Relieving Effect of Artemisia ordosica Krasch Extract on DSS-Induced Colitis by Regulating Immunity, Antioxidant Function, Gut Microbiota, and Bile Acid Metabolism in Mice
Abstract
:1. Introduction
2. Materials and Methods
2.1. Reagents and Equipment
2.2. Preparation of AOE
2.3. Analysis of AOE Active Ingredients
2.4. Determination of AOE Antioxidant Activity
2.5. Treatment of Experimental Animals
2.6. Sample Collection and Processing
2.7. Histological Analysis
2.8. Determination of Inflammatory Factors and Antioxidant Markers in Colon and Serum
2.9. Real-Time Quantitative PCR
2.10. Analysis of Intestinal Microbial Community Based on 16sRNA
2.11. Metabolomics Analysis
2.12. Statistical Analysis
3. Results
3.1. AOE Active Ingredients
3.2. Determination of Antioxidant Activity of AOE
3.2.1. DPPH Free Radical Scavenging Ability of AOE
3.2.2. Hydroxyl Radical (·OH) Scavenging Ability of AOE
3.2.3. Iron Ion Reduction Power of AOE
3.3. AOE Alleviates Pathological Signs of DSS-Induced Colitis and Colonic Inflammation
3.4. Effects of AOE on Intestinal Immune, Antioxidant, and Barrier Functions of Colitis Induced by DSS
3.5. Effect of AOE on Gut Microbiota of DSS-Induced Colitis in Mice
3.6. Effect of AOE on Microbial BA Metabolism of DSS-Induced Colitis in Mice
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix A
Score | Weight Loss (%) | Stool Consistency | Fecal Blood Content |
---|---|---|---|
0 | None | Normal | None |
1 | 1–5% | - | |
2 | 6–10% | Loose stool | Occult blood |
3 | 11–15% | - | |
4 | >16% | Diarrhea | Hemorrhage/Gross bleeding |
Primer Name | Reference Sequence | Primer Sequence (5′-3′) |
---|---|---|
IL-6 | NM_001314054.1 | F: CTGCAAGAGACTTCCATCCAG |
R: AGTGGTATAGACAGGTCTGTTGG | ||
TNF-α | NM_007021.4 | F: TGAGGTCAATCTGCCCAAGT |
R: GGGGTCAGAGTAAAGGGGTC | ||
NLRP3 | NM_001359638.1 | F: ATTACCCGCCCGAGAAAGG |
R: TCGCAGCAAAGATCCACACAG | ||
ZO-1 | XM_054378715.1 | F: GAGCAGGCTTTGGAGGAGAC |
R: TGGGACAAAAGTCCGGGAAG | ||
Occludin | XM_054351382.1 | F: TTGAAAGTCCACCTCCTTACAGA |
R: CCGGATAAAAAGAGTACGCTGG | ||
Claudin | NM_021101.5 | F: TGCCCCAGTGGAAGATTTACT |
R: CTTTGCGAAACGCAGGACAT | ||
GAPDH | NM_001357943.2 | F: ATGGGAAGCTTGTCATCAACG |
R: AAGACACCAGTAGACTCCACG |
Item (Unit) | CON | DSS | DSS_AOE | p-Value |
---|---|---|---|---|
WBC (×109/L) | 2.06 ± 0.83 | 2.44 ± 0.57 | 1.92 ± 0.54 | 0.36 |
LYM (×109/L) | 1.26 ± 0.65 | 1.30 ± 0.38 | 1.06 ± 0.41 | 0.69 |
MID (×109/L) | 0.27 ± 0.12 | 0.26 ± 0.15 | 0.20 ± 0.11 | 0.59 |
GRAN (×109/L) | 0.53 ± 0.12 b | 0.88 ± 0.13 a | 0.70 ± 0.23 ab | 0.01 |
RBC (×1012/L) | 5.09 ± 0.45 | 4.47 ± 0.59 | 4.49 ± 0.45 | 0.08 |
HGB (g/L) | 79.33 ± 9.65 | 71.00 ± 11.36 | 70.50 ± 8.77 | 0.30 |
PCV (%) | 30.32 ± 2.87 | 26.92 ± 3.21 | 27.40 ± 2.76 | 0.13 |
MCV (fL) | 59.63 ± 1.01 | 60.36 ± 1.94 | 61.16 ± 3.10 | 0.51 |
MCH (pg) | 15.53 ± 0.58 | 15.76 ± 0.71 | 15.62 ± 0.93 | 0.89 |
MCHC (g/L) | 260.83 ± 8.28 | 262.20 ± 11.91 | 256.6 ± 12.84 | 0.51 |
RDW-SD (%) | 23.59 ± 3.18 | 27.10 ± 2.50 | 27.11 ± 4.97 | 0.20 |
RDW-CV (%) | 13.9 ± 0.60 | 15.20 ± 1.09 | 15.00 ± 2.11 | 0.24 |
PLT (×109/L) | 334.70 ± 123.50 b | 518.00 ± 130.16 a | 396.60 ± 74.83 ab | 0.04 |
MPV (fL) | 6.87 ± 0.46 | 6.86 ± 0.33 | 7.19 ± 0.70 | 0.49 |
