6-O-trans-feruloyl Catalpol, a Natural Antioxidant from the Stem Bark of Catalpa ovata, Accelerates Liver Regeneration In Vivo via Activation of Hepatocyte Proliferation Signaling Pathways
Abstract
1. Introduction
2. Matrrials and Methods
2.1. Animals and Drug Administration
2.2. Surgical Procedures
2.3. Biochemical Assays
2.4. RNA Isolation
2.5. Reverse Transcription Polymerase Chain Reaction (RT-PCR) and Quantitative Real Time PCR (qPCR)
2.6. Immunoblot Analysis
2.7. Cell Culture
2.8. Cell Proliferation Assay
2.9. Statistical Analysis
2.10. Materials
3. Results
3.1. 6FC Promotes Liver Regeneration After 2/3 PHx in Mice
3.2. 6FC Activates Cell Cycle Regulatory Proteins After 2/3 PHx in Mice
3.3. 6FC Modulates NF-κB and STAT3 Pathways During Liver Regeneration
3.4. 6FC Enhances Early Gene Expression Involved in Liver Regeneration Following 2/3 PHx in Mice
3.5. 6FC Activates Redox-Sensitive Akt and MAPK Signaling Pathways During Liver Regeneration
3.6. 6FC Promotes Hepatocyte Proliferation In Vitro Through Redox-Sensitive Signaling Pathways
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
References
- Alizai, P.H.; Bertram, L.; Fragoulis, A.; Wruck, C.J.; Kroy, D.C.; Klinge, U.; Neumann, U.P.; Schmeding, M. In vivo imaging of antioxidant response element activity during liver regeneration after partial hepatectomy. J. Surg. Res. 2016, 206, 525–535. [Google Scholar] [CrossRef]
- Shimizu, T.; Togo, S.; Kumamoto, T.; Makino, H.; Morita, T.; Tanaka, K.; Kubota, T.; Ichikawa, Y.; Nagasima, Y.; Okazaki, Y.; et al. Gene expression during liver regeneration after partial hepatectomy in mice lacking type 1 tumor necrosis factor receptor. J. Surg. Res. 2009, 152, 178–188. [Google Scholar] [CrossRef]
- Taub, R. Liver regeneration: From myth to mechanism. Nat. Rev. Mol. Cell Biol. 2004, 5, 836–847. [Google Scholar] [CrossRef] [PubMed]
- Clavien, P.A.; Petrowsky, H.; DeOliveira, M.L.; Graf, R. Strategies for safer liver surgery and partial liver transplantation. N. Engl. J. Med. 2007, 356, 1545–1559. [Google Scholar] [CrossRef]
- Bachellier, P.; Rosso, E.; Pessaux, P.; Oussoultzoglou, E.; Nobili, C.; Panaro, F.; Jaeck, D. Risk factors for liver failure and mortality after hepatectomy associated with portal vein resection. Ann. Surg. 2011, 253, 173–179. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Ma, X.; Huang, T.; Chen, X.; Li, Q.; Liao, M.; Fu, L.; Huang, J.; Yuan, K.; Wang, Z.; Zeng, Y. Molecular mechanisms in liver repair and regeneration: From physiology to therapeutics. Signal Transduct. Target. Ther. 2025, 10, 63. [Google Scholar] [CrossRef]
- Okay, E.; Simsek, T.; Subasi, C.; Gunes, A.; Duruksu, G.; Gurbuz, Y.; Gacar, G.; Karaoz, E. Cross effects of resveratrol and mesenchymal stem cells on liver regeneration and homing in partially hepatectomized rats. Stem Cell Rev. 2015, 11, 322–331. [Google Scholar] [CrossRef]
- Mandic, P.; Lestarevic, S.; Filipovic, T.; Savic, S.; Stevic, S.; Kostic, M. The effects of quercetin on liver regeneration after liver resection in rats. Folia Morphol. 2016, 75, 188–195. [Google Scholar] [CrossRef] [PubMed]
