Dietary Supplementation with 25-Hydroxyvitamin D3 on Reproductive Performance and Placental Oxidative Stress in Primiparous Sows during Mid-to-Late Gestation
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethic Statement
2.2. Animals and Experimental Design
2.3. Reproductive Performance Analysis
2.4. Sample Collection
2.5. Assay of Antioxidant Indicators
2.6. Gene Expression Analysis
2.7. Statistical Analysis
3. Results
3.1. Reproductive Performance
3.2. Plasma Antioxidant Capacities of Sows
3.3. Placenta Antioxidant Capacity
3.4. Placental Function
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Ampode, K.M.B.; Mun, H.S.; Lagua, E.B.; Chem, V.; Park, H.R.; Kim, Y.H.; Yang, C.J. Bump Feeding Improves Sow Reproductive Performance, Milk Yield, Piglet Birth Weight, and Farrowing Behavior. Animals 2023, 13, 3148. [Google Scholar] [CrossRef] [PubMed]
- Liang, L.; Rasmussen, M.H.; Piening, B.; Shen, X.; Chen, S.; Röst, H.; Snyder, J.K.; Tibshirani, R.; Skotte, L.; Lee, N.C. Metabolic Dynamics and Prediction of Gestational Age and Time to Delivery in Pregnant Women. Cell 2020, 181, 1680–1692.e1615. [Google Scholar] [CrossRef]
- Yang, X.; Hu, R.; Shi, M.; Wang, L.; Yan, J.; Gong, J.; Zhang, Q.; He, J.; Wu, S. Placental Malfunction, Fetal Survival and Development Caused by Sow Metabolic Disorder: The Impact of Maternal Oxidative Stress. Antioxidants 2023, 12, 360. [Google Scholar] [CrossRef] [PubMed]
- Pisoschi, A.M.; Pop, A. The role of antioxidants in the chemistry of oxidative stress: A review. Eur. J. Med. Chem. 2015, 97, 55–74. [Google Scholar] [CrossRef]
- Zhao, Y.; Kim, S.W. Oxidative stress status and reproductive performance of sows during gestation and lactation under different thermal environments. Asian-Australas. J. Anim. 2020, 33, 722–731. [Google Scholar] [CrossRef]
- Berchieri-Ronchi, C.B.; Kim, S.W.; Zhao, Y.; Correa, C.R.; Yeum, K.J.; Ferreira, A.L.A. Oxidative stress status of highly prolific sows during gestation and lactation. Animal 2011, 5, 1774–1779. [Google Scholar] [CrossRef]
- Xie, C.; Wu, X.; Long, C.; Wang, Q.; Fan, Z.; Li, S.; Yin, Y. Chitosan oligosaccharide affects antioxidant defense capacity and placental amino acids transport of sows. BMC Vet. Res. 2016, 12, 243. [Google Scholar] [CrossRef]
- Serdar, Z.; Gür, E.; Colakoethullarý, M.; Develioethlu, O.; Sarandöl, E. Lipid and protein oxidation and antioxidant function in women with mild and severe preeclampsia. Arch. Gynecol. Obstet. 2003, 268, 19–25. [Google Scholar] [CrossRef] [PubMed]
- Myatt, L.; Cui, X. Oxidative stress in the placenta. Histochem. Cell 2004, 122, 369–382. [Google Scholar] [CrossRef]
- Fatemi, S.A.; Alqhtani, A.; Elliott, K.E.C.; Bello, A.; Zhang, H.; Peebles, E.D. Effects of the in ovo injection of vitamin D(3) and 25-hydroxyvitamin D(3) in Ross 708 broilers subsequently fed commercial or calcium and phosphorus-restricted diets. I. Performance, carcass characteristics, and incidence of woody breast myopathy(1,2,3). Poultry Sci. 2021, 100, 101220. [Google Scholar] [CrossRef]
