, Z.; Li, X.; Cai, Z.; Jin, G.; Ahn, D.U.; Huang, X. Immunomodulatory effects of chicken soups prepared with the native cage-free chickens and the commercial caged broilers. Poult. Sci. 2022, 101, 102053. [Google Scholar] [CrossRef] [Scilit]
- Lu, X.; Guo, C.; Zhu, Y. Selenium-enriched crude polysaccharide from Rosa roxburghii Tratt ameliorates cadmium-induced acute kidney injury in mice by modulating intestinal microorganisms. Heliyon 2023, 9, e19678. [Google Scholar] [CrossRef] [Scilit]
- Attia, Y.; Abdalah, A.; Zeweil, H.; Bovera, F.; El-Din, A.T.; Araft, M. Effect of inorganic or organic selenium supplementation on productive performance, egg quality and some physiological traits of dual-purpose breeding hens. Czech J. Anim. Sci. 2010, 55, 505–519. [Google Scholar] [CrossRef] [Scilit]
- Ali, F.; Saeed, K.; Fatemeh, H. Nano-Bio Selenium Synthesized by Bacillus subtilis Modulates Broiler Performance, Intestinal Morphology and Microbiota, and Expression of Tight Junction’s Proteins. Biol. Trace Elem. Res. 2022, 200, 1811–1825. [Google Scholar] [CrossRef] [Scilit]
- Zhu, Y.; Shi, C.; Niu, Q.; Wang, J.; Zhu, W. Dynamic changes in morphology, gene expression and microbiome in the jejunum of compensatory-growth rats induced by protein restriction. Microb. Biotechnol. 2018, 11, 734–746. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Khan, I.; Zaneb, H.; Masood, S.; Ashraf, S.; Rehman, H.F.; Tahir, S.K.; Rehman, H.U.; Khan, A.; Taj, R.; Rahman, S.U.; et al. Supplementation of Selenium Nanoparticles-Loaded Chitosan Improves Production Performance, Intestinal Morphology, and Gut Microflora in Broiler Chickens. J. Poult. Sci. 2022, 59, 272–281. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lu, D.; Yao, D.; Hu, G.; Zhou, J.; Shen, X.; Qian, L. Maternal docosahexaenoic acid supplementation during lactation improves exercise performance, enhances intestinal glucose absorption and modulates gut microbiota in weaning offspring mice. Front. Nutr. 2024, 11, 1423576. [Google Scholar] [CrossRef] [Scilit]
- Xu, Z.R.; Hu, C.H.; Xia, M.S.; Zhan, X.A.; Wang, M.Q. Effects of dietary fructooligosaccharide on digestive enzyme activities, intestinal microflora and morphology of male broilers. Poult. Sci. 2003, 82, 1030–1036. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, A.W.; Lee, B.D.; Lee, S.K.; Lee, K.W.; An, G.H.; Song, K.B.; Lee, C.H. Effects of yeast (Saccharomyces cerevisiae) cell components on growth performance, meat quality, and ileal mucosa development of broiler chicks. Poult. Sci. 2005, 84, 1015–1021. [Google Scholar] [CrossRef] [Scilit]
- Li, R.; Liu, J.; Liu, M.; Liang, M.; Wang, Z.; Sha, Y.; Ma, H.; Lin, Y.; Li, B.; You, J.; et al. Effects of selenium-enriched yeast dietary supplementation on egg quality, gut morphology and caecal microflora of laying hens. Anim. Biotechnol. 2024, 35, 2258188. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rehman, H.F.u.; Zaneb, H.; Masood, S.; Yousaf, M.S.; Hayat, K.; Majeed, K.A.; Zeeshan, M.; Ashraf, S.; Khan, I.; Khan, A.; et al. Effect of Selenium Nanoparticles and Mannan Oligosaccharide Supplementation on Growth Performance, Stress Indicators, and Intestinal Microarchitecture of Broilers Reared under High Stocking Density. Animals 2022, 12, 2910. [Google Scholar] [CrossRef] [Scilit]
- Khajeh Bami, M.; Afsharmanesh, M.; Espahbodi, M.; Esmaeilzadeh, E. Effects of dietary nano-selenium supplementation on broiler chicken performance, meat selenium content, intestinal microflora, intestinal morphology, and immune response. J. Trace Elem. Med. Biol. 2022, 69, 126897. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Quinteiro-Filho, W.M.; Ribeiro, A.; Ferraz-de-Paula, V.; Pinheiro, M.L.; Sakai, M.; Sá, L.R.; Ferreira, A.J.; Palermo-Neto, J. Heat stress impairs performance parameters, induces intestinal injury, and decreases macrophage activity in broiler chickens. Poult. Sci. 2010, 89, 1905–1914. [Google Scholar] [CrossRef] [Scilit]