- Xu, J.; Yang, Y. Traditional Chinese medicine in the Chinese health care system. Health Policy 2009, 90, 133–139. [Google Scholar] [CrossRef]
- Xu, L.; Gu, L.; Tao, X.; Xu, Y.; Qi, Y.; Yin, L.; Han, X.; Peng, J. Effect of dioscin on promoting liver regeneration via activating Notch1/Jagged1 signal pathway. Phytomedicine 2018, 38, 107–117. [Google Scholar] [CrossRef]
- Jin, Y.R.; Jin, J.L.; Li, C.H.; Piao, X.X.; Jin, N.G. Ursolic acid enhances mouse liver regeneration after partial hepatectomy. Pharm. Biol. 2012, 50, 523–528. [Google Scholar] [CrossRef] [PubMed]
- Kil, Y.S.; Kim, S.M.; Kang, U.; Chung, H.Y.; Seo, E.K. Peroxynitrite-Scavenging Glycosides from the Stem Bark of Catalpa ovata. J. Nat. Prod. 2017, 80, 2240–2251. [Google Scholar] [CrossRef]
- Pae, H.O.; Oh, G.S.; Choi, B.M.; Shin, S.; Chai, K.Y.; Oh, H.; Kim, J.M.; Kim, H.J.; Jang, S.I.; Chung, H.T. Inhibitory effects of the stem bark of Catalpa ovata G. Don. (Bignoniaceae) on the productions of tumor necrosis factor-alpha and nitric oxide by the lipopolisaccharide-stimulated RAW 264.7 macrophages. J. Ethnopharmacol. 2003, 88, 287–291. [Google Scholar] [CrossRef]
- An, S.J.; Pae, H.O.; Oh, G.S.; Choi, B.M.; Jeong, S.; Jang, S.I.; Oh, H.; Kwon, T.O.; Song, C.E.; Chung, H.T. Inhibition of TNF-alpha, IL-1beta, and IL-6 productions and NF-kappa B activation in lipopolysaccharide-activated RAW 264.7 macrophages by catalposide, an iridoid glycoside isolated from Catalpa ovata G. Don (Bignoniaceae). Int. Immunopharmacol. 2002, 2, 1173–1181. [Google Scholar] [CrossRef]
- Oh, H.; Pae, H.O.; Oh, G.S.; Lee, S.Y.; Chai, K.Y.; Song, C.E.; Kwon, T.O.; Chung, H.T.; Lee, H.S. Inhibition of inducible nitric oxide synthesis by catalposide from Catalpa ovata. Planta Med. 2002, 68, 685–689. [Google Scholar] [CrossRef] [PubMed]
- Giner, R.M.; Villalba, M.L.; Recio, M.C.; Manez, S.; Cerda-Nicolas, M.; Rios, J. Anti-inflammatory glycoterpenoids from Scrophularia auriculata. Eur. J. Pharmacol. 2000, 389, 243–252. [Google Scholar] [CrossRef]
- Kasibhatla, S.; Brunner, T.; Genestier, L.; Echeverri, F.; Mahboubi, A.; Green, D.R. DNA damaging agents induce expression of Fas ligand and subsequent apoptosis in T lymphocytes via the activation of NF-kappa B and AP-1. Mol. Cell 1998, 1, 543–551. [Google Scholar] [CrossRef]
- Romashkova, J.A.; Makarov, S.S. NF-kappaB is a target of AKT in anti-apoptotic PDGF signalling. Nature 1999, 401, 86–90. [Google Scholar] [CrossRef] [PubMed]
- Wang, C.Y.; Mayo, M.W.; Korneluk, R.G.; Goeddel, D.V.; Baldwin, A.S., Jr. NF-kappaB antiapoptosis: Induction of TRAF1 and TRAF2 and c-IAP1 and c-IAP2 to suppress caspase-8 activation. Science 1998, 281, 1680–1683. [Google Scholar] [CrossRef]
- Miagkov, A.V.; Kovalenko, D.V.; Brown, C.E.; Didsbury, J.R.; Cogswell, J.P.; Stimpson, S.A.; Baldwin, A.S.; Makarov, S.S. NF-kappaB activation provides the potential link between inflammation and hyperplasia in the arthritic joint. Proc. Natl. Acad. Sci. USA 1998, 95, 13859–13864. [Google Scholar] [CrossRef]