PDW (%) | 8.58 ± 1.07 | 7.56 ± 1.53 | 8.29 ± 1.64 | 0.47 |
PCT (%) | 0.23 ± 0.08 | 0.35 ± 0.20 | 0.29 ± 0.19 | 0.46 |
P-LCR (%) | 4.51 ± 2.03 | 3.20 ± 1.74 | 3.97 ± 2.16 | 0.51 |
References
- Baumgart, D.C.; Sandborn, W.J. Inflammatory bowel disease: Clinical aspects and established and evolving therapies. Lancet 2007, 369, 1641–1657. [Google Scholar] [CrossRef] [PubMed]
- Gros, B.; Kaplan, G.G. Ulcerative colitis in adults: A review. JAMA 2023, 330, 951–965. [Google Scholar] [CrossRef] [PubMed]
- van der Lelie, D.; Oka, A.; Taghavi, S.; Umeno, J.; Fan, T.J.; Merrell, K.E.; Watson, S.D.; Ouellette, L.; Liu, B.; Awoniyi, M.; et al. Rationally designed bacterial consortia to treat chronic immune-mediated colitis and restore intestinal homeostasis. Nat. Commun. 2021, 12, 3105. [Google Scholar] [CrossRef] [PubMed]
- Ballester, M.P.; Marti-Aguado, D.; Fullana, M.; Bosca-Watts, M.M.; Tosca, J.; Romero, E.; Sanchez, A.; Navarro-Cortes, P.; Anton, R.; Mora, F.; et al. Impact and risk factors of non-adherence to 5-aminosalicylates in quiescent ulcerative colitis evaluated by an electronic management system. Int. J. Color. Dis. 2019, 34, 1053–1059. [Google Scholar] [CrossRef]
- Wan, M.L.Y.; Ling, K.H.; El-Nezami, H.; Wang, M.F. Influence of functional food components on gut health. Crit. Rev. Food Sci. Nutr. 2019, 59, 1927–1936. [Google Scholar] [CrossRef] [PubMed]
- Xu, F.; Cheng, Y.; Ruan, G.; Fan, L.; Tian, Y.; Xiao, Z.; Chen, D.; Wei, Y. New pathway ameliorating ulcerative colitis: Focus on Roseburia intestinalis and the gut-brain axis. Ther. Adv. Gastroenterol. 2021, 14, 17562848211004469. [Google Scholar] [CrossRef] [PubMed]
- Wang, K.; Jin, X.; Chen, Y.; Song, Z.; Jiang, X.; Hu, F.; Conlon, M.A.; Topping, D.L. Polyphenol-rich propolis extracts strengthen intestinal barrier function by activating AMPK and ERK signaling. Nutrients 2016, 8, 272. [Google Scholar] [CrossRef]
- Cui, L.; Guan, X.; Ding, W.; Luo, Y.; Wang, W.; Bu, W.; Song, J.; Tan, X.; Sun, E.; Ning, Q.; et al. Scutellaria baicalensis georgi polysaccharide ameliorates DSS-induced ulcerative colitis by improving intestinal barrier function and modulating gut microbiota. Int. J. Biol. Macromol. 2021, 166, 1035–1045. [Google Scholar] [CrossRef]
- Ye, C.; Liu, L.; Ma, X.; Tong, H.; Gao, J.; Tai, Y.; Huang, L.; Tang, C.; Wang, R. Obesity aggravates acute pancreatitis via damaging intestinal mucosal barrier and changing microbiota composition in rats. Sci. Rep. 2019, 9, 69. [Google Scholar] [CrossRef] [PubMed]
- Collins, S.L.; Stine, J.G.; Bisanz, J.E.; Okafor, C.D.; Patterson, A.D. Bile acids and the gut microbiota: Metabolic interactions and impacts on disease. Nat. Rev. Microbiol. 2023, 21, 236–247. [Google Scholar] [CrossRef] [PubMed]
- Perino, A.; Schoonjans, K. Metabolic messengers: Bile acids. Nat. Metab. 2022, 4, 416–423. [Google Scholar] [CrossRef]
- Rodríguez-Morató, J.; Matthan, N.R. Nutrition and gastrointestinal microbiota, microbial-derived secondary bile acids, and cardiovascular disease. Curr. Atheroscler. Rep. 2020, 22, 47. [Google Scholar] [CrossRef]
- Wright, C.W. Artemisia, 1st ed.; CRC Press: Boca Raton, FL, USA, 2001. [Google Scholar] [CrossRef]
