Xingkai Lake Topmouth Culter (Culter alburnus) Exhibits Biochemical and Histopathological Alterations upon Acute Ammonia Exposure
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Materials
2.2. Determination of LC50
2.3. Experiment of Acute Ammonia Exposure Design
2.4. Biochemical Analysis
2.5. Gene Expression Analysis
2.6. Terminal Deoxynucleotidyl Transferase-Mediated dUTP Nick End Labeling Assay (TUNEL)
2.7. Histopathology
2.8. Statistics
3. Results
3.1. Determination of 96 h Lethal Concentration (LC50) for C. alburnus Following Acute Ammonia Exposure
- NH4+ + NH3: The sum of the concentrations of ammonium ions and nonionic ammonia in water
- pKa: The negative logarithm of the acid dissociation constant for the ammonia dissociation reaction
- pH: Acid-base level of water
- T: Absolute temperature; t: Centigrade degree.
3.2. Oxidative Stress, Hepatic Function, and Antioxidant Markers in C. alburnus Liver Tissue Following Acute Ammonia Exposure
3.3. Effects of Acute Ammonia Exposure on the Expression of Heat Shock Proteins and Inflammatory Factors in C. alburnus Liver Tissue
3.4. Alterations in Apoptotic Gene Expression and Cellular Apoptosis in the Liver Tissue of C. alburnus After Acute Ammonia Exposure
3.5. Histopathological Alterations in the Liver Tissue of C. alburnus Following Acute Ammonia Exposure
4. Discussion
4.1. Ammonia Exposure Alters Hepatic Stress Hormones and Metabolic Indices
4.2. Ammonia Exposure Induces Hepatic Tissue Damage in C. alburnus
4.3. Ammonia Exposure Triggers Hepatic Oxidative Stress
4.4. Ammonia Exposure Modulates Hepatic Stress and Inflammatory Responses
4.4.1. Heat Shock Protein (Hsp) Regulation
4.4.2. Inflammatory Cytokine Responses
4.5. Ammonia Exposure Activates Hepatic Apoptosis via the P53-Bax/Bcl-Caspase Pathway
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Chen, Y.Y. Fauna Sinica Osteichthyes: Cypriniformes II; Science Press: Beijing, China, 1998; pp. 112–207. [Google Scholar]
- Yang, H.; Hou, X.; Zhou, L.; Kanika, N.H.; Zhang, G.Q.; Gong, G.W.; Zhang, Y.L.; Wang, J.; Wang, C.H. Adaptive evolution of different geographical populations of Culter alburnus. Aquac. Rep. 2024, 39, 102496. [Google Scholar] [CrossRef] [Scilit]
- Xia, B.; Hao, Q.; Xue, S.; Bing, H.; Yu, J.; Zhao, D.; Gao, C.; Ge, Y.; Liu, C. Geographical region traceability of wild topmouth culter (Culter alburnus) from Xingkai Lake based on muscle quality and aroma profiles. Food Chem. 2024, 438, 137979. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, K.; Xie, N.; Ma, H.J. Next-generation sequencing reveals the mitogenomic heteroplasmy in the topmouth culter (Culter alburnus Basilewsky, 1855). Mol. Biol. Rep. 2022, 49, 943–950. [Google Scholar] [CrossRef] [Scilit]
- Zhao, Y.; Xue, G.; Peng, Y.; Zhang, J.; Chen, F.; Wang, Y.; He, J.; Chen, J.; Xie, P. Ultrastructure and Transcriptomic Analysis Reveal Alternative Pathways of Zona Radiata Formation in Culter alburnus with Different Spawning Habits. Biology 2025, 14, 987. [Google Scholar] [CrossRef] [Scilit]
- Xue, H.; Gu, H.; Yang, L.; Chen, J.; Tang, W. Comparative Transcriptomics of Olfactory Rosettes Reveals Expression Divergence and Adaptive Evolution in Herbivorous and Carnivorous Xenocyprididae Fishes. Animals 2025, 15, 2741. [Google Scholar] [CrossRef] [Scilit]