- He, X.; Lin, Y.; Lian, S.; Sun, D.; Guo, D.; Wang, J.; Wu, R. Selenium Deficiency in Chickens Induces Intestinal Mucosal Injury by Affecting the Mucosa Morphology, SIgA Secretion, and GSH-Px Activity. Biol. Trace Elem. Res. 2020, 197, 660–666. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Muhammad, A.I.; Mohamed, D.A.; Chwen, L.T.; Akit, H.; Samsudin, A.A. Effect of Selenium Sources on Laying Performance, Egg Quality Characteristics, Intestinal Morphology, Microbial Population and Digesta Volatile Fatty Acids in Laying Hens. Animals 2021, 11, 1681. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dalia, A.M.; Loh, T.C.; Sazili, A.Q.; Samsudin, A.A. Influence of bacterial organic selenium on blood parameters, immune response, selenium retention and intestinal morphology of broiler chickens. BMC Vet. Res. 2020, 16, 365. [Google Scholar] [CrossRef] [Scilit]
- Khambualai, O.; Yamauchi, K.; Tangtaweewipat, S.; Cheva-Isarakul, B. Growth performance and intestinal histology in broiler chickens fed with dietary chitosan. Br. Poult. Sci. 2009, 50, 592–597. [Google Scholar] [CrossRef] [Scilit]
- Celi, P.; Verlhac, V.; Calvo, E.P.; Schmeisser, J.; Kluenter, A.-M. Biomarkers of gastrointestinal functionality in animal nutrition and health. Anim. Feed Sci. Technol. 2019, 250, 9–31. [Google Scholar] [CrossRef] [Scilit]
- Sun, M.; He, C.; Cong, Y.; Liu, Z. Regulatory immune cells in regulation of intestinal inflammatory response to microbiota. Mucosal Immunol. 2015, 8, 969–978. [Google Scholar] [CrossRef] [Scilit]
- Tang, Y.L.; Sim, T.S.; Tan, K.S. Oral streptococci subvert the host innate immune response through hydrogen peroxide. Sci. Rep. 2022, 12, 656. [Google Scholar] [CrossRef] [Scilit]
- Groux, H.; O’Garra, A.; Bigler, M.; Rouleau, M.; Antonenko, S.; de Vries, J.E.; Roncarolo, M.G. A CD4+ T-cell subset inhibits antigen-specific T-cell responses and prevents colitis. Nature 1997, 389, 737–742. [Google Scholar] [CrossRef] [Scilit]
- McNamee, E.N.; Masterson, J.C.; Jedlicka, P.; McManus, M.; Grenz, A.; Collins, C.B.; Nold, M.F.; Nold-Petry, C.; Bufler, P.; Dinarello, C.A.; et al. Interleukin 37 expression protects mice from colitis. Proc. Natl. Acad. Sci. USA 2011, 108, 16711–16716. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sabat, R.; Grütz, G.; Warszawska, K.; Kirsch, S.; Witte, E.; Wolk, K.; Geginat, J. Biology of interleukin-10. Cytokine Growth Factor Rev. 2010, 21, 331–344. [Google Scholar] [CrossRef] [Scilit]
- Rusetskaya, N.Y.; Fedotov, I.V.; Koftina, V.A.; Borodulin, V.B. Selenium compounds in redox regulation of inflammation and apoptosis. Biochem. Moscow Suppl. Ser. B 2019, 13, 277–292. [Google Scholar] [CrossRef] [Scilit]
- Lu, J.; An, Y.; Wang, X.; Zhang, C.; Guo, S.; Ma, Y.; Qiu, Y.; Wang, S. Alleviating effect of chlorogenic acid on oxidative damage caused by hydrogen peroxide in bovine intestinal epithelial cells. J. Vet. Med. Sci. 2024, 86, 1016–1026. [Google Scholar] [CrossRef] [Scilit]
- Li, Z.; Huang, Z.; Jia, G.; Zhao, H.; Liu, G.; Chen, X. L-theanine attenuates H2O2-induced inflammation and apoptosis in IPEC-J2 cells via inhibiting p38 MAPK signaling pathway. Food Chem. Toxicol. 2024, 186, 114561. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yuan, Z.; Yang, M.; Liang, Z.; Yang, C.; Kong, X.; Wu, Y.; Wang, S.; Fan, H.; Ning, C.; Xiao, W.; et al. PI3K/AKT/mTOR, NF-κB and ERS pathway participated in the attenuation of H2O2-induced IPEC-J2 cell injury by koumine. J. Ethnopharmacol. 2023, 304, 116028. [Google Scholar] [CrossRef] [Scilit]
