Next Article in Journal
The Abscisic Acid Receptor Gene StPYL8-like from Solanum tuberosum Confers Tolerance to Drought Stress in Transgenic Plants
Previous Article in Journal
TSG Extends the Longevity of Caenorhabditis elegans by Targeting the DAF-16/SKN-1/SIR-2.1-Mediated Mitochondrial Quality Control Process
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Terminalia Chebula Extract Replacing Zinc Oxide Enhances Antioxidant and Anti-Inflammatory Capabilities, Improves Growth Performance, and Promotes Intestinal Health in Weaned Piglets

1
Laboratory of Animal Nutritional Physiology and Metabolic Process, Key Laboratory of Agro-Ecological Processes in Subtropical Region, National Engineering Laboratory for Pollution Control and Waste Utilization in Livestock and Poultry Production, Institute of Subtropical Agriculture, Chinese Academy of Sciences, Changsha 410125, China
2
University of Chinese Academy of Sciences, Beijing 100008, China
3
Hunan Provincial Key Laboratory of the Traditional Chinese Medicine Agricultural Biogenomics, Institute of Bast Fiber Crops, Chinese Academy of Agricultural Sciences, Changsha 410205, China
4
Animal Nutritional Genome and Germplasm Innovation Research Center, College of Animal Science and Technology, Hunan Agricultural University, Changsha 410128, China
*
Authors to whom correspondence should be addressed.
Antioxidants 2024, 13(9), 1087; https://doi.org/10.3390/antiox13091087
Submission received: 4 July 2024 / Revised: 28 August 2024 / Accepted: 2 September 2024 / Published: 5 September 2024

Abstract

This study aimed to assess the effects of substituting zinc oxide with terminalia chebula extract (TCE) on growth performance, antioxidant capacity, immune function, and intestinal health in weaned pigs. Initially, 72 weaned Duroc × Landrace × Large White piglets, 28 days old with an initial weight of 7.43 ± 0.14 kg, equally divided by gender, were randomly assigned into three groups, with six replicates and four piglets per replicate. They were fed a basal diet (CON group), a diet containing 2 g/kg zinc oxide (ZnO group), or 2 g/kg TCE (TCE group) for a duration of 28 days. Subsequently, to further confirm the most appropriate levels of TCE in piglets, 96 piglets of the same breeds and age, with an initial weight of 7.42 ± 0.12 kg, also equally divided by gender, were randomly assigned into four groups, each with six replicates and four piglets per replicate, and fed a basal diet (CON group), or diets supplemented with 1 g/kg TCE (LTCE group), 2 g/kg TCE (MTCE group), or 4 g/kg TCE (HTCE group) for a duration of 28 days. The results demonstrated that both TCE and ZnO reduced diarrhea rates (p = 0.001) and enhanced average daily gain (ADG) (p = 0.014) compared to the control group. TCE at 1 g/kg and 4 g/kg reduced the feed to gain ratio (p = 0.050). Dietary supplementing with TCE and ZnO increased serum total antioxidant capacity (T-AOC) (p = 0.020). Various doses of TCE also increased jejunal IgA (p = 0.000) levels and IL-10 expression (p = 0.004), and decreased the levels of TNF-α in both serum (p = 0.043) and jejunal mucosa (p = 0.000). Notably, TCE reduced the crypt depth (CD) of the duodenal (p = 0.007) and increased the villus height (VH) of the ileal (p = 0.045), and with increased dosage, there was a rise in the villus height to crypt depth ratio (VH:CD) in the duodenum (p = 0.000) and jejunum (p = 0.001). Higher abundances of Lactobacillaceae (p = 0.000) and lower levels of Streptococcaceae (p = 0.000) and Peptostreptococcaceae (p = 0.035) in cecal contents were fed the ZnO and TCE pigs compared with CON pigs. Therefore, TCE was firstly presented as being able to replace zinc oxide, improve intestinal morphology, and enhance antioxidant and immune functions, thus safeguarding intestinal mucosal health and promoting piglet growth.