- Liu, D.; Du, L.; Huang, Q.; Zhou, M.; Xiong, G.; Li, C.; Qiao, Y.; Wu, W. Effects of ultrasound treatment on muscle structure, volatile compounds, and small molecule metabolites of salted Culter alburnus fish. Ultrason. Sonochem. 2023, 97, 106440. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.L.; Song, L.; Liu, R.P.; Zhao, Z.B.; He, H.; Fan, Q.X.; Shen, Z.G. Effects of dietary protein and lipid levels on growth, body composition and flesh quality of juvenile topmouth culter, Culter alburnus Basilewsky. Aquac. Res. 2016, 47, 2633–2641. [Google Scholar] [CrossRef] [Scilit]
- Guo, M.J.; Xu, Z.K.; Zhang, H.Z.; Mei, J.; Xie, J. The effects of acute exposure to ammonia on oxidative stress, hematological parameters, flesh quality, and gill morphological changes of the large yellow croaker (Larimichthys crocea). Animals 2023, 13, 2534. [Google Scholar] [CrossRef] [Scilit]
- Long, X.R.; He, K.W.; Zhang, M.Z.; Li, M.; Wang, Z.L.; Wang, C.G.; Dong, X.H.; Shao, J.; Gan, L.; Hu, X.J.; et al. Temporal correlations of ferroptosis, inflammation and oxidative stress under acute ammonia exposure in brain tissue of yellow catfish (Pelteobagrus fulvidraco). Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2023, 271, 109693. [Google Scholar] [CrossRef] [Scilit]
- Nasr, M.; Youssef, M.; Alghamdi, A.A.A.; Alghamdi, A.H.; Khormi, M.A.; Aborasain, A.M.; Emeish, W.F.A.; Elkamel, A.A. Effects of ammonia exposure on the expression of IL-1β, CRH, and lep-a1 genes in common carp (Cyprinus carpio). BMC Vet. Res. 2025, 21, 383. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Guo, S.; Yang, L.; Xu, X. Assessing the Tolerance of Spotted Longbarbel Catfish as a Candidate Species for Aquaculture to Ammonia Nitrogen Exposure. Animals 2025, 15, 2035. [Google Scholar] [CrossRef] [Scilit]
- Sun, Y.; Fu, Z.; Ma, Z. The effects of acute ammonia stress on liver antioxidant, immune and metabolic responses of juvenile yellowfin tuna (Thunnus albacares). Comparative biochemistry and physiology. Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 2024, 297, 111707. [Google Scholar] [CrossRef] [Scilit]
- Li, Y.; Yang, R.; He, M.; Su, J.; Liu, L. Chronic Ammonia Stress in Chinese Perch (Siniperca chuatsi): Oxidative Response, Nitrogen Metabolism, and Multi-Enzyme-Mediated Molecular Detoxification Defense Mechanisms. Antioxidants 2025, 14, 768. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, W.X.; Xia, B.H.; Zou, Y.N.; Xiang, Y.F.; Shen, Z.T.; Xue, S.Q. Protective effect of dietary dandelion (Taraxacum officinale) extract on common carp under acute ammonia stress. Aquac. Rep. 2023, 30, 101609. [Google Scholar] [CrossRef] [Scilit]
- Gyamfi, S.; Edziyie, R.E.; Obirikorang, K.A.; Adjei-Boateng, D.; Skov, P.V. Nile tilapia (Oreochromis niloticus) show high tolerance to acute ammonia exposure but lose metabolic scope during prolonged exposure at low concentration. Aquat. Toxicol. 2024, 271, 106932. [Google Scholar] [CrossRef] [Scilit]
- Zhang, T.; Zhou, Y.; Wen, H.; Ma, X.; Xu, D. Integrated analysis of physiological, transcriptome, and metabolome analyses of the gills in Solenaia oleivora under ammonia exposure. Ecotoxicol. Environ. Saf. 2024, 271, 115949. [Google Scholar] [CrossRef] [Scilit]