- Zhan, D.; Zhao, J.; Shi, Q.; Lou, J.; Wang, W. 25-hydroxyvitamin D3 inhibits oxidative stress and ferroptosis in retinal microvascular endothelial cells induced by high glucose through down-regulation of miR-93. BMC Ophthalmol. 2023, 23, 22. [Google Scholar] [CrossRef] [PubMed]
- Mitri, J.; Pittas, A.G. Vitamin D and diabetes. Endo. Crin. Metab. Clin. 2014, 43, 205–232. [Google Scholar] [CrossRef]
- Haussler, M.R.; Whitfield, G.K.; Kaneko, I.; Haussler, C.A.; Hsieh, D.; Hsieh, J.-C.; Jurutka, P.W. Molecular mechanisms of vitamin D action. Calcified Tissue Int. 2013, 92, 77–98. [Google Scholar] [CrossRef] [PubMed]
- Anandabaskar, N.; Selvarajan, S.; Dkhar, S.A.; Kamalanathan, S.K.; Tamilarasu, K.; Bobby, Z. Effect of vitamin D supplementation on vascular functions and oxidative stress in type 2 diabetic patients with vitamin D deficiency. Indian J. Endocrinol. Metab. 2017, 21, 555–563. [Google Scholar]
- Zhou, H.; Chen, Y.; Zhuo, Y.; Lv, G.; Lin, Y.; Feng, B.; Fang, Z.; Che, L.; Li, J.; Xu, S.; et al. Effects of 25-hydroxycholecalciferol supplementation in maternal diets on milk quality and serum bone status markers of sows and bone quality of piglets. Anim. Sci. 2017, 88, 476–483. [Google Scholar] [CrossRef]
- Lütke-Dörhoff, M.; Schulz, J.; Westendarp, H.; Visscher, C.; Wilkens, M.R. Dietary supplementation of 25-hydroxycholecalciferol as an alternative to cholecalciferol in swine diets: A review. J. Anim. Physiol. An. Nutri 2022, 106, 1288–1305. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Koketsu, Y.; Tani, S.; Iida, R. Factors for improving reproductive performance of sows and herd productivity in commercial breeding herds. Porcine Health Manag. 2017, 3, 1. [Google Scholar] [CrossRef]
- Weber, G.M.; Witschi, A.K.; Wenk, C.; Martens, H. Triennial Growth Symposium--Effects of dietary 25-hydroxycholecalciferol and cholecalciferol on blood vitamin D and mineral status, bone turnover, milk composition, and reproductive performance of sows. J. Anim. Sci. 2014, 92, 899–909. [Google Scholar] [CrossRef]
- Wang, K.; Chen, Y.; Zhang, D.; Wang, R.; Zhao, Z.; Feng, M.; Wei, H.; Li, L.; Zhang, S. Effects of 25-hydroxycholecalciferol supplementation in maternal diets on reproductive performance and the expression of genes that regulate lactation in sows. Anim. Sci. J. 2020, 91, e13391. [Google Scholar] [CrossRef]
- Upadhaya, S.D.; Jung, Y.J.; Kim, Y.M.; Chung, T.K.; Kim, I.H. Effects of dietary supplementation with 25-OH-D3 during gestation and lactation on reproduction, sow characteristics and piglet performance to weaning: 25-hydroxyvitamin D3 in sows. Anim. Feed Sci. Tech. 2021, 271, 114732. [Google Scholar] [CrossRef]