- Yan, Y.; Shi, Z.; Zhang, Y. Hierarchical multi-task deep learning-assisted construction of human gut microbiota reactive oxygen species-scavenging enzymes database. mSphere 2024, 9, e0034624. [Google Scholar] [CrossRef] [Scilit]
- Mitchell, J.P.; Carmody, R.J. NF-κB and the Transcriptional Control of Inflammation. Int. Rev. Cell Mol. Biol. 2018, 335, 41–84. [Google Scholar] [CrossRef] [Scilit]
- Mao, H.; Zhao, X.; Sun, S.-c. NF-κB in inflammation and cancer. Cell. Mol. Immunol. 2025, 22, 811–839. [Google Scholar] [CrossRef] [Scilit]
- Morgan, M.J.; Liu, Z.G. Crosstalk of reactive oxygen species and NF-κB signaling. Cell Res. 2011, 21, 103–115. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- He, Y.; Li, Z.; Xu, T.; Luo, D.; Chi, Q.; Zhang, Y.; Li, S. Polystyrene nanoplastics deteriorate LPS-modulated duodenal permeability and inflammation in mice via ROS drived-NF-κB/NLRP3 pathway. Chemosphere 2022, 307, 135662. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hayden, M.S.; West, A.P.; Ghosh, S. NF-κB and the immune response. Oncogene 2006, 25, 6758–6780. [Google Scholar] [CrossRef] [Scilit]
- Li, H.; Che, H.; Xie, J.; Dong, X.; Song, L.; Xie, W.; Sun, J. Supplementary selenium in the form of selenylation α-D-1,6-glucan ameliorates dextran sulfate sodium induced colitis in vivo. Int. J. Biol. Macromol. 2022, 195, 67–74. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tang, J.; Cao, L.; Jia, G.; Liu, G.; Chen, X.; Tian, G.; Cai, J.; Shang, H.; Zhao, H. The protective effect of selenium from heat stress-induced porcine small intestinal epithelial cell line (IPEC-J2) injury is associated with regulation expression of selenoproteins. Br. J. Nutr. 2019, 122, 1081–1090. [Google Scholar] [CrossRef] [Scilit]
- Kaur, R.; Thakur, S.; Rastogi, P.; Kaushal, N. Resolution of Cox mediated inflammation by Se supplementation in mouse experimental model of colitis. PLoS ONE 2018, 13, e0201356. [Google Scholar] [CrossRef] [Scilit]
- Tirosh, O.; Levy, E.; Reifen, R. High selenium diet protects against TNBS-induced acute inflammation, mitochondrial dysfunction, and secondary necrosis in rat colon. Nutrition 2007, 23, 878–886. [Google Scholar] [CrossRef] [Scilit]
- Alsulami, M.N.; El-Saadony, M.T. Supplementing broiler diets with bacterial selenium nanoparticles enhancing performance, carcass traits, blood indices, antioxidant status, and caecal microbiota of Eimeria tenella-infected broiler chickens. Poult. Sci. 2023, 102, 103111. [Google Scholar] [CrossRef] [Scilit]
- Abdel-Gaber, R.; Hawsah, M.A.; Al-Otaibi, T.; Alojayri, G.; Al-Shaebi, E.M.; Mohammed, O.B.; Elkhadragy, M.F.; Al-Quraishy, S.; Dkhil, M.A. Biosynthesized selenium nanoparticles to rescue coccidiosis-mediated oxidative stress, apoptosis and inflammation in the jejunum of mice. Front. Immunol. 2023, 14, 1139899. [Google Scholar] [CrossRef] [Scilit]
- Xu, Y.; Wang, X.C.; Jiang, W.; Chen, L.H.; Chen, T.; Wu, D.; Hu, J.N. Porphyra haitanensis polysaccharide-functionalized selenium nanoparticles for effective alleviation of ulcerative colitis. Int. J. Biol. Macromol. 2023, 253, 127570. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, Y.; Luo, C.; Li, S.; Liu, X.; Guo, Y.; Li, Y.; Wang, Y.; Yuan, J. Selenium nanoparticles promotes intestinal development in broilers by inhibiting intestinal inflammation and NLRP3 signaling pathway compared with other selenium sources. Poult. Sci. 2024, 103, 103958. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gao, X.; Zhang, Z.; Xing, H.; Yu, J.; Zhang, N.; Xu, S. Selenium Deficiency-Induced Inflammation and Increased Expression of Regulating Inflammatory Cytokines in the Chicken Gastrointestinal Tract. Biol. Trace Elem. Res. 2016, 173, 210–218. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lei, L.; Jing, M.; Yingce, Z.; Pei, Z.; Yun, L. Selenium deficiency causes oxidative stress and activates inflammation, apoptosis, and necroptosis in the intestine of weaned calves. Metallomics 2023, 15, mfad028. [Google Scholar] [CrossRef] [Scilit]