- Al Ghouleh, I.; Khoo, N.K.; Knaus, U.G.; Griendling, K.K.; Touyz, R.M.; Thannickal, V.J.; Barchowsky, A.; Nauseef, W.M.; Kelley, E.E.; Bauer, P.M.; et al. Oxidases and peroxidases in cardiovascular and lung disease: New concepts in reactive oxygen species signaling. Free Radic. Biol. Med. 2011, 51, 1271–1288. [Google Scholar] [CrossRef]
- Dery, K.J.; Chiu, R.; Kasargod, A.; Kupiec-Weglinski, J.W. Feedback Loops Shape Oxidative and Immune Interactions in Hepatic Ischemia-Reperfusion Injury. Antioxidants 2025, 14, 944. [Google Scholar] [CrossRef] [PubMed]
- Baeuerle, P.A. Pro-inflammatory signaling: Last pieces in the NF-kappaB puzzle? Curr. Biol. 1998, 8, R19–R22. [Google Scholar] [CrossRef]
- Laurent, S.; Otsuka, M.; De Saeger, C.; Maiter, D.; Lambotte, L.; Horsmans, Y. Expression of presumed specific early and late factors associated with liver regeneration in different rat surgical models. Lab. Investig. 2001, 81, 1299–1307. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Mars, W.M.; Liu, M.L.; Kitson, R.P.; Goldfarb, R.H.; Gabauer, M.K.; Michalopoulos, G.K. Immediate early detection of urokinase receptor after partial hepatectomy and its implications for initiation of liver regeneration. Hepatology 1995, 21, 1695–1701. [Google Scholar]
- Kurinna, S.; Barton, M.C. Cascades of transcription regulation during liver regeneration. Int. J. Biochem. Cell Biol. 2011, 43, 189–197. [Google Scholar] [CrossRef] [PubMed]
- Iimuro, Y.; Fujimoto, J. TLRs, NF-kappaB, JNK, and Liver Regeneration. Gastroenterol. Res. Pract. 2010, 2010, 598109. [Google Scholar] [CrossRef]
- Chaisson, M.L.; Brooling, J.T.; Ladiges, W.; Tsai, S.; Fausto, N. Hepatocyte-specific inhibition of NF-kappaB leads to apoptosis after TNF treatment, but not after partial hepatectomy. J. Clin. Investig. 2002, 110, 193–202. [Google Scholar] [CrossRef]
- Kirillova, I.; Chaisson, M.; Fausto, N. Tumor necrosis factor induces DNA replication in hepatic cells through nuclear factor kappaB activation. Cell Growth Differ. 1999, 10, 819–828. [Google Scholar]
- Fausto, N. Liver regeneration. J. Hepatol. 2000, 32 (Suppl. 1), 19–31. [Google Scholar] [CrossRef]
- Muriel, P. NF-kappaB in liver diseases: A target for drug therapy. J. Appl. Toxicol. 2009, 29, 91–100. [Google Scholar] [CrossRef]
- Zimmermann, A. Regulation of liver regeneration. Nephrol. Dial. Transplant. 2004, 19 (Suppl. 4), iv6–iv10. [Google Scholar] [CrossRef]
- Michalopoulos, G.K.; DeFrances, M.C. Liver regeneration. Science 1997, 276, 60–66. [Google Scholar] [CrossRef]
- Mitchell, C.; Willenbring, H. A reproducible and well-tolerated method for 2/3 partial hepatectomy in mice. Nat. Protoc. 2008, 3, 1167–1170. [Google Scholar] [CrossRef]
- Valenzuela, A.; Garrido, A. Biochemical bases of the pharmacological action of the flavonoid silymarin and of its structural isomer silibinin. Biol. Res. 1994, 27, 105–112. [Google Scholar]
- Sonnenbichler, J.; Zetl, I. Biochemical effects of the flavonolignane silibinin on RNA, protein and DNA synthesis in rat livers. Prog. Clin. Biol. Res. 1986, 213, 319–331. [Google Scholar] [PubMed]