- Elshopakey, G.E.; Mahboub, H.H.; Sheraiba, N.I.; Abduljabbar, M.H.; Mahmoud, Y.K.; Abomughaid, M.M.; Ismail, A.K. Ammonia toxicity in Nile tilapia: Potential role of dietary baicalin on biochemical profile, antioxidant status and inflammatory gene expression. Aquac. Rep. 2023, 28, 101434. [Google Scholar] [CrossRef] [Scilit]
- Xue, S.Q.; Xia, B.H.; Zhang, B.T.; Li, L.Y.; Zou, Y.N.; Shen, Z.T.; Xiang, Y.F.; Han, Y.; Chen, W.X. Mannan oligosaccharide (MOS) on growth performance, immunity, inflammatory and antioxidant responses of the common carp (Cyprinus carpio) under ammonia stress. Front. Mar. Sci. 2022, 9, 1062597. [Google Scholar] [CrossRef] [Scilit]
- Spencer, E.L.; Fitzgibbon, Q.P.; Day, R.D.; Trotter, A.J.; Smith, G.G. Effects of acute salinity stress on the survival and haemolymph biochemistry of juvenile tropical rock lobster, Panulirus ornatus, at different moult stages. Aquaculture 2023, 573, 739597. [Google Scholar] [CrossRef] [Scilit]
- Li, J.N.; Fan, Z.; Wu, D.; Wang, L.S.; Wang, C.A.; Liu, H.B.; Han, S.C. Effects of arginine supplementation in high-carbohydrate diets on the growth, hematological parameters, and hepatic and skeletal muscle glucose metabolism of juvenile mirror carp (Cyprinus carpio) based on PI3K/Akt signaling pathway. Aquac. Rep. 2024, 39, 102409. [Google Scholar] [CrossRef] [Scilit]
- Lu, Y.L.; Zhang, J.Y.; Zhang, J.Y.; Cao, J.W.; Liu, P.; Liu, P.; Li, J.; Meng, X.L. Long-term ammonia toxicity in the hepatopancreas of swimming crab Portunus trituberculatus: Cellular stress response and tissue damage. Front. Mar. Sci. 2022, 8, 757602. [Google Scholar] [CrossRef] [Scilit]
- Sarda, N.; Burton, G. Ammonia variation in sediments: Spatial, temporal and method-related effects. Environ. Toxicol. Chem. 1995, 14, 1499–1506. [Google Scholar] [CrossRef]
- Twitchen, I.; Eddy, F. Effects of ammonia on sodium balance in juvenile rainbow trout Oncorhynchus mykiss Walbaum. Aquat. Toxicol. 1994, 30, 27–45. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.; Chen, L.J.; Dai, T.J.; Sun, R.H.; Wen, D.H. Ammonia manipulates the ammonia-oxidizing archaea and bacteria in the coastal sediment-water microcosms. Appl. Microbiol. Biot. 2015, 99, 6481–6491. [Google Scholar] [CrossRef] [Scilit]
- Molayemraftar, T.; Peyghan, R.; Razi Jalali, M.; Shahriari, A. Single and combined effects of ammonia and nitrite on common carp, Cyprinus carpio: Toxicity, hematological parameters, antioxidant defenses, acetylcholinesterase, and acid phosphatase activities. Aquaculture 2022, 548, 737676. [Google Scholar] [CrossRef] [Scilit]
- Wang, H.J.; Xiao, X.C.; Wang, H.Z.; Li, Y.; Yu, Q.; Liang, X.M.; Feng, W.S.; Shao, J.C.; Rybicki, M.; Jungmann, D. Effects of high ammonia concentrations on three cyprinid fish: Acute and whole-ecosystem chronic tests. Sci. Total Environ 2017, 598, 900–909. [Google Scholar] [CrossRef] [Scilit]
- Refaey, M.M.; Li, D.P. Transport stress changes blood biochemistry, antioxidant defense system, and hepatic hsps mrna expressions of channel catfish ictalurus punctatus. Front. Physiol. 2018, 9, 1628. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liew, H.J.; Sinha, A.K.; Nawata, C.M.; Blust, R.; Wood, C.M.; De Boeck, G. Differential responses in ammonia excretion, sodium fluxes and gill permeability explain different sensitivities to acute high environmental ammonia in three freshwater teleosts. Aquat. Toxicol. 2013, 126, 63–76. [Google Scholar] [CrossRef] [Scilit]