- Barrett, C.W.; Singh, K.; Motley, A.K.; Lintel, M.K.; Matafonova, E.; Bradley, A.M.; Ning, W.; Poindexter, S.V.; Parang, B.; Reddy, V.K.; et al. Dietary selenium deficiency exacerbates DSS-induced epithelial injury and AOM/DSS-induced tumorigenesis. PLoS ONE 2013, 8, e67845. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- He, Y.; Peng, L.; Zhao, X.; Fan, X.; Tang, X.; Shi, G.; Li, S. Selenium Deficiency Induces Inflammatory Response and Decreased Antimicrobial Peptide Expression in Chicken Jejunum Through Oxidative Stress. Biol. Trace Elem. Res. 2023, 201, 3461–3473. [Google Scholar] [CrossRef] [Scilit]
- Wang, G.; Jiang, Z.; Song, Y.; Xing, Y.; He, S.; Boomi, P. Gut microbiota contribution to selenium deficiency-induced gut-liver inflammation. BioFactors 2024, 50, 311–325. [Google Scholar] [CrossRef] [Scilit]
- Speckmann, B.; Steinbrenner, H. Selenium and selenoproteins in inflammatory bowel diseases and experimental colitis. Inflamm. Bowel Dis. 2014, 20, 1110–1119. [Google Scholar] [CrossRef] [Scilit]
- Bulteau, A.-L.; Chavatte, L. Update on selenoprotein biosynthesis. Antioxid. Redox Signal. 2015, 23, 775–794. [Google Scholar] [CrossRef] [Scilit]
- Labunskyy, V.M.; Hatfield, D.L.; Gladyshev, V.N. Selenoproteins: Molecular pathways and physiological roles. Physiol. Rev. 2014, 94, 739–777. [Google Scholar] [CrossRef] [Scilit]
- Kryukov, G.V.; Castellano, S.; Novoselov, S.V.; Lobanov, A.V.; Zehtab, O.; Guigó, R.; Gladyshev, V.N. Characterization of mammalian selenoproteomes. Science 2003, 300, 1439–1443. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Prabhu, K.S.; Lei, X.G. Selenium. Adv. Nutr. 2016, 7, 415–417. [Google Scholar] [CrossRef] [Scilit]
- Wickramasuriya, S.S.; Park, I.; Lee, Y.; Lillehoj, H.S. Effect of Dietary Organic Selenium on Growth Performance, Gut Health, and Coccidiosis Response in Broiler Chickens. Animals 2023, 13, 1560. [Google Scholar] [CrossRef] [Scilit]
- Sunde, R.A.; Raines, A.M. Selenium regulation of the selenoprotein and nonselenoprotein transcriptomes in rodents. Adv. Nutr. 2011, 2, 138–150. [Google Scholar] [CrossRef] [Scilit]
- Long, C.; Zhu, G.Y.; Sheng, X.H.; Xing, K.; Venema, K.; Wang, X.G.; Xiao, L.F.; Guo, Y.; Ni, H.M.; Zhu, N.H.; et al. Dietary supplementation with selenomethionine enhances antioxidant capacity and selenoprotein gene expression in layer breeder roosters. Poult. Sci. 2022, 101, 102113. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sun, H.; Zhao, L.; Xu, Z.J.; De Marco, M.; Briens, M.; Yan, X.H.; Sun, L.H. Hydroxy-Selenomethionine Improves the Selenium Status and Helps to Maintain Broiler Performances under a High Stocking Density and Heat Stress Conditions through a Better Redox and Immune Response. Antioxidants 2021, 10, 1542. [Google Scholar] [CrossRef] [Scilit]
- Pardechi, A.; Tabeidian, S.A.; Habibian, M. Comparative assessment of sodium selenite, selenised yeast and nanosized elemental selenium on performance response, immunity and antioxidative function of broiler chickens. Ital. J. Anim. Sci. 2020, 19, 1108–1121. [Google Scholar] [CrossRef] [Scilit]