- Thompson, N.L.; Mead, J.E.; Braun, L.; Goyette, M.; Shank, P.R.; Fausto, N. Sequential protooncogene expression during rat liver regeneration. Cancer Res. 1986, 46, 3111–3117. [Google Scholar]
- Fausto, N.; Mead, J.E. Regulation of liver growth: Protooncogenes and transforming growth factors. Lab. Investig. 1989, 60, 4–13. [Google Scholar]
- Vosough, M.; Shokouhian, B.; Sharbaf, M.A.; Solhi, R.; Heidari, Z.; Seydi, H.; Hassan, M.; Devaraj, E.; Najimi, M. Role of mitogens in normal and pathological liver regeneration. Hepatol. Commun. 2025, 9, e0692. [Google Scholar] [CrossRef] [PubMed]
- Korchilava, B.; Khachidze, T.; Megrelishvili, N.; Svanadze, L.; Kakabadze, M.; Tsomaia, K.; Jintcharadze, M.; Kordzaia, D. Liver regeneration after partial hepatectomy: Triggers and mechanisms. World J. Hepatol. 2025, 17, 107378. [Google Scholar] [CrossRef] [PubMed]
- Beg, A.A.; Sha, W.C.; Bronson, R.T.; Ghosh, S.; Baltimore, D. Embryonic lethality and liver degeneration in mice lacking the RelA component of NF-kappa B. Nature 1995, 376, 167–170. [Google Scholar] [CrossRef]
- FitzGerald, M.J.; Webber, E.M.; Donovan, J.R.; Fausto, N. Rapid DNA binding by nuclear factor kappa B in hepatocytes at the start of liver regeneration. Cell Growth Differ. 1995, 6, 417–427. [Google Scholar] [PubMed]
- Liu, Q.; Wang, S.; Fu, J.; Chen, Y.; Xu, J.; Wei, W.; Song, H.; Zhao, X.; Wang, H. Liver regeneration after injury: Mechanisms, cellular interactions and therapeutic innovations. Clin. Transl. Med. 2024, 14, e1812. [Google Scholar] [CrossRef] [PubMed]
- Kuklin, A.; Slabber, C.F.; Tortola, L.; Kwan, C.L.; Liebisch, G.; Kondylis, V.; Mair, F.; Kopf, M.; Weber, A.; Werner, S. An Nrf2-NF-kappaB Crosstalk Controls Hepatocyte Proliferation in the Normal and Injured Liver. Cell Mol. Gastroenterol. Hepatol. 2025, 19, 101480. [Google Scholar] [CrossRef]
- Wang, H.; Lafdil, F.; Kong, X.; Gao, B. Signal transducer and activator of transcription 3 in liver diseases: A novel therapeutic target. Int. J. Biol. Sci. 2011, 7, 536–550. [Google Scholar] [CrossRef]
- Cressman, D.E.; Diamond, R.H.; Taub, R. Rapid activation of the Stat3 transcription complex in liver regeneration. Hepatology 1995, 21, 1443–1449. [Google Scholar] [CrossRef]
- Li, W.; Liang, X.; Kellendonk, C.; Poli, V.; Taub, R. STAT3 contributes to the mitogenic response of hepatocytes during liver regeneration. J. Biol. Chem. 2002, 277, 28411–28417. [Google Scholar] [CrossRef] [PubMed]
- Akerman, P.; Cote, P.; Yang, S.Q.; McClain, C.; Nelson, S.; Bagby, G.J.; Diehl, A.M. Antibodies to tumor necrosis factor-alpha inhibit liver regeneration after partial hepatectomy. Am. J. Physiol. 1992, 263 Pt 1, G579–G585. [Google Scholar] [CrossRef]
- Yamada, Y.; Kirillova, I.; Peschon, J.J.; Fausto, N. Initiation of liver growth by tumor necrosis factor: Deficient liver regeneration in mice lacking type I tumor necrosis factor receptor. Proc. Natl. Acad. Sci. USA 1997, 94, 1441–1446. [Google Scholar] [CrossRef]
- Aldeguer, X.; Debonera, F.; Shaked, A.; Krasinkas, A.M.; Gelman, A.E.; Que, X.; Zamir, G.A.; Hiroyasu, S.; Kovalovich, K.K.; Taub, R.; et al. Interleukin-6 from intrahepatic cells of bone marrow origin is required for normal murine liver regeneration. Hepatology 2002, 35, 40–48. [Google Scholar] [CrossRef]