1. Introduction

During weaning, piglets face physiological, environmental, and dietary changes that diminish their antioxidant and anti-inflammatory capacities, impacting intestinal health and leading to diarrhea, growth retardation, and even death [1,2,3]. Zinc oxide (ZnO) has been shown to enhance growth performance and effectively reduce diarrhea in piglets, thereby improving production performance [4]. However, the use of ZnO in feeds poses environmental pollution risks, affects the absorption of other nutrients by piglets, and contributes to the emergence of resistance for pathogenic bacteria [5]. Our previous studies have indicated that amino acids and plant extracts can improve intestinal health and alleviate diarrhea in weaned piglets, serving as alternatives to ZnO [6,7,8]. Among these alternatives, natural plant extracts are gaining widespread attention for their potential to inhibit harmful bacteria, enhance antioxidant and immune responses, and are considered environmentally friendly with broad application prospects [9].
Terminalia chebula (TC, Combretaceae), commonly known as black myrobalan or ink tree, is a deciduous tree from the Combretaceae family, widely distributed in tropical and subtropical regions around the world. It is extensively used in traditional Chinese and Tibetan medicine for its antioxidant, anti-inflammatory, and gastroprotective effects [10,11,12]. Extracts from TC (TCE) have been identified as potential feed additives that can enhance intestinal health in piglets. In addition, TCE can reduce the harmful bacteria in the animal gut while increasing beneficial bacteria such as Lactobacilli, thus enhancing nutrient digestion, alleviating weaning stress, and improving productivity and performance [13]. TCE also improve antioxidant and anti-inflammatory capacities in weaned bull calves [13]. Our previous research has shown that 600 mg/kg TCE can enhance immune function and antioxidant capacity in yellow broilers [14]. The major bioactive components of TCE include tannins (hydrolyzable tannins), triterpenoids, berberine, phenolic acids, and flavonoids [11,12]. Among them, tannins and berberine possess astringent, antimicrobial, anti-inflammatory, and antioxidant properties and can improve intestinal health and growth performance [15]. Although TCE has been used to some extent in animal production, studies on its effectiveness in substituting ZnO in piglet diets are still insufficient. In addition, the mechanisms by which TCE improves growth performance and intestinal health in weaned piglets require further investigation. Thus, this study aims to evaluate how TCE can substitute ZnO by enhancing antioxidant capacity, modulating inflammatory markers, improving intestinal barrier function, and optimizing gut microbiota to enhance growth performance and reduce diarrhea in piglets, providing a theoretical basis for the inclusion of TCE in piglet diets.

2. Materials and Methods

The procedures in this study were agreed to by the Animal Care and Use Committee of the Institute of Subtropical Agriculture, Chinese Academy of Science (no. ISA-2018-4-25).

2.1. Terminalia Chebula Extract

The TCE (powder form) was provided by Wuxi Zhengda Biotechnology Co., Ltd. (Wuxi, China), with active ingredients including chebulic tannins (45.0%), polysaccharides (14.2%), and flavone (3.1%).

2.2. Experimental Animals, Design, and Diets

Seventy-two weaned piglets (Duroc × Landrace × Large White, 28 days old, half male and half female, initial weight 7.43 ± 0.14 kg), equally divided by gender, were randomly assigned to three groups with six replicates per group and four piglets per replicate. They were fed a basal diet (CON), or the CON diet supplemented with either 2 g/kg ZnO or 2 g/kg TCE. The doses of TCE (2 g/kg) were selected according to the recommendation of a feed-additive company and preliminary feeding experiment (unpublished data). In order to further confirm the most appropriate levels of TCE in piglets, a supplementary experiment was performed. Specifically, ninety-six weaned piglets (Duroc × Landrace × Large White, 28 days old, initial weight 7.42 ± 0.12 kg), also equally divided by gender, were randomly divided into four groups: a control group fed a basal diet (CON), a low-dose TCE group (LTCE) with 1 g/kg TCE added to the basal diet, a medium-dose TCE group (MTC) with 2 g/kg TCE, and a high-dose TCE group (HTCE) with 4 g/kg TCE. The basal diet was formulated according to the recommendations of the National Research Council (NRC, 2012) (Table 1). Both trials lasted for 28 days with ad libitum feeding, and the pigs of each replicate were raised together. Feed was weighted before adding into trough, and the residual feed was collected and weighted in the next morning to calculate the feed consumption. At 0 and 28 days, all piglets were weighed to record, and the average daily gain (ADG) was analyzed according to the weights of per replicate. The average daily feed intake (ADFI) was calculated based on the consumption of feed every day from each replicate. ADG, ADFI, and feed-to-gain ratio (F:G) of piglets in each group were calculated on the basis of each replicate, the results were presented as the average value per replicate. Diarrhea rates were monitored according to the methods recommended by Wang et al. (2021) [16].