- Kipp, A.; Banning, A.; van Schothorst, E.M.; Méplan, C.; Schomburg, L.; Evelo, C.; Coort, S.; Gaj, S.; Keijer, J.; Hesketh, J.; et al. Four selenoproteins, protein biosynthesis, and Wnt signalling are particularly sensitive to limited selenium intake in mouse colon. Mol. Nutr. Food Res. 2009, 53, 1561–1572. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Malyar, R.M.; Li, H.; Liu, D.; Abdulrahim, Y.; Farid, R.A.; Gan, F.; Ali, W.; Enayatullah, H.; Banuree, S.A.H.; Huang, K.; et al. Selenium/Zinc-Enriched probiotics improve serum enzyme activity, antioxidant ability, inflammatory factors and related gene expression of Wistar rats inflated under heat stress. Life Sci. 2020, 248, 117464. [Google Scholar] [CrossRef] [Scilit]
- Guevara Agudelo, F.A.; Leblanc, N.; Bourdeau-Julien, I.; St-Arnaud, G.; Lacroix, S.; Martin, C.; Flamand, N.; Veilleux, A.; Di Marzo, V.; Raymond, F. Impact of selenium on the intestinal microbiome-eCBome axis in the context of diet-related metabolic health in mice. Front. Immunol. 2022, 13, 1028412. [Google Scholar] [CrossRef] [Scilit]
- Schomburg, L.; Schweizer, U. Hierarchical regulation of selenoprotein expression and sex-specific effects of selenium. Biochim. et Biophys. Acta 2009, 1790, 1453–1462. [Google Scholar] [CrossRef] [Scilit]
- Carlson, B.A.; Xu, X.M.; Gladyshev, V.N.; Hatfield, D.L. Selective rescue of selenoprotein expression in mice lacking a highly specialized methyl group in selenocysteine tRNA. J. Biol. Chem. 2005, 280, 5542–5548. [Google Scholar] [CrossRef] [Scilit]
- Gan, F.; Ren, F.; Chen, X.; Lv, C.; Pan, C.; Ye, G.; Shi, J.; Shi, X.; Zhou, H.; Shituleni, S.A.; et al. Effects of selenium-enriched probiotics on heat shock protein mRNA levels in piglet under heat stress conditions. J. Agric. Food Chem. 2013, 61, 2385–2391. [Google Scholar] [CrossRef] [Scilit]
- Gan, F.; Chen, X.; Liao, S.F.; Lv, C.; Ren, F.; Ye, G.; Pan, C.; Huang, D.; Shi, J.; Shi, X.; et al. Selenium-enriched probiotics improve antioxidant status, immune function, and selenoprotein gene expression of piglets raised under high ambient temperature. J. Agric. Food Chem. 2014, 62, 4502–4508. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Maseko, T.; Dunshea, F.R.; Howell, K.; Cho, H.J.; Rivera, L.R.; Furness, J.B.; Ng, K. Selenium-enriched Agaricus bisporus mushroom protects against increase in gut permeability ex vivo and up-regulates glutathione peroxidase 1 and 2 in hyperthermally-induced oxidative stress in rats. Nutrients 2014, 6, 2478–2492. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ye, R.; Guo, Q.; Huang, J.; Wang, Z.; Chen, Y.; Dong, Y. Eucommia ulmoides polysaccharide modified nano-selenium effectively alleviated DSS-induced colitis through enhancing intestinal mucosal barrier function and antioxidant capacity. J. Nanobiotechnol. 2023, 21, 222. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hosnedlova, B.; Kepinska, M.; Skalickova, S.; Fernandez, C.; Ruttkay-Nedecky, B.; Peng, Q.; Baron, M.; Melcova, M.; Opatrilova, R.; Zidkova, J.; et al. Nano-selenium and its nanomedicine applications: A critical review. Int. J. Nanomed. 2018, 13, 2107–2128. [Google Scholar] [CrossRef] [Scilit]
- Te Velde, A.A.; Pronk, I.; de Kort, F.; Stokkers, P.C. Glutathione peroxidase 2 and aquaporin 8 as new markers for colonic inflammation in experimental colitis and inflammatory bowel diseases: An important role for H2O2? Eur. J. Gastroenterol. Hepatol. 2008, 20, 555–560. [Google Scholar] [CrossRef] [Scilit]
- Sherif, A.H.; Zommara, M.A. Selenium Nanoparticles Ameliorate Adverse Impacts of Aflatoxin in Nile Tilapia with Special Reference to Streptococcus agalactiae Infection. Biol. Trace Elem. Res. 2024, 202, 4767–4777. [Google Scholar] [CrossRef] [Scilit]