- Bhakuni, R.S.; Jain, D.C.; Sharma, R.P.; Kumar, S. Secondary metabolites of Artemisia annua and their biological activity. Curr. Sci. 2000, 80, 35–48. [Google Scholar]
- Kim, Y.M.; Kim, J.H.; Kim, S.C.; Ha, H.M.; Ko, Y.D.; Kim, C.H. Influence of dietary addition of dried wormwood (Artemisia sp.) on the performance, carcass characteristics and fatty acid composition of muscle tissues of Hanwoo heifers. Asian-australas. J. Anim. Sci. 2002, 15, 549–554. [Google Scholar] [CrossRef]
- Li, K.; Zhang, P.; Shi, B.; Su, J.; Yue, Y.; Tong, M.; Yan, S. Dietary Artemisia ordosica extract alleviating immune stress in broil-ers exposed to lipopolysaccharide. Ital. J. Anim. Sci. 2017, 16, 301–330. [Google Scholar] [CrossRef]
- Zhang, P.F.; Shi, B.L.; Su, J.L.; Yue, Y.X.; Cao, Z.X.; Chu, W.B.; Yan, S.M. Relieving effect of Artemisia argyi aqueous extract on immune stress in broilers. J. Anim. Physiol. Anim. Nutr. 2017, 101, 251–258. [Google Scholar] [CrossRef] [PubMed]
- Xiao, B.; Wang, J.H.; Zhou, C.Y.; Chen, J.M.; Zhang, N.; Zhao, N.; Han, X.Y.; Niu, Y.X.; Feng, Y.B.; Du, G.H. Ethno-medicinal study of Artemisia ordosica Krasch. (traditional Chinese/Mongolian medicine) extracts for the treatment of allergic rhinitis and nasosinusitis. J. Ethnopharmacol. 2020, 248, 112262. [Google Scholar] [CrossRef] [PubMed]
- Xing, Y.; Wu, Y.; Mao, C.; Sun, D.; Guo, S.; Xu, Y.; Jin, X.; Yan, S.; Shi, B. Water extract of Artemisia ordosica enhances antioxidant capability and immune response without affecting growth performance in weanling piglets. J. Anim. Physiol. Anim. Nutr. 2019, 103, 1848–1856. [Google Scholar] [CrossRef]
- Haidong, D.; Xing, Y.; Jin, X.; Yan, S.; Shi, B. Effects of Artemisia ordosica polysaccharide on growth performance and antioxidant capacity in broilers. J. Appl. Anim. Res. 2023, 51, 92–101. [Google Scholar]
- Xing, Y.Y.; Zheng, Y.K.; Yang, S.; Zhang, L.H.; Guo, S.W.; Shi, L.L.; Xu, Y.Q.; Jin, X.; Yan, S.M.; Shi, B.L. Artemisia ordosica polysaccharide alleviated lipopolysaccharide-induced oxidative stress of broilers via Nrf2/Keap1 and TLR4/NF-κB pathway. Ecotoxicol. Environ. Saf. 2021, 223, 112566. [Google Scholar] [CrossRef]
- Shi, L.L.; Jin, X.; Xu, Y.Q.; Xing, Y.Y.; Yan, S.; Guo, Y.F.; Cheng, Y.C.; Shi, B.L. Effects of total flavonoids of Artemisia ordosica on growth performance, oxidative stress, and antioxidant status of lipopolysaccharide-challenged broilers. Antioxidants 2022, 11, 1985. [Google Scholar] [CrossRef]
- Xing, Y.Y.; Zheng, Y.K.; Yang, S.; Zhang, L.H.; Guo, S.W.; Shi, L.L.; Xu, Y.Q.; Jin, X.; Yan, S.M.; Shi, B.L. Artemisia ordosica polysaccharide ameliorated LPS-induced growth inhibition and intestinal injury in broilers through enhancing immune-regulation and antioxidant capacity. J Nutr. Biochem. 2023, 115, 109284. [Google Scholar] [CrossRef]
- Guo, Y.; Li, J.X.; Wang, Y.L.; Mao, T.Y.; Chen, C.; Xie, T.H.; Han, Y.F.; Tan, X.; Han, H.X. Yinchen linggui zhugan decoction ameliorates nonalcoholic fatty liver disease in rats by regulating the Nrf2/ARE signaling path-way. eCAM 2017, 2017, 6178358. [Google Scholar]