- Lauridsen, C.; Halekoh, U.; Larsen, T.; Jensen, S.K. Reproductive performance and bone status markers of gilts and lactating sows supplemented with two different forms of vitamin D1. J. Anim. Sci. 2010, 88, 202–213. [Google Scholar] [CrossRef]
- Zhang, L.; Wang, J.; Piao, X. Potential Effects of 25-Hydroxycholecalciferol on the Growth Performance, Blood Antioxidant Capacity, Intestinal Barrier Function and Microbiota in Broilers under Lipopolysaccharide Challenge. Antioxidants 2022, 11, 2094. [Google Scholar] [CrossRef]
- Zhou, X.; Zou, Y.; Xu, Y.; Zhang, Z.; Wu, Y.; Cao, J.; Qiu, B.; Qin, X.; Han, D.; Piao, X. Dietary supplementation of 25-hydroxyvitamin D3 improves growth performance, antioxidant capacity and immune function in weaned piglets. Antioxidants 2022, 11, 1750. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Liu, S.; Li, M.; Piao, X. Effects of maternal 25-hydroxycholecalciferol during the last week of gestation and lactation on serum parameters, intestinal morphology and microbiota in suckling piglets. Arch. Anim. Nutr. 2020, 74, 445–461. [Google Scholar] [CrossRef] [PubMed]
- Zhao, L.; Mao, Z.; Mou, D.; Huang, L.; Yang, M.; Ding, D.; Yan, H.; Fang, Z.; Che, L.; Zhuo, Y.; et al. Maternal cholecalciferol supplementation during gestation improves antioxidant capacities in gilts and piglets. Italian J. Anim. Sci. 2021, 20, 1201–1210. [Google Scholar] [CrossRef]
- Xu, K.; Liu, G.; Fu, C. The Tryptophan Pathway Targeting Antioxidant Capacity in the Placenta. Oxid. Med. Cell Longev. 2018, 2018, 1054797. [Google Scholar] [CrossRef]
- Suhail, M.; Suhail, S.; Gupta, B.K.; Bharat, V. Malondialdehyde and Antioxidant Enzymes in Maternal and Cord Blood, and their Correlation in Normotensive and Preeclamptic Women. J. Clin. Med. Res. 2009, 1, 150–157. [Google Scholar] [CrossRef][Green Version]
- El-Hashash, A.H.; Warburton, D.; Kimber, S.J. Genes and signals regulating murine trophoblast cell development. Mech. Develop. 2010, 127, 1–20. [Google Scholar] [CrossRef]
- Ma, Q. Role of nrf2 in oxidative stress and toxicity. Annu. Rev. Pharmacol. Toxicol. 2013, 53, 401–426. [Google Scholar] [CrossRef]
- Zhang, H.; Davies, K.J.A.; Forman, H.J. Oxidative stress response and Nrf2 signaling in aging. Free. Radic. Bio. Med. 2015, 88, 314–336. [Google Scholar] [CrossRef] [PubMed]
- Xiang, Q.; Zhao, Y.; Lin, J.; Jiang, S.; Li, W. The Nrf2 antioxidant defense system in intervertebral disc degeneration: Molecular insights. Exp. Mol. Med. 2022, 54, 1067–1075. [Google Scholar] [CrossRef]
- Jones, H.N.; Powell, T.L.; Jansson, T. Regulation of Placental Nutrient Transport—A Review. Placenta 2007, 28, 763–774. [Google Scholar] [CrossRef] [PubMed]
- Lager, S.; Powell, T.L. Regulation of Nutrient Transport across the Placenta. J. Pregnancy 2012, 2012, 179827. [Google Scholar] [CrossRef]
- Cetin, I.; Ronzoni, S.; Marconi, A.M.; Perugino, G.; Corbetta, C.; Battaglia, F.C.; Pardi, G. Maternal concentrations and fetal-maternal concentration differences of plasma amino acids in normal and intrauterine growth-restricted pregnancies. Am. J. Obstet. Gynecol. 1996, 174, 1575–1583. [Google Scholar] [CrossRef] [PubMed]