2.3. Sample Collection

On days 28 of both experiments, after fasting and weighing, one male piglet from each replicate (n = 6) close to the average weight was selected. Before slaughter, blood samples (5 mL) from the anterior vena cava were collected in blood-collecting vessel without anticoagulant, allowed to settle for 30 min, then centrifuged at 1500× g for 10 min to prepare serum, which was stored at −20 °C for the measurements of antioxidant and immune indices. During slaughter, the intestinal segments were quickly removed and separated. Mucosal samples from the jejunum were carefully scraped with sterile glass slides, rapidly collected, flash-frozen in liquid nitrogen, and stored at −80 °C for the analysis of antioxidant and immune indices. About 3 cm long segments from the middle of the duodenum, jejunum, and ileum were fixed in 10% neutral buffered formalin for histological examination of intestinal tissues. In pigs from the replacing ZnO with TCE trials, the ceca were ligated, wrapped in tin foil, and stored in liquid nitrogen for microbial analysis.

2.4. Diarrhea Incidence

During the formal experiment, the fecal contamination in the anus of each piglet was carefully observed during feeding every day, and the first diarrhea and diarrhea of each repetition were recorded in detail. The diarrhea incidence and fecal consistency scores (0 = normal feces, 1 = soft feces, 2 = mild diarrhea, 3 = severe diarrhea) were determined by a trained investigator with no prior knowledge of the dietary treatment assignment. Diarrhea rate (%) was calculated as the number of pigs with diarrhea × the number of days with diarrhea/(the total number of pigs × the number of study days).

2.5. Serum and Jejunal Mucosal Antioxidant and Immune Indices

Jejunal mucosal samples were homogenized in cold physiological saline (0.9%) at a ratio of 1:9 (weight (g) to volume (mL)), then centrifuged at 3000× g for 15 min at 4 °C. The total antioxidant capacity (T-AOC), catalase (CAT), glutathione peroxidase (GSH-Px), superoxide dismutase (SOD) activity, and malondialdehyde (MDA) levels in serum and jejunal mucosa, were measured using kits provided by Nanjing Jiancheng Bioengineering Institute (Nanjing, China). Serum and jejunal mucosal levels of tumor necrosis factor-alpha (TNF-α), interferon-alpha (IFN-α), immunoglobulins (IgA, IgG, IgM), and cytokines (IL-1β, IL-6, IL-10) were assessed using pig-specific enzyme-linked immunosorbent assay (ELISA) kits from Jiangsu Meimian Industrial Co., Ltd. (Yancheng, China).

2.6. Intestinal Morphology

Tissue samples were processed through washing, dehydration, clearing, paraffin embedding, and then sectioned using a LEICA RM2135 microtome. The sections were further processed through spreading, staining, and cover-slipping. The average villus height (VH), crypt depth (CD), and the ratio of villus height to crypt depth (VH:CD) for each sample were observed and measured using Caseviewer software 2.3. One slide per animal was measured, and five well-oriented villi of each pig at five different views were used to determine these indices.

2.7. Cecal Microbiota Composition

The total bacterial genomic DNA from microbial community of digesta samples in caecal was performed using a DNA Kit (Qiagen, Hilden, Germany) according to the manufacturer’s methods. Briefly, the integrity of the DNA was determined on 1% (weight (g) to volume (mL)) agarose gels, and the yield and purity of DNA were checked. The 16S rRNA of the caecal digesta samples was amplified with the V3-V4 region (338F ACTCCTACGGGAGGCAGCAG and 806R GGACTACHVGGGTWTCTAAT). Purification of PCR product was performed by AxyPrep DNA Gel Extraction Kit (Axygen Biosciences, Union City, CA, USA). Amplicon libraries were sequenced based on Illumina HiSeq PE250 platform (Illumina, San Diego, CA, USA) for paired-end reads of 300 bp. After discarding the low-quality sequencing reads, operational taxonomic unit (OTU) clustering was conducted and delimited at the cutoff of 97% by Uparse software version 7.1. The taxonomy of each OTU representative sequence was analyzed by RDP Classifier version 2.2 against the 16S rRNA database (Silva v138) using a confidence threshold of 70% [16].