- Zarantoniello, M.; Bortoletti, M.; Olivotto, I.; Ratti, S.; Poltronieri, C.; Negrato, E.; Caberlotto, S.; Radaelli, G.; Bertotto, D. Salinity, Temperature and Ammonia Acute Stress Response in Seabream (Sparus aurata) Juveniles: A Multidisciplinary Study. Animals 2021, 11, 97. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, X.N.; Ma, A.J. Dissection of genotype × tissue interactions for immunological factors in turbot (Scophthalmus maximus) infected with Vibrio anguillarum. Fish Shellfish Immunol. 2021, 119, 60–66. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ruyet, J.P.L.; Boeuf, G.; Infante, J.Z.; Helgason, S.; Roux, A.L. Short-term physiological changes in turbot and seabream juveniles exposed to exogenous ammonia. Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 1998, 119, 511–518. [Google Scholar] [CrossRef] [Scilit]
- He, M.; Fang, D.A.; Chen, Y.J.; Sun, H.B.; Luo, H.; Ren, Y.F.; Li, T.Y. Genetic Diversity Evaluation and Conservation of Topmouth Culter (Culter alburnus) Germplasm in Five River Basins in China. Biology 2022, 12, 12. [Google Scholar] [CrossRef] [Scilit]
- Chai, Y.H.; Peng, R.B.; Jiang, M.W.; Jiang, X.M.; Han, Q.X.; Han, Z.R. Effects of ammonia nitrogen stress on the blood cell immunity and liver antioxidant function of Sepia pharaonis. Aquaculture 2022, 546, 737417. [Google Scholar] [CrossRef] [Scilit]
- Paust, L.O.; Foss, A.; Imsland, A.K. Effects of chronic and periodic exposure to ammonia on growth, food conversion efficiency and blood physiology in juvenile Atlantic halibut (Hippoglossus hippoglossus L.). Aquaculture 2011, 315, 400–406. [Google Scholar] [CrossRef] [Scilit]
- Li, Y.T.; Pan, L.; Zeng, X.Y.; Zhang, R.X.; Li, X.; Li, J.H.; Xing, H.J.; Bao, J. Ammonia exposure causes the imbalance of the gut-brain axis by altering gene networks associated with oxidative metabolism, inflammation and apoptosis. Ecotoxicol. Environ. Saf. 2021, 224, 112668. [Google Scholar] [CrossRef] [Scilit]
- Hoseini, S.M.; Gharavi, B.; Mirghaed, A.T.; Hoseinifar, S.H.; Van Doan, H. Effects of dietary phytol supplementation on growth performance, immunological parameters, antioxidant and stress responses to ammonia exposure in common carp, Cyprinus carpio (Linnaeus, 1758). Aquaculture 2021, 545, 737151. [Google Scholar] [CrossRef] [Scilit]
- Motamedi-Tehrani, J.; Peyghan, R.; Shahriari, A. The influence of ammonia-N and salinity levels on oxidative stress markers, hepatic enzymes, and acid phosphatase activity in Nile tilapia (Oreochromis niloticus). Sci. Rep. 2025, 15, 559. [Google Scholar] [CrossRef] [Scilit]
- Xiong, H.L.; Wang, Z.J. Micro-and Untra-structure of Culter alburnus Liver. J. Southwest Univ. Nat. Sci. Ed. 2011, 33, 50–56. [Google Scholar]
- de Farias, N.O.; Oliveira, R.; Moretti, P.N.S.; E Pinto, J.M.; Oliveira, A.C.; Santos, V.L.; Rocha, P.S.; Andrade, T.S.; Grisolia, C.K. Fluoxetine chronic exposure affects growth, behavior and tissue structure of zebrafish. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2020, 237, 108836. [Google Scholar] [CrossRef] [Scilit]