- He, Y.; Liu, Y.; Tang, J.; Jia, G.; Liu, G.; Tian, G.; Chen, X.; Cai, J.; Kang, B.; Zhao, H. Selenium exerts protective effects against heat stress-induced barrier disruption and inflammation response in jejunum of growing pigs. J. Sci. Food Agric. 2022, 102, 496–504. [Google Scholar] [CrossRef] [Scilit]
- Hrdina, J.; Banning, A.; Kipp, A.; Loh, G.; Blaut, M.; Brigelius-Flohé, R. The gastrointestinal microbiota affects the selenium status and selenoprotein expression in mice. J. Nutr. Biochem. 2009, 20, 638–648. [Google Scholar] [CrossRef] [Scilit]
- Kasaikina, M.V.; Kravtsova, M.A.; Lee, B.C.; Seravalli, J.; Peterson, D.A.; Walter, J.; Legge, R.; Benson, A.K.; Hatfield, D.L.; Gladyshev, V.N. Dietary selenium affects host selenoproteome expression by influencing the gut microbiota. FASEB J. 2011, 25, 2492–2499. [Google Scholar] [CrossRef] [Scilit]
- Miao, L.P.; Zhou, M.Y.; Zhang, X.Y.; Yuan, C.; Dong, X.Y.; Zou, X.T. Effect of excess dietary fluoride on laying performance and antioxidant capacity of laying hens. Poult. Sci. 2017, 96, 2200–2205. [Google Scholar] [CrossRef] [Scilit]
- Huang, D.; Ou, B.; Prior, R.L. The chemistry behind antioxidant capacity assays. J. Agric. Food Chem. 2005, 53, 1841–1856. [Google Scholar] [CrossRef] [Scilit]
- Han, B.; Yoon, S.; Su, J.; Han, H.; Wang, M.; Qu, W.; Zhong, D. Effects of selenium, copper and magnesium on antioxidant enzymes and lipid peroxidation in bovine fluorosis. Asian-Australas. J. Anim. Sci. 2004, 17, 1695–1699. [Google Scholar] [CrossRef] [Scilit]
- Unsal, V.; Dalkıran, T.; Çiçek, M.; Kölükçü, E. The Role of Natural Antioxidants Against Reactive Oxygen Species Produced by Cadmium Toxicity: A Review. Adv. Pharm. Bull. 2020, 10, 184–202. [Google Scholar] [CrossRef] [Scilit]
- Li, J.L.; Zhang, L.; Yang, Z.Y.; Zhang, Z.Y.; Jiang, Y.; Gao, F.; Zhou, G.H. Effects of Different Selenium Sources on Growth Performance, Antioxidant Capacity and Meat Quality of Local Chinese Subei Chickens. Biol. Trace Elem. Res. 2018, 181, 340–346. [Google Scholar] [CrossRef] [Scilit]
- Birben, E.; Sahiner, U.M.; Sackesen, C.; Erzurum, S.; Kalayci, O. Oxidative stress and antioxidant defense. World Allergy Organ J. 2012, 5, 9–19. [Google Scholar] [CrossRef] [Scilit]
- Xiao, J.; Cao, H.; Guo, S.; Xiao, S.; Li, N.; Li, M.; Wu, Y.; Liu, H. Long-term administration of low-dose selenium nanoparticles with different sizes aggravated atherosclerotic lesions and exhibited toxicity in apolipoprotein E-deficient mice. Chem. Biol. Interact. 2021, 347, 109601. [Google Scholar] [CrossRef] [Scilit]
- Bano, I.; Skalickova, S.; Arbab, S.; Urbankova, L.; Horky, P. Toxicological effects of nanoselenium in animals. J. Anim. Sci. Biotechnol. 2022, 13, 72. [Google Scholar] [CrossRef] [Scilit]
- Fernandes, A.P.; Gandin, V. Selenium compounds as therapeutic agents in cancer. Biochim. et Biophys. Acta 2015, 1850, 1642–1660. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, J.; Wang, H.; Yan, X.; Zhang, L. Comparison of short-term toxicity between Nano-Se and selenite in mice. Life Sci. 2005, 76, 1099–1109. [Google Scholar] [CrossRef] [Scilit]
- Deng, S.; Hu, S.; Xue, J.; Yang, K.; Zhuo, R.; Xiao, Y.; Fang, R. Productive Performance, Serum Antioxidant Status, Tissue Selenium Deposition, and Gut Health Analysis of Broiler Chickens Supplemented with Selenium and Probiotics-A Pilot Study. Animals 2022, 12, 1086. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhou, W.; Miao, S.; Zhu, M.; Dong, X.; Zou, X. Effect of Glycine Nano-Selenium Supplementation on Production Performance, Egg Quality, Serum Biochemistry, Oxidative Status, and the Intestinal Morphology and Absorption of Laying Hens. Biol. Trace Elem. Res. 2021, 199, 4273–4283. [Google Scholar] [CrossRef] [Scilit] [PubMed]