2.8. RT-PCR

Jejunal mucosal samples were homogenized in 1 mL Trizol reagent (TaKaRa, Dalian, China), and total RNA was extracted according to the manufacturer’s instructions. RNA purity was assessed by spectrophotometry (Beckman Coulter DU800; Beckman Coulter Inc., Brea, CA, USA) at 260 and 280 nm, with OD260: OD280 ratios between 1.8 and 2.0. cDNA was synthesized using the PrimeScript RT reagent kit with gDNA Eraser (TaKaRa, Dalian, China) as per the manufacturer’s protocol. Real-time quantitative PCR was conducted on a CFX96 Real-Time System (Bio-Rad Laboratories, Inc., Hercules, CA, USA) to measure the expression levels of TNF-α, IFN-γ, IFNα1, IFNβ1, IL-1β, IL-4, IL-6, and IL-10, with β-actin serving as the internal reference transcript. Specific primers (sequences in Table 2) were synthesized by Sangon Biotech (Shanghai, China).

2.9. Statistical Analysis

All data are presented as mean (the group averages) ± standard error of the mean (SEM). Statistical analysis was performed using one-way ANOVA followed by Tukey’s test (IBM SPSS Statistics software 20). For the microbiota data, the abundance of microbiota composition was assessed by the Kruskal–Wallis test. A significance level of p < 0.05 was used. Differences were considered statistically different at p < 0.05. All figures were generated using GraphPad Prism 9.

3. Results

3.1. Effects of Replacing ZnO with TCE on Piglet Growth Performance, Diarrhea Rate, and Serum and Intestinal Mucosal Antioxidant Indices

As shown in Table 3, compared to the CON group, both ZnO and TCE groups increased the ADG (p = 0.014) and reduced the diarrhea rate in piglets (p = 0.002). Although there was no difference in F:G, ZnO and TCE showed a trend towards reduction (p = 0.097). Dietary supplementation of ZnO and TCE increased serum T-AOC levels (Figure 1, p = 0.002). ZnO reduced serum MDA (p = 0.011) levels and increased jejunal mucosal T-AOC levels (p = 0.029). Notably, TCE enhanced jejunal mucosal GSH-Px levels compared with CON and ZnO (p = 0.026).

3.2. Effects of Replacing ZnO with TCE on Piglet Immunity

Compared to the control group, ZnO increased serum IgG levels (p = 0.047) and decreased TNF-α levels (p = 0.043), while there were no significant changes in the TCE group. However, TCE reduced serum IL-1β levels (p = 0.003, Figure 2). Additionally, TCE and ZnO also increased jejunal mucosal IgA (p = 0.000) levels, while TCE decreased IL-2 (p = 0.031) levels (Figure 3). Analysis of gene expression related to inflammatory cytokines revealed that ZnO decreased TNF-α expression (p = 0.006) and increased IL-10 expression (p = 0.018), while TCE showed no significant differences from the control group (p > 0.05, Figure 4).

3.3. Effects of Replacing ZnO with TCE on Piglet Intestinal Morphology

Compared to the control group, TCE increased ileal VH (p = 0.033) and reduced duodenal CD (p = 0.013). ZnO decreased jejunal CD (p = 0.000) and increased both duodenal (p = 0.042) and jejunal VH:CD (p = 0.000, Figure 5).

3.4. Effects of Replacing ZnO with TCE on Piglet Cecal Microbiota Composition

Four alpha-diversity indexes (ACE, Chao, Simpson, and Shannon) were analyzed. Compared with CON group, the lower Shannon indexes (p = 0.039) and higher Simpson indexes (p = 0.022) were presented in the ZnO and TCE groups. However, no difference in the estimators (ACE and Chao) in results was observed among the three dietary treatments (p > 0.05; Figure 6a). At the phylum level, Firmicutes