- Paulino, M.G.; Tavares, D.; Bieczynski, F.; Pedrão, P.G.; Souza, N.E.S.; Sakuragui, M.M.; Luquet, C.M.; Terezan, A.P.; Fernandes, J.B.; Giani, A.; et al. Crude extract of cyanobacteria (Radiocystis fernandoi, strain R28) induces liver impairments in fish. Aquat. Toxicol. 2017, 182, 91–101. [Google Scholar] [CrossRef] [Scilit]
- Benli, A.C.; Köksal, G.; Ozkul, A. Sublethal ammonia exposure of Nile tilapia (Oreochromis niloticus L.): Effects on gill, liver and kidney histology. Chemosphere 2008, 72, 1355–1358. [Google Scholar] [CrossRef] [Scilit]
- Banihashemi, E.S.; Khara, H.; Pajand, Z.; Rahnandeh, M. Histopathological study of gill, kidney and liver of Persian Sturgeon (Acipenser persicus Borodin, 1897) and Stellate (Acipenser stellatus Pallas, 1811) exposed to sublethal concentration of un-ionised ammonia UAN. J. Parasit. Dis. 2016, 40, 1443–1450. [Google Scholar] [CrossRef] [Scilit]
- Zou, Y.N.; Chen, W.X.; Xia, B.H.; Xiang, Y.F.; Shen, Z.T.; Han, Y.; Xue, S.Q. Ammonia Toxicity in the Bighead Carp (Aristichthys nobilis): Hematology, Antioxidation, Immunity, Inflammation and Stress. Toxics 2023, 11, 243. [Google Scholar] [CrossRef] [Scilit]
- Jia, R.; Liu, B.L.; Han, C.; Huang, B.; Lei, J.L. Effects of ammonia exposure on stress and immune response in juvenile turbot (Scophthalmus maximus). Aquac. Res. 2017, 48, 3149–3162. [Google Scholar] [CrossRef] [Scilit]
- He, K.W.; Luo, X.P.; Wen, M.; Wang, C.A.; Qin, C.J.; Shao, J.; Gan, L.; Dong, R.R.; Jiang, H.B. Effect of acute ammonia toxicity on inflammation, oxidative stress and apoptosis in head kidney macrophage of Pelteobagrus fulvidraco and the alleviation of curcumin. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2021, 248, 109098. [Google Scholar] [CrossRef] [Scilit]
- Yousefi, M.; Vatnikov, Y.A.; Kulikov, E.V.; Plushikov, V.G.; Drukovsky, S.G.; Hoseinifar, S.H.; Doan, H.V. The protective effects of dietary garlic on common carp (Cyprinus carpio) exposed to ambient ammonia toxicity. Aquaculture 2020, 526, 735400. [Google Scholar] [CrossRef] [Scilit]
- Zhang, C.N.; Tian, H.Y.; Li, X.F.; Zhu, J.; Cai, D.S.; Xu, C.; Wang, F.; Zhang, D.D.; Liu, W.B. The effects of fructooligosaccharide on the immune response, antioxidant capability and Hsp70 and Hsp90 expressions in blunt snout bream (Megalobrama amblycephala Yih) under high heat stress. Aquaculture 2014, 433, 458–466. [Google Scholar] [CrossRef] [Scilit]
- Long, S.S.; Dong, X.H.; Tan, B.P.; Zhang, S.; Chi, S.Y.; Yang, Q.H.; Liu, H.Y.; Xie, S.W.; Deng, J.M.; Yang, Y.Z.; et al. The antioxidant ability, histology, proximate, amino acid and fatty acid compositions, and transcriptome analysis of muscle in juvenile hybrid grouper (female Epinephelus fuscoguttatus x male Epinephelus lanceolatus) fed with oxidized fish oil. Aquaculture 2022, 547, 737510. [Google Scholar] [CrossRef] [Scilit]
- Zhang, T.X.; Yan, Z.G.; Zheng, X.; Wang, S.P.; Fan, J.T.; Liu, Z.T. Effects of acute ammonia toxicity on oxidative stress, DNA damage and apoptosis in digestive gland and gill of Asian clam (Corbicula fluminea). Fish Shellfish Immunol. 2020, 99, 514–525. [Google Scholar] [CrossRef] [Scilit]