- Lorentz, A.; Klopp, I.; Gebhardt, T.; Manns, M.P.; Bischoff, S.C. Role of activator protein 1, nuclear factor-kappaB, and nuclear factor of activated T cells in IgE receptor-mediated cytokine expression in mature human mast cells. J. Allergy Clin. Immunol. 2003, 111, 1062–1068. [Google Scholar] [CrossRef]
- Cressman, D.E.; Greenbaum, L.E.; DeAngelis, R.A.; Ciliberto, G.; Furth, E.E.; Poli, V.; Taub, R. Liver failure and defective hepatocyte regeneration in interleukin-6-deficient mice. Science 1996, 274, 1379–1383. [Google Scholar] [CrossRef] [PubMed]
- Greenbaum, L.E.; Li, W.; Cressman, D.E.; Peng, Y.; Ciliberto, G.; Poli, V.; Taub, R. CCAAT enhancer- binding protein beta is required for normal hepatocyte proliferation in mice after partial hepatectomy. J. Clin. Investig. 1998, 102, 996–1007. [Google Scholar] [CrossRef]
- Ankoma-Sey, V. Hepatic Regeneration-Revisiting the Myth of Prometheus. News Physiol. Sci. 1999, 14, 149–155. [Google Scholar] [CrossRef][Green Version]
- Wang, G.L.; Timchenko, N.A. Dephosphorylated C/EBPalpha accelerates cell proliferation through sequestering retinoblastoma protein. Mol. Cell Biol. 2005, 25, 1325–1338. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Kumar, N.; Rai, A.; Reddy, N.D.; Raj, P.V.; Jain, P.; Deshpande, P.; Mathew, G.; Kutty, N.G.; Udupa, N.; Rao, C.M. Silymarin liposomes improves oral bioavailability of silybin besides targeting hepatocytes, and immune cells. Pharmacol. Rep. 2014, 66, 788–798. [Google Scholar] [CrossRef]
- Ishikawa, T.; Factor, V.M.; Marquardt, J.U.; Raggi, C.; Seo, D.; Kitade, M.; Conner, E.A.; Thorgeirsson, S.S. Hepatocyte growth factor/c-met signaling is required for stem-cell-mediated liver regeneration in mice. Hepatology 2012, 55, 1215–1226. [Google Scholar] [CrossRef] [PubMed]
- Khoshnoodi, M.; Fakhraei, N.; Dehpour, A.R. Possible involvement of nitric oxide in antidepressant-like effect of silymarin in male mice. Pharm. Biol. 2015, 53, 739–745. [Google Scholar] [CrossRef]
- Okano, J.; Shiota, G.; Matsumoto, K.; Yasui, S.; Kurimasa, A.; Hisatome, I.; Steinberg, P.; Murawaki, Y. Hepatocyte growth factor exerts a proliferative effect on oval cells through the PI3K/AKT signaling pathway. Biochem. Biophys. Res. Commun. 2003, 309, 298–304. [Google Scholar] [CrossRef]
- Dudek, H.; Datta, S.R.; Franke, T.F.; Birnbaum, M.J.; Yao, R.; Cooper, G.M.; Segal, R.A.; Kaplan, D.R.; Greenberg, M.E. Regulation of neuronal survival by the serine-threonine protein kinase Akt. Science 1997, 275, 661–665. [Google Scholar] [CrossRef]
- Franke, T.F.; Kaplan, D.R.; Cantley, L.C. PI3K: Downstream AKTion blocks apoptosis. Cell 1997, 88, 435–437. [Google Scholar] [CrossRef]
- Yano, S.; Tokumitsu, H.; Soderling, T.R. Calcium promotes cell survival through CaM-K kinase activation of the protein-kinase-B pathway. Nature 1998, 396, 584–587. [Google Scholar] [CrossRef] [PubMed]