- Baliyan, S.; Mukherjee, R.; Priyadarshini, A.; Vibhuti, A.; Gupta, A.; Pandey, R.P.; Chang, C.M. Determination of antioxidants by DPPH radical scavenging activity and quantitative phytochemical analysis of ficus religiosa. Molecules 2022, 27, 1326. [Google Scholar] [CrossRef] [PubMed]
- Barreto, S.M.A.G.; Cadavid, C.O.M.; Moura, R.A.O.; Silva, G.M.M.; Araújo, S.V.F.; Silva Filho, J.A.A.D.; Rocha, H.A.O.; Oliveira, R.P.; Giordani, R.B.; Ferrari, M. In vitro and In vivo antioxidant activity of agave sisalana agro-industrial residue. Biomolecules 2020, 10, 1435. [Google Scholar] [CrossRef] [PubMed]
- Arika, W.; Kibiti, C.M.; Njagi, J.M.; Ngugi, M.P. In vitro antioxidant properties of dichloromethanolic leaf extract of gnidia glauca (Fresen) as a promising antiobesity drug. J. Evid. Based Integr. Med. 2019, 24, 2515690X19883258. [Google Scholar] [CrossRef] [PubMed]
- Peng, Y.; Yan, Y.; Wan, P.; Chen, D.; Ding, Y.; Ran, L.; Mi, J.; Lu, L.; Zhang, Z.; Li, X.; et al. Gut microbiota modulation and anti-inflammatory properties of anthocyanins from the fruits of lycium ruthenicum murray in dextran sodium sulfate-induced colitis in mice. Free Radical. Biol. Med. 2019, 136, 96–108. [Google Scholar] [CrossRef]
- Stillie, R.; Stadnyk, A.W. Role of TNF receptors, TNFR1 and TNFR2, in dextran sodium sulfate-induced colitis. Inflamm. Bowel Dis. 2009, 15, 1515–1525. [Google Scholar] [CrossRef] [PubMed]
- Jing, W.; Dong, S.; Luo, X.; Liu, J.; Wei, B.; Du, W.; Yang, L.; Luo, H.; Wang, Y.; Wang, S.; et al. Berberine improves colitis by triggering AhR activation by microbial tryptophan catabolites. Pharmacol. Res. 2021, 164, 105358. [Google Scholar] [CrossRef]
- Pavlidis, P.; Powell, N.; Vincent, R.P.; Ehrlich, D.; Bjarnason, I.; Hayee, B. Systematic review: Bile acids and intestinal inflammation-luminal aggressors or regulators of mucosal defence? Aliment. Pharmacol. Ther. 2015, 42, 802–817. [Google Scholar] [CrossRef] [PubMed]
- Wan, H.L.; Chen, H.Z.; Shi, X.Q. Study on effect of Traditional Chinese Medicine Jianpi Chushi decoction and ointment on chronic eczema. Asian Pac. J. Trop. Med. 2016, 9, 920–923. [Google Scholar] [CrossRef]
- Han, H.M.; Kim, S.J.; Kim, J.S.; Kim, B.H.; Lee, H.W.; Lee, Y.T.; Kang, K.H. Ameliorative effects of Artemisia argyi Folium extract on 2,4 dinitrochlorobenzene induced atopic dermatitis like lesions in BALB/c mice. Mol. Med. Rep. 2016, 14, 3206–3214. [Google Scholar] [CrossRef] [PubMed]
- Pietta, P.G. Flavonoids as antioxidants. J. Nat. Prod. 2000, 63, 1035–1042. [Google Scholar] [CrossRef] [PubMed]
- Shahidi, F.; Wanasundara, P.K. Phenolic antioxidants. Crit. Rev. Food Sci. Nutr. 1992, 32, 67–103. [Google Scholar] [CrossRef]
- Nickerson, K.P.; Chanin, R.; McDonald, C. Deregulation of intestinal anti-microbial defense by the dietary additive, maltodextrin. Gut Microbes 2015, 6, 78–83. [Google Scholar] [CrossRef] [PubMed]
- Witkowski, M.; Witkowski, M.; Gagliani, N.; Huber, S. Recipe for IBD: Can we use food to control inflammatory bowel disease? Semin. Immunopathol. 2018, 40, 145–156. [Google Scholar] [CrossRef] [PubMed]
- Stevceva, L.; Pavli, P.; Buffinton, G.; Wozniak, A.; Doe, W.F. Dextran sodium sulphate-induced colitis activity varies with mouse strain but develops in lipopolysaccharide-unresponsive mice. J. Gastroenterol. Hepatol. 1999, 14, 54–60. [Google Scholar] [CrossRef] [PubMed]