- Li, Y.D.; Zhou, F.L.; Huang, J.H.; Yang, L.S.; Jiang, S.; Yang, Q.B.; He, J.G.; Jiang, S.G. Transcriptome reveals involvement of immune defense, oxidative imbalance, and apoptosis in ammonia-stress response of the black tiger shrimp (Penaeus monodon). Fish. Shellfish. Immun. 2018, 83, 162–170. [Google Scholar] [CrossRef] [Scilit]
- Kim, J.H.; Cho, J.H.; Kim, S.R.; Hur, Y.B. Toxic effects of waterborne ammonia exposure on hematological parameters, oxidative stress and stress indicators of juvenile hybrid grouper, Epinephelus lanceolatus male x Epinephelus fuscoguttatus female. Environ. Toxicol. Phar. 2020, 80, 103453. [Google Scholar] [CrossRef] [Scilit]
- Hangzo, H.; Banerjee, B.; Saha, S.; Saha, N.A. Ammonia stress under high environmental ammonia induces Hsp70 and Hsp90 in the mud eel, Monopterus cuchia. Fish Physiol. Biochem. 2017, 43, 77–88. [Google Scholar] [CrossRef] [Scilit]
- Dong, X.X.; Liu, Q.G.; Zhao, W.H.; Ou, J.T.; Jiang, F.J.; Guo, H.S.; Lv, L.L. Effects of ammonia-N stress on the antioxidant enzymes, heat shock proteins, and apoptosis-related genes of Macrobrachium rosenbergii. Ital. J. Anim. Sci. 2021, 20, 453–464. [Google Scholar] [CrossRef] [Scilit]
- Cheng, C.H.; Yang, F.F.; Ling, R.Z.; Liao, S.A.; Miao, Y.T.; Ye, C.X.; Wang, A.L. Effects of ammonia exposure on apoptosis, oxidative stress and immune response in pufferfish (Takifugu obscurus). Aquat. Toxicol. 2015, 164, 61–71. [Google Scholar] [CrossRef] [Scilit]
- Basu, N.; Nakano, T.; Grau, E.G.; Iwama, G.K. The effects of cortisol on heat shock protein 70 levels in two fish species. Gen. Comp. Endocr. 2001, 124, 97–105. [Google Scholar] [CrossRef] [Scilit]
- Lindquist, S. The heat-shock response. Annu. Rev. Biochem. 1986, 55, 1151–1191. [Google Scholar] [CrossRef]
- Wadekar, S.A.; Li, D.; Periyasamy, S.; Sánchez, E.R. Inhibition of Heat Shock Transcription Factor by GR. Mol. Endocrinol. 2001, 15, 1396–1410. [Google Scholar] [CrossRef]
- Celi, M.; Vazzana, M.; Sanfratello, M.A.; Parrinello, N. Elevated cortisol modulates Hsp70 and Hsp90 gene expression and protein in sea bass head kidney and isolated leukocytes. Gen. Comp. Endocr. 2012, 175, 424–431. [Google Scholar] [CrossRef] [Scilit]
- Li, Z.H.; Li, P. Effects of tributyltin on the blood parameters, immune responses and thyroid hormone system in zebrafish. Environ. Pollut. 2021, 268, 115707. [Google Scholar] [CrossRef] [Scilit]
- Zhang, T.X.; Zhang, Y.; Xu, J.Y.; Yan, Z.G.; Sun, Q.H.; Huang, Y.; Wang, S.P.; Li, S.; Sun, B.B. Toxic effects of ammonia on the intestine of the Asian clam (Corbicula fluminea). Environ. Pollut. 2021, 287, 117617. [Google Scholar] [CrossRef] [Scilit]
- Yousefi, M.; Vatnikov, Y.A.; Kulikov, E.V.; Ahmadifar, E.; Mirghaed, A.T.; Hoseinifar, S.H.; Doan, H.V. Effects of dietary Hibiscus sabdariffa supplementation on biochemical responses and inflammatory-related genes expression of rainbow trout, Oncorhynchus mykiss, to ammonia toxicity. Aquaculture 2021, 533, 736095. [Google Scholar] [CrossRef] [Scilit]