- Behrens, A.; Sibilia, M.; David, J.P.; Mohle-Steinlein, U.; Tronche, F.; Schutz, G.; Wagner, E.F. Impaired postnatal hepatocyte proliferation and liver regeneration in mice lacking c-jun in the liver. EMBO J. 2002, 21, 1782–1790. [Google Scholar] [CrossRef]
- Stepniak, E.; Ricci, R.; Eferl, R.; Sumara, G.; Sumara, I.; Rath, M.; Hui, L.; Wagner, E.F. c-Jun/AP-1 controls liver regeneration by repressing p53/p21 and p38 MAPK activity. Genes. Dev. 2006, 20, 2306–2314. [Google Scholar] [CrossRef] [PubMed]
- Muller, M.; Morotti, A.; Ponzetto, C. Activation of NF-kappaB is essential for hepatocyte growth factor-mediated proliferation and tubulogenesis. Mol. Cell Biol. 2002, 22, 1060–1072. [Google Scholar] [CrossRef]
- Ceyhan, E.; Canbek, M. Determining the Effects of Geraniol on Liver Regeneration Via the Nuclear Factor kB Pathway After Partial Hepatectomy. Altern. Ther. Health Med. 2017, 23, 38–45. [Google Scholar]
- Jepsen, B.N.; Andersen, K.J.; Knudsen, A.R.; Nyengaard, J.R.; Hamilton-Dutoit, S.; Svendsen, P.; Etzerodt, A.; Moller, H.J.; Moestrup, S.K.; Graversen, J.H.; et al. Anti-inflammatory liposomes have no impact on liver regeneration in rats. Ann. Med. Surg. 2015, 4, 452–461. [Google Scholar] [CrossRef]
- Knight, T.R.; Kurtz, A.; Bajt, M.L.; Hinson, J.A.; Jaeschke, H. Vascular and hepatocellular peroxynitrite formation during acetaminophen toxicity: Role of mitochondrial oxidant stress. Toxicol. Sci. 2001, 62, 212–220. [Google Scholar] [CrossRef] [PubMed]
- Cheng, Z.; Chu, H.; Seki, E.; Lin, R.; Yang, L. Hepatocyte programmed cell death: The trigger for inflammation and fibrosis in metabolic dysfunction-associated steatohepatitis. Front. Cell Dev. Biol. 2024, 12, 1431921. [Google Scholar] [CrossRef]
- Todisco, S.; Santarsiero, A.; Convertini, P.; De Stefano, G.; Gilio, M.; Iacobazzi, V.; Infantino, V. PPAR Alpha as a Metabolic Modulator of the Liver: Role in the Pathogenesis of Nonalcoholic Steatohepatitis (NASH). Biology 2022, 11, 792. [Google Scholar] [CrossRef]
- Anderson, S.P.; Yoon, L.; Richard, E.B.; Dunn, C.S.; Cattley, R.C.; Corton, J.C. Delayed liver regeneration in peroxisome proliferator-activated receptor-alpha-null mice. Hepatology 2002, 36, 544–554. [Google Scholar] [CrossRef] [PubMed]
- Xie, G.; Yin, S.; Zhang, Z.; Qi, D.; Wang, X.; Kim, D.; Yagai, T.; Brocker, C.N.; Wang, Y.; Gonzalez, F.J.; et al. Hepatocyte Peroxisome Proliferator-Activated Receptor alpha Enhances Liver Regeneration after Partial Hepatectomy in Mice. Am. J. Pathol. 2019, 189, 272–282. [Google Scholar] [CrossRef] [PubMed]







| Genes | Forward Primer | Reverse Primer | Accession |
|---|---|---|---|
| A1/Bf1 | TGC CAG GGA AGA TGG CTG AG | TCC GTA GTG TTA CTT GAG GAG | NM_009742.3 |
| C/EBP-β | CGCCTTTAGACCCATGGAAG | CCCGTAGGCCAGGCAGT | NM_001287738.1 |
| Cyclin E | GCAGCGAGCAGGAGACAGA | TGCTTCCACACCACTGTCTTTG | NM_007633.2 |
| Cyclin D | CGTGGCCTCTAAGATGAAGGA | TCGGGCCGGATAGAGTTGT | NM_007631.3 |
| EGFR | TCAGCAACAACCCCATCCTC | GCTTGGATCACATTTGGGGC | NM_007912.4 |
| Fibrinogen | GATGAACAAATGTCACGCAGGCCA | GCCCAAATAATGCCGTCGTCGAAA | NM_133862.2 |
| c-Fos | AATGGTGAAGACCGTGTCAGG | CCCTTCGGATTCTCCGTTTCT | NM_010234.3 |