- Paolini, C.L.; Marconi, A.M.; Ronzoni, S.; Di Noio, M.; Fennessey, P.V.; Pardi, G.; Battaglia, F.C. Placental transport of leucine, phenylalanine, glycine, and proline in intrauterine growth-restricted pregnancies. J. Clin. Endocr. Metab. 2001, 86, 5427–5432. [Google Scholar] [CrossRef]
- Vaughan Owen, R.; Maksym, K.; Silva, E.; Barentsen, K.; Anthony Russel, V.; Brown Thomas, L.; Hillman Sara, L.; Spencer, R.; David Anna, L.; Rosario Fredrick, J.R.; et al. Placenta-specific Slc38a2/SNAT2 knockdown causes fetal growth restriction in mice. Clin. Sci. 2021, 135, 2049–2066. [Google Scholar] [CrossRef]


| Ingredients | Composition (%) |
|---|---|
| Corn | 64.65 |
| Soybean meal | 16.00 |
| De-fatted rice bran | 8.00 |
| Wheat bran | 7.00 |
| Soybean oil | 1.40 |
| Monocalcium phosphate | 0.40 |
| Limestone (CaCO3) | 1.50 |
| L-Lysine HCl | 0.25 |
| Threonine | 0.04 |
| Salt | 0.40 |
| Choline chloride | 0.04 |
| Phytase, 10,000 U/g | 0.02 |
| Premix 1 | 0.30 |
| Calculated nutrient content | |
| Net Energy, kcal/kg | 2470 |
| Crude protein, % | 14.46 |
| Ca, % | 0.69 |
| Total P, % | 0.54 |
| Available P, % | 0.26 |
| Lysine, % | 0.63 |
| Methionine, % | 0.24 |
| Threonine, % | 0.42 |
| Tryptophan, % | 0.14 |
| Gene | Primer Sequences | Product Length, bp | Accession No. |
|---|---|---|---|
| CAT | F: CCTGCAACGTTCTGTAAGGC | 72 | NM_214301.2 |
| R: GCTTCATCTGGTCACTGGCT | |||
| GAPDH | F: GCTTGTCATCAATGGAAAGG R: CATACGTAGCACCAGCATCA | 86 | NM_001206359.1 |
| GLUT1 | F: CGTCGCTGGCTTCTCCAACTG | 110 | XM_021096908.1 |
| R: CCAGGAGCACCGTGAAGATGATG | |||
| GPX1 | F: TCTCCAGTGTGTCGCAATGA | 104 | NM_214201.1 |
| R: TCGATGGTCAGAAAGCGACG | |||
| GPX2 | F: AGCCCCACTGTGAAATTCTT | 131 | NM_001115136.1 |
| R: CGTAGAAGGACTTGGCAATG | |||
| HO-1 | F: GAGAAGGCTTTAAGCTGGTG | 74 | NM_001004027.1 |
| R: GTTGTGCTCAATCTCCTCCT | |||
| IL-1β | F: CAAGGAGATGATAGCAACAA | 87 | NM_214055.1 |
| R: CATCACACAAGACAGGTACA | |||
| IL-6 | F: AATGTCGAGGCTGTGCAGATT | 82 | NM_214399 |
| R: TGGTGGCTTTGTCTGGATTCT | |||
| IL-8 | F: CCGTGTCAACATGACTTCCAA | 75 | NM_213867 |
| R: GCCTCACAGAGAGCTGCAGAA | |||
| Nrf2 | F: GACCTTGGAGTAAGTCGAGA | 103 | XM_005671981.3 |
| R: GGAGTTGTTCTTGTCTTTCC | |||
| SOD1 | F: GAAGACAGTGTTAGTAACGG | 93 | NM_001190422.1 |
| R: CAGCCTTGTGTATTATCTCC | |||
| SOD2 | F: GCTGAAAAAGGGTGATGTTA | 81 | NM_214127.2 |
| R: CTATGATTGATGTGGCCTCC | |||
| SNAT2 | F: GCCGCAGCCGTAGAAGAATGATG | 125 | NM_001317081.1 |
| R: AAGCAATTCCGTCTCAACGTGGTC | |||
| SNAT1 | F: GCAGGTCTTCGGCACCACAG | 80 | XM_003355629.4 |
| R: GGTAGCTCAGCATTGCTCCAGTG | |||
| TNF-α | F: TGGCCCCTTGAGCATCA | 68 | NM_214022 |
| R: CGGGCTTATCTGAGGTTTGAGA | |||
| VEGFA | F: CGAGACCCTGGTGGACATCT | 115 | XM_013977975.1 |
| R: CTCCAGACCTTCGTCGTTGC |
| Items | CT | VD3 | 25-OH-D3 | SEM | p-Value |