| Composition | Ingredient (g·kg−1) |
|---|---|
| Casein | 200 |
| Maltodextrin | 100 |
| Corn starch | 430.1 |
| Sucrose | 80 |
| Fat powder 1-extruded corn type | 100 |
| Microcrystalline cellulose | 50 |
| L-cystine | 3 |
| Calcium carbonate | 6 |
| Calcium hydrogen phosphate | 10 |
| Potassium citrate | 8 |
| Choline chloride, 50% | 2.6 |
| Vitamin 1 | 0.3 |
| Mineral element 2 | 10 |
| Total | 1000 |
| Gene Name | Sequence | Base Pair | Accession No. |
|---|---|---|---|
| β-actin | F: GGCTGTATTCCCCTCCATCG R: CCAGTTGGTAACAATGCCATGT | 154 | NM_007393 |
| IL-1β | F: GCAACTGTTCCTGAACTCAACT R: ATCTTTTGGGGTCCGTCAACT | 89 | NM_008361 |
| TNF-α | F: CCCTCACACTCAGATCATCTTCT R: GCTACGACGTGGGCTACAG | 61 | NM_013693 |
| NF-κB | F: ATGGCAGACGATGATCCCTAC R: TGTTGACAGTGGTATTTCTGGTG | 111 | NM_008689 |
| IL-10 | F: GCTCTTACTGACTGGCATGAG R: CGCAGCTCTAGGAGCATGTG | 105 | NM_010548 |
| TXNRD1 | F: CCCACTTGCCCCAACTGTT R: GGGAGTGTCTTGGAGGGAC | 134 | NM_001042523 |
| TXNRD2 | F: GATCCGGTGGCCTAGCTTG R: TCGGGGAGAAGGTTCCACAT | 86 | NM_013711 |
| GPX1 | F: AGTCCACCGTGTATGCCTTCT R: GAGACGCGACATTCTCAATGA | 105 | NM_008160 |
| GPX2 | F: GCCTCAAGTATGTCCGACCTG R: GGAGAACGGGTCATCATAAGGG | 143 | NM_030677 |
| GPX3 | F: CCTTTTAAGCAGTATGCAGGCA R: CAAGCCAAATGGCCCAAGTT | 120 | NM_008161 |
| GPX4 | F: GATGGAGCCCATTCCTGAACC R: CCCTGTACTTATCCAGGCAGA | 185 | NM_008162 |
| SOD | F: CAGACCTGCCTTACGACTATGG R: CTCGGTGGCGTTGAGATTGTT | 113 | NM_013671 |
| CAT | F: AGCGACCAGATGAAGCAGTG R: TCCGCTCTCTGTCAAAGTGTG | 181 | NM_009804 |
| Index | Treatments | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| C | SS | NS | CH | SSH | NSH | ||||||
| Liver | 0.044 ± 0.001 | 0.042 ± 0.002 | 0.044 ± 0.001 | 0.044 ± 0.001 | 0.042 ± 0.001 | 0.044 ± 0.001 | |||||
| Spleen | 0.0043 ± 0.0003 a | 0.0035 ± 0.0002 b | 0.0036 ± 0.0002 b | 0.0042 ± 0.0002 | 0.0038 ± 0.0003 | 0.0042 ± 0.0002 * | |||||
| Kidney | 0.0066 ± 0.0002 | 0.0064 ± 0.0003 | 0.0071 ± 0.0002 | 0.0070 ± 0.0002 | 0.0067 ± 0.0002 | 0.0065 ± 0.0002 | |||||
| Heart | 0.0050 ± 0.0001 | 0.0048 ± 0.0002 | 0.0050 ± 0.0002 | 0.0048 ± 0.0002 | 0.0047 ± 0.0002 | 0.0048 ± 0.0001 | |||||
| Pancreas | 0.0050 ± 0.0002 | 0.0048 ± 0.0002 | 0.0053 ± 0.0002 | 0.0049 ± 0.0002 | 0.0053 ± 0.0002 | 0.0049 ± 0.0003 | |||||
| C × SS × NS | CH × SSH × NSH | C × CH | SS × SSH | NS × NSH | |||||||
| p-value | η2-value (95% CI) | p-value | η2-value (95% CI) | p-value | g-value (95% CI) | p-value | g-value (95% CI) | p-value | g-value (95% CI) | ||
| Liver | 0.33 | 0.083 [0.004,0.44] | 0.67 | 0.031 [0.004,0.34] | 0.71 | 0.161 [−0.74,1.06] | 0.85 | −0.082 [−1.01,0.84] | 0.97 | −0.016 [−0.94,0.91] | |
| Spleen | 0.04 | 0.219 [0.036,0.52] | 0.38 | 0.070 [0.003,0.40] | 0.80 | 0.111 [−0.79,1.01] | 0.44 | −0.340 [−1.25,0.57] | 0.03 | −1.011 [−2.00,−0.02] | |
| Kidney | 0.12 | 0.147 [0.016,0.50] | 0.22 | 0.109 [0.011,0.44] | 0.23 | −0.533 [−1.45,0.38] | 0.33 | −0.443 [−1.38,0.50] | 0.05 | 0.891 [−0.06,1.84] | |
| Heart | 0.76 | 0.021 [0.003,0.31] | 0.76 | 0.021 [0.002,0.34] | 0.62 | 0.223 [−0.71,1.15] | 0.52 | 0.283 [−0.62,1.19] | 0.27 | 0.497 [−0.44,1.44] | |
| Pancreas | 0.31 | 0.085 [0.008,0.37] | 0.47 | 0.055 [0.004,0.32] | 0.73 | 0.151 [−0.75,1.05] | 0.13 | −0.702 [−1.66,0.25] | 0.28 | 0.479 [−0.43,1.39] | |
| Intestinal Structure | Antioxidant Index | Treatments | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| C | SS | NS | CH | SSH | NSH | |||||||
| Jejunum | T-SOD (U/mgprot) | 504.34 ± 20.92 | 546.17 ± 27.89 | 459.99 ± 26.23 | 490.07 ± 22.43 | 471.22 ± 35.11 | 451.84 ± 31.55 | |||||