- Rogler, G.; Singh, A.; Kavanaugh, A.; Rubin, D.T. Extraintestinal manifestations of inflammatory bowel disease: Current concepts, treatment, and implications for disease management. Gastroenterology 2021, 161, 1118–1132. [Google Scholar] [CrossRef]
- Zhang, Y.; Tao, M.; Chen, C.; Zhao, X.; Feng, Q.; Chen, G.; Fu, Y. BAFF blockade attenuates DSS-induced chronic colitis via inhibiting NLRP3 inflammasome and NF-κB activation. Front. Immunol. 2022, 13, 783254. [Google Scholar] [CrossRef] [PubMed]
- Ganapathy, A.S.; Saha, K.; Suchanec, E.; Singh, V.; Verma, A.; Yochum, G.; Koltun, W.; Nighot, M.; Ma, T.; Nighot, P. AP2M1 mediates autophagy-induced CLDN2 (claudin 2) degradation through endocytosis and interaction with LC3 and reduces intestinal epithelial tight junction permeability. Autophagy 2022, 18, 2086–2103. [Google Scholar] [CrossRef]
- Wang, R.X.; Lee, J.S.; Campbell, E.L.; Colgan, S.P. Microbiota-derived butyrate dynamically regulates intestinal homeostasis through regulation of actin-associated protein synaptopodin. Proc. Nat. Acad. Sci. USA 2020, 117, 11648–11657. [Google Scholar] [CrossRef] [PubMed]
- Thomann, A.K.; Mak, J.W.Y.; Zhang, J.W.; Wuestenberg, T.; Ebert, M.P.; Sung, J.J.Y.; Bernstein, C.N.; Reindl, W.; Ng, S.C. Review article: Bugs, inflammation and mood-a microbiota-based approach to psychiatric symptoms in inflammatory bowel diseases. Aliment. Pharm. Therap. 2020, 52, 247–266. [Google Scholar] [CrossRef]
- Caenepeel, C.; Sadat Seyed Tabib, N.; Vieira-Silva, S.; Vermeire, S. Review article: How the intestinal microbiota may reflect disease activity and influence therapeutic outcome in inflammatory bowel disease. Aliment. Pharmacol. Ther. 2020, 52, 1453–1468. [Google Scholar] [CrossRef]
- Li, H.; Li, H.; Stanton, C.; Ross, R.P.; Zhao, J.; Chen, W.; Yang, B. Alleviative effects of exopolysaccharides from Limosilactobacillus mucosae CCFM1273 against ulcerative colitis via modulation of gut microbiota and inhibition of Fas/Fasl and TLR4/NF-κB pathways. Int. J. Biol. Macromol. 2024, 260, 129346. [Google Scholar] [CrossRef]
- Ke, J.; Li, Y.; Han, C.; He, R.; Lin, R.; Qian, W.; Hou, X. Fucose ameliorate intestinal inflammation through modulating the crosstalk between bile acids and gut microbiota in a chronic colitis murine model. Inflamm. Bowel. Dis. 2020, 26, 863–873. [Google Scholar] [CrossRef]
- Jia, W.; Xie, G.; Jia, W. Bile acid-microbiota crosstalk in gastrointestinal inflammation and carcinogenesis. Nat. Rev. Gastroenterol. Hepatol. 2018, 15, 111–128. [Google Scholar] [CrossRef] [PubMed]
- Duboc, H.; Rajca, S.; Rainteau, D.; Benarous, D.; Maubert, M.A.; Quervain, E.; Thomas, G.; Barbu, V.; Humbert, L.; Despras, G.; et al. Connecting dysbiosis, bile-acid dysmetabolism and gut inflammation in inflammatory bowel diseases. Gut 2013, 62, 531–539. [Google Scholar] [CrossRef] [PubMed]
- Sinha, S.R.; Haileselassie, Y.; Nguyen, L.P.; Tropini, C.; Wang, M.; Becker, L.S.; Sim, D.; Jarr, K.; Spear, E.T.; Singh, G.; et al. Dysbiosis-induced secondary bile acid deficiency promotes intestinal inflammation. Cell Host Microbe 2020, 27, 659–670. [Google Scholar] [CrossRef] [PubMed]