- Dar, S.A.; Srivastava, P.P.; Varghese, T.; Nazir, M.I.; Gupta, S.; Krishna, G. Temporal changes in superoxide dismutase, catalase, and heat shock protein 70 gene expression, cortisol and antioxidant enzymes activity of Labeo rohita fingerlings subjected to starvation and refeeding. Gene 2019, 692, 94–101. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, S.D.; Meng, F.X.; Liu, Y.; Xia, S.L.; Wang, R.X. Exogenous inositol ameliorates the effects of acute ammonia toxicity on intestinal oxidative status, immune response, apoptosis, and tight junction barriers of great blue-spotted mudskippers (Boleophthalmus pectinirostris). Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2021, 240, 108911. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Guicciardi, M.E.; Malhi, H.; Mott, J.L.; Gores, G.J. Apoptosis and Necrosis in the Liver. Compr. Physiol. 2013, 3, 977–1010. [Google Scholar] [CrossRef] [Scilit]






| Accession No. | Amplicon Size (bp) | Gene | Primer | Primer Efficiency (%) | R2 |
|---|---|---|---|---|---|
| XM_042754349.1 | 134 | P53 F | GCCCATCCTCACAATCATCACTCTG | 96.7 | 0.996 |
| P53 R | CCTGGTCTTTCCTGAAGTTGCTCTC | 96.7 | 0.996 | ||
| KJ174685.1 | 135 | Bax F | TCTACTTTGCGTGTCGGCTTGTC | 102.2 | 0.998 |
| Bax R | TCCATCCACCCTGTTCCCTGATC | 102.2 | 0.998 | ||
| XM_019067767.2 | 131 | Bcl-2 F | CGAGTTTGGAGGGACCGTTTGTG | 94.5 | 0.995 |
| Bcl-2 R | AGCCGCCGTTCTCCTGGATC | 94.5 | 0.995 | ||
| XM_042755485.1 | 128 | TNF-α F | GACCAGAACAACAGGGAGCACATC | 98.2 | 0.999 |
| TNF-α R | AGTTTGGAGAGAGGGCAGAAGAGAG | 98.2 | 0.999 | ||
| XM_042766262.1 | 80 | IL-10 F | TCTCAAGCGGGATATGCGGAAATG | 101.6 | 0.999 |
| IL-10 R | ACGAGTTCTTTATGCTGGCGATCTC | 101.6 | 0.999 | ||
| JN544930.1 | 137 | Hsp70 F | CACCAATGACAAGGGCAGACTGAG | 95.8 | 0.995 |
| Hsp70 R | TGTTGAAGGCGTAGGACTCCAGAG | 95.8 | 0.995 | ||
| XM_042721808.1 | 104 | Hsp90 F | AACTCACGGACACCAAAGCATACG | 101.9 | 0.998 |
| Hsp90 R | CTCCTCTTCTGGCTCTTCCTCTACC | 101.9 | 0.998 | ||
| KF055462.1 | 81 | Caspase-3 F | ACACAACAGATGCTGGTAAGGATGG | 99.3 | 0.996 |
| Caspase-3 R | GACTGTACCTGTAGGCATGTGACTG | 99.3 | 0.996 |
| TAN (mg/L) * | CNH3 (mg/L) * | Total Amount | Total Deaths | CMR (%) * |
|---|---|---|---|---|
| 26.68 | 1.89 | 30 | 3 | 10 |
| 30.94 | 2.19 | 30 | 8 | 26.67 |
| 35.89 | 2.54 | 30 | 15 | 50 |
| 41.63 | 2.95 | 30 | 21 | 70 |
| 48.28 | 3.42 | 30 | 28 | 93.33 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yu, J.; Yang, H.; Cai, G.; Xu, J.; Xia, B.; Sun, Y. Xingkai Lake Topmouth Culter (Culter alburnus) Exhibits Biochemical and Histopathological Alterations upon Acute Ammonia Exposure. Antioxidants 2025, 14, 1318. https://doi.org/10.3390/antiox14111318
Yu J, Yang H, Cai G, Xu J, Xia B, Sun Y. Xingkai Lake Topmouth Culter (Culter alburnus) Exhibits Biochemical and Histopathological Alterations upon Acute Ammonia Exposure. Antioxidants. 2025; 14(11):1318. https://doi.org/10.3390/antiox14111318
Chicago/Turabian StyleYu, Junfei, Hongling Yang, Guohe Cai, Jianming Xu, Banghua Xia, and Yunzhang Sun. 2025. "Xingkai Lake Topmouth Culter (Culter alburnus) Exhibits Biochemical and Histopathological Alterations upon Acute Ammonia Exposure" Antioxidants 14, no. 11: 1318. https://doi.org/10.3390/antiox14111318
APA StyleYu, J., Yang, H., Cai, G., Xu, J., Xia, B., & Sun, Y. (2025). Xingkai Lake Topmouth Culter (Culter alburnus) Exhibits Biochemical and Histopathological Alterations upon Acute Ammonia Exposure. Antioxidants, 14(11), 1318. https://doi.org/10.3390/antiox14111318