| T-AOC (mmol/g) | 0.16 ± 0.01 a | 0.17 ± 0.01 a | 0.13 ± 0.01 b | 0.13 ± 0.00 * | 0.14 ± 0.01 | 0.13 ± 0.01 | ||||||
| CAT (U/mgprot) | 14.00 ± 1.76 | 14.74 ± 2.30 | 11.84 ± 1.93 | 11.57 ± 1.05 ab | 13.79 ± 1.84 a | 8.56 ± 1.12 b | ||||||
| MDA (nmol/mgprot) | 0.84 ± 0.07 | 0.97 ± 0.08 | 0.71 ± 0.10 | 0.95 ± 0.08 | 1.01 ± 0.14 | 0.80 ± 0.05 | ||||||
| Ileum | T-AOC (mmol/g) | 0.15 ± 0.01 | 0.14 ± 0.01 | 0.15 ± 0.02 | 0.14 ± 0.01 | 0.13 ± 0.02 | 0.15 ± 0.01 | |||||
| MDA (nmol/mgprot) | 2.75 ± 0.61 | 2.62 ± 0.62 | 2.34 ± 0.36 | 4.05 ± 0.68 | 5.76 ± 0.74 * | 4.76 ± 1.72 | ||||||
| Colon | T-SOD (U/mgprot) | 270.99 ± 9.87 b | 333.01 ± 17.33 a | 306.79 ± 11.94 ab | 277.64 ± 15.22 a | 202.51 ± 18.12 b* | 251.76 ± 21.25 ab* | |||||
| T-AOC (mmol/g) | 0.05 ± 0.00 | 0.05 ± 0.00 | 0.05 ± 0.01 | 0.06 ± 0.01 a | 0.04 ± 0.00 b* | 0.06 ± 0.00 a | ||||||
| MDA (nmol/mgprot) | 2.19 ± 0.54 | 2.78 ± 0.53 | 3.25 ± 0.89 | 2.35 ± 0.33 | 3.03 ± 0.75 | 2.13 ± 0.49 | ||||||
| C × SS × NS | CH × SSH × NSH | C × CH | SS × SSH | NS × NSH | ||||||||
| p-value | η2-value (95% CI) | p-value | η2-value (95% CI) | p-value | g-value (95% CI) | p-value | g-value (95% CI) | p-value | g-value (95% CI) | |||
| Jejunum | T-SOD | 0.07 | 0.181 [0.026,0.47] | 0.67 | 0.031 [0.004,0.35] | 0.65 | 0.204 [−0.72,1.13] | 0.11 | 0.741 [−0.22,1.70] | 0.85 | 0.086 [−0.84,1.01] | |
| T-AOC | 0.01 | 0.308 [0.087,0.61] | 0.80 | 0.051 [0.003,0.35] | 0.01 | 1.857 [0.77,2.95] | 0.06 | 0.668 [−0.29,1.62] | 0.83 | −0.096 [−1.02,0.83] | ||
| CAT | 0.58 | 0.040 [0.003,0.34] | 0.03 | 0.249 [0.047,0.60] | 0.25 | 0.509 [−0.41,1.42] | 0.76 | 0.140 [−0.86,1.14] | 0.16 | 0.628 [−0.30,1.55] | ||
| MDA | 0.10 | 0.168 [0.019,0.50] | 0.31 | 0.128 [0.016,0.56] | 0.28 | −0.473 [−1.39,0.44] | 0.78 | −0.140 [−1.21,0.93] | 0.29 | −0.377 [−1.31,0.56] | ||
| Ileum | T-AOC | 0.88 | 0.010 [0.002,0.29] | 0.71 | 0.029 [0.002,0.33] | 0.21 | 0.614 [−0.41,1.64] | 0.74 | 0.210 [−0.72,1.14] | 0.85 | −0.083 [−1.01,0.84] | |
| MDA | 0.96 | 0.011 [0.003,0.28] | 0.41 | 0.095 [0.010,0.49] | 0.16 | −0.646 [−1.63,0.34] | 0.01 | −1.600 [−2.84,−0.36] | 0.06 | −1.103 [−2.18,−0.03] | ||
| Colon | T-SOD | 0.02 | 0.285 [0.064,0.66] | 0.02 | 0.242 [0.081,0.54] | 0.88 | −0.157 [−1.06,0.74] | <0.01 | 2.229 [1.06,3.39] | 0.03 | 0.967 [0.01,1.92] | |
| T-AOC | 0.75 | 0.024 [0.003,0.37] | 0.01 | 0.323 [0.122,0.63] | 0.14 | −0.683 [−1.64,0.27] | 0.03 | 1.093 [0.06,2.13] | 0.41 | −0.372 [−1.31,0.56] | ||
| MDA | 0.59 | 0.069 [0.006,0.52] | 0.81 | 0.074 [0.004,0.56] | 0.79 | −0.147 [1.35,1.06] | 0.79 | −0.136 [−1.23,0.96] | 0.28 | 0.593 [−0.57,1.76] | ||
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mao, X.; Li, W.; Li, Y.; Jiang, X.; Zhang, R.; Che, L.; Zhuo, Y.; Sun, M.; Wang, X.; Wu, D.; et al. Effect of Nano-Selenium on Intestinal Oxidative Stress Induced by H2O2 in Mice. Antioxidants 2025, 14, 1073. https://doi.org/10.3390/antiox14091073
Mao X, Li W, Li Y, Jiang X, Zhang R, Che L, Zhuo Y, Sun M, Wang X, Wu D, et al. Effect of Nano-Selenium on Intestinal Oxidative Stress Induced by H2O2 in Mice. Antioxidants. 2025; 14(9):1073. https://doi.org/10.3390/antiox14091073
Chicago/Turabian StyleMao, Xiangyu, Wenyuan Li, Yuanyuan Li, Xuemei Jiang, Ruinan Zhang, Lianqiang Che, Yong Zhuo, Mengmeng Sun, Xianxiang Wang, De Wu, and et al. 2025. "Effect of Nano-Selenium on Intestinal Oxidative Stress Induced by H2O2 in Mice" Antioxidants 14, no. 9: 1073. https://doi.org/10.3390/antiox14091073
APA StyleMao, X., Li, W., Li, Y., Jiang, X., Zhang, R., Che, L., Zhuo, Y., Sun, M., Wang, X., Wu, D., & Xu, S. (2025). Effect of Nano-Selenium on Intestinal Oxidative Stress Induced by H2O2 in Mice. Antioxidants, 14(9), 1073. https://doi.org/10.3390/antiox14091073