|---|---|---|---|---|---|
| Number of sows | 15 | 15 | 15 | ||
| Body weight, kg | |||||
| Day 60 of gestation | 199 | 198 | 198 | 2.9 | 0.998 |
| Day 107 of gestation | 221 | 218 | 222 | 2.3 | 0.551 |
| Average backfat thickness, mm | |||||
| Day 60 of gestation | 18.69 | 18.99 | 18.97 | 0.10 | 0.071 |
| Day 107 of gestation | 19.66 | 19.73 | 19.94 | 0.15 | 0.603 |
| At farrowing | |||||
| Total fetus, n | 13.57 | 14.00 | 13.86 | 0.469 | 0.824 |
| Live fetus, n | 12.36 | 12.93 | 13.07 | 0.438 | 0.507 |
| Stillborn, n | 0.64 | 0.73 | 0.64 | 0.245 | 0.956 |
| Mummy, n | 0.50 | 0.33 | 0.14 | 0.186 | 0.427 |
| Average litter weight, kg | 15.58 ab | 15.47 b | 17.79 a | 0.670 | 0.032 |
| Average birth weight, kg | 1.27 ab | 1.21 b | 1.38 a | 0.041 | 0.015 |
| Percentage of average birth weight < 1.0 kg | 12.04 | 6.13 | 6.50 | 10.391 | 0.244 |
| Items | CT | VD3 | 25-OH-D3 | SEM | p-Value |
|---|---|---|---|---|---|
| Gestation d60 | |||||
| SOD, U/mL | 12.23 | 12.23 | 12.83 | 0.604 | 0.761 |
| MDA, nmol/mL | 3.41 | 3.37 | 3.41 | 0.306 | 0.961 |
| GSH-Px, U/mL | 751 | 728 | 753 | 44.7 | 0.911 |
| CAT, U/mL | 3.31 | 3.49 | 3.11 | 0.377 | 0.860 |
| Gestation d107 | |||||
| SOD, U/mL | 13.78 | 13.22 | 12.89 | 0.813 | 0.780 |
| MDA, nmol/mL | 4.41 a | 3.28 b | 3.37 b | 0.160 | 0.001 |
| GSH-Px, U/mL | 829 | 751 | 760 | 45.2 | 0.416 |
| CAT, U/mL | 2.53 | 2.48 | 2.79 | 0.391 | 0.831 |
| Items | CT | VD3 | 25-OH-D3 | SEM | p-Value |
|---|---|---|---|---|---|
| SOD, U/mL | 6.47 | 6.80 | 6.24 | 0.712 | 0.875 |
| MDA, nmol/mL | 7.62 | 8.24 | 7.16 | 0.387 | 0.239 |
| GSH-Px, U/mL | 479 | 509 | 527 | 29.5 | 0.324 |
| CAT, U/mL | 3.07 | 3.02 | 2.98 | 0.275 | 0.971 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, J.; Bi, Q.; Pi, Y.; Jiang, X.; Li, Y.; Li, X. Dietary Supplementation with 25-Hydroxyvitamin D3 on Reproductive Performance and Placental Oxidative Stress in Primiparous Sows during Mid-to-Late Gestation. Antioxidants 2024, 13, 1090. https://doi.org/10.3390/antiox13091090
Li J, Bi Q, Pi Y, Jiang X, Li Y, Li X. Dietary Supplementation with 25-Hydroxyvitamin D3 on Reproductive Performance and Placental Oxidative Stress in Primiparous Sows during Mid-to-Late Gestation. Antioxidants. 2024; 13(9):1090. https://doi.org/10.3390/antiox13091090
Chicago/Turabian StyleLi, Jing, Qingyue Bi, Yu Pi, Xianren Jiang, Yanpin Li, and Xilong Li. 2024. "Dietary Supplementation with 25-Hydroxyvitamin D3 on Reproductive Performance and Placental Oxidative Stress in Primiparous Sows during Mid-to-Late Gestation" Antioxidants 13, no. 9: 1090. https://doi.org/10.3390/antiox13091090
APA StyleLi, J., Bi, Q., Pi, Y., Jiang, X., Li, Y., & Li, X. (2024). Dietary Supplementation with 25-Hydroxyvitamin D3 on Reproductive Performance and Placental Oxidative Stress in Primiparous Sows during Mid-to-Late Gestation. Antioxidants, 13(9), 1090. https://doi.org/10.3390/antiox13091090