- Lajczak-McGinley, N.K.; Porru, E.; Fallon, C.M.; Smyth, J.; Curley, C.; McCarron, P.A.; Tambuwala, M.M.; Roda, A.; Keely, S.J. The secondary bile acids, ursodeoxycholic acid and lithocholic acid, protect against intestinal inflammation by inhibition of epithelial apoptosis. Physiol. Rep. 2020, 8, 14456. [Google Scholar] [CrossRef] [PubMed]
- de Diego-Cabero, N.; Mereu, A.; Menoyo, D.; Holst, J.J.; Ipharraguerre, I.R. Bile acid mediated effects on gut integrity and performance of early-weaned piglets. BMC Vet. Res. 2015, 11, 111. [Google Scholar] [CrossRef] [PubMed]
- Reuter, M.A.; Tucker, M.; Marfori, Z.; Shishani, R.; Bustamante, J.M.; Moreno, R.; Goodson, M.L.; Ehrlich, A.; Taha, A.Y.; Lein, P.J.; et al. Dietary resistant starch supplementation increases gut luminal deoxycholic acid abundance in mice. Gut Microbes 2024, 16, 2315632. [Google Scholar] [CrossRef]
- van Baarlen, P.; Wells, J.M.; Kleerebezem, M. Regulation of intestinal homeostasis and immunity with probiotic lactobacilli. Trends Immunol. 2013, 34, 208–215. [Google Scholar] [CrossRef] [PubMed]
- Ahl, D.; Liu, H.; Schreiber, O.; Roos, S.; Phillipson, M.; Holm, L. Lactobacillus reuteri increases mucus thickness and ameliorates dextran sulphate sodium-induced colitis in mice. Acta Physiol. 2016, 217, 300–310. [Google Scholar] [CrossRef] [PubMed]
- Wu, H.; Xie, S.; Miao, J.; Li, Y.; Wang, Z.; Wang, M.; Yu, Q. Lactobacillus reuteri maintains intestinal epithelial regeneration and repairs damaged intestinal mucosa. Gut Microbes 2020, 11, 997–1014. [Google Scholar] [CrossRef] [PubMed]
- Cani, P.D.; Depommier, C.; Derrien, M.; Everard, A.; de Vos, W.M. Akkermansia muciniphila: Paradigm for next-generation beneficial microorganisms. Nat. Rev. Gastro. Hepat. 2022, 19, 625–637. [Google Scholar] [CrossRef] [PubMed]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jiang, M.; Zhang, X.; Jin, X.; Shi, B.; Xu, Y.; Wang, Z. Relieving Effect of Artemisia ordosica Krasch Extract on DSS-Induced Colitis by Regulating Immunity, Antioxidant Function, Gut Microbiota, and Bile Acid Metabolism in Mice. Antioxidants 2025, 14, 45. https://doi.org/10.3390/antiox14010045
Jiang M, Zhang X, Jin X, Shi B, Xu Y, Wang Z. Relieving Effect of Artemisia ordosica Krasch Extract on DSS-Induced Colitis by Regulating Immunity, Antioxidant Function, Gut Microbiota, and Bile Acid Metabolism in Mice. Antioxidants. 2025; 14(1):45. https://doi.org/10.3390/antiox14010045
Chicago/Turabian StyleJiang, Min, Xuekai Zhang, Xiao Jin, Binlin Shi, Yuanqing Xu, and Zheqi Wang. 2025. "Relieving Effect of Artemisia ordosica Krasch Extract on DSS-Induced Colitis by Regulating Immunity, Antioxidant Function, Gut Microbiota, and Bile Acid Metabolism in Mice" Antioxidants 14, no. 1: 45. https://doi.org/10.3390/antiox14010045
APA StyleJiang, M., Zhang, X., Jin, X., Shi, B., Xu, Y., & Wang, Z. (2025). Relieving Effect of Artemisia ordosica Krasch Extract on DSS-Induced Colitis by Regulating Immunity, Antioxidant Function, Gut Microbiota, and Bile Acid Metabolism in Mice. Antioxidants, 14(1), 45. https://doi.org/10.3390/antiox14010045