| Gadd45 | TGAGCTGCTGCTACTGGAGA | GCAGGATCCTTCCATTGTGA | NM_007836.1 |
| GAPDH | AGAACATCATCCCTGCATCC | GGTCCTCAGTGTAGCCCAAG | NM_001411841.1 |
| Haptoglobin | TATGGATGCCAAAGGCAGCTTTCC | TCGCTGTGGTTCAGGAAGAGGTTT | NM_017370.2 |
| HGF | GGTGTATCAGGAACAGGGGC | GTCAAATTCATGGCCAAACCCT | NM_001289461.1 |
| c-Jun | TCTTCATTTTCTCACCAACTGCTT | CTCTCCAAATGCTCCCCAAA | NM_010591.2 |
| c-Myc | ACTTACAATCTGCGAGCCAGGACA | GCCCAAAGGAAATCCAGCCTTCAA | NM_010849.4 |
| NF-κB | TGGCAGCTCTTCTCAAAGCA | CCAAGAGTCGTCCAGGTCATAGA | NM_001410442.1 |
| RATENS | CAGCAGCAAGTGCTCCAATCTT | TTCTTGAACCCACTTCTTCTCTGG | NM_013653.3 |
| SAA1 | GCGAGCCTACTCTGACATGAAG | CCCCCGAGCATGGAAGTATT | NM_001163892.2 |
| SAA2 | AAGCTGGCTGGAAAGATGGA | CCTTTGGGCAGCATCATAGTTC | NM_011314.3 |
| SAA3 | CCTGGGCTGCTAAAGTCATCA | CCATGTCCCGTGAACTTCTGA | NM_011315.3 |
| TGF-β | CCGCAACAACGCCATCTATG | CTCTGCACGGGACAGCAAT | NM_011577.2 |
| XIAP | CCATGTGTAGTGAAGAAGCCAGAT | GATCATCAGCCCCTGTGTAGTAG | NM_009688.3 |
| Cell Number (×105 per mL) | ||||||
|---|---|---|---|---|---|---|
| HGF (10 ng/mL) | ||||||
| Hep3B | − | + | + | + | + | + |
| Concentration of Compound (µM) | ||||||
| Compounds | 0 | 0 | 0.5 | 1 | 5 | 10 |
| Control | 1.90 0.09 | 2.14 0.05 | 2.18 0.07 | 2.17 1.53 | 2.15 0.13 | 2.20 0.27 |
| Sm a | 2.27 0.21 | 2.31 0.13 | 2.33 0.06 * | 2.51 0.12 * | ||
| 6FC | 2.41 0.10 * | 2.44 0.06 * | 2.82 0.09 *,# | 3.08 0.13 *,# | ||
| Cell Number (×105 per mL) | |||||
|---|---|---|---|---|---|
| HGF (10 ng/mL) | |||||
| Hep3B | Day After Treatment (10 µM) | ||||
| Compounds | 0 | 1 | 2 | 3 | 4 |
| Control | 0.50 0.06 | 1.04 0.22 | 1.32 0.09 | 2.05 0.08 | 2.23 0.25 |
| Sm a | 1.16 0.20 | 1.52 0.28 | 2.22 0.03 * | 2.71 0.05 * | |
| 6FC | 1.24 0.12 | 2.32 0.19 * | 2.88 0.28 *,# | 3.05 0.14 *,# | |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Park, J.; Kil, Y.-S.; Yi, H.J.; Seo, E.K.; Woo, H.A. 6-O-trans-feruloyl Catalpol, a Natural Antioxidant from the Stem Bark of Catalpa ovata, Accelerates Liver Regeneration In Vivo via Activation of Hepatocyte Proliferation Signaling Pathways. Antioxidants 2025, 14, 1210. https://doi.org/10.3390/antiox14101210
Park J, Kil Y-S, Yi HJ, Seo EK, Woo HA. 6-O-trans-feruloyl Catalpol, a Natural Antioxidant from the Stem Bark of Catalpa ovata, Accelerates Liver Regeneration In Vivo via Activation of Hepatocyte Proliferation Signaling Pathways. Antioxidants. 2025; 14(10):1210. https://doi.org/10.3390/antiox14101210
Chicago/Turabian StylePark, Jiyoung, Yun-Seo Kil, Ho Jin Yi, Eun Kyoung Seo, and Hyun Ae Woo. 2025. "6-O-trans-feruloyl Catalpol, a Natural Antioxidant from the Stem Bark of Catalpa ovata, Accelerates Liver Regeneration In Vivo via Activation of Hepatocyte Proliferation Signaling Pathways" Antioxidants 14, no. 10: 1210. https://doi.org/10.3390/antiox14101210
APA StylePark, J., Kil, Y.-S., Yi, H. J., Seo, E. K., & Woo, H. A. (2025). 6-O-trans-feruloyl Catalpol, a Natural Antioxidant from the Stem Bark of Catalpa ovata, Accelerates Liver Regeneration In Vivo via Activation of Hepatocyte Proliferation Signaling Pathways. Antioxidants, 14(10), 1210. https://doi.org/10.3390/antiox14101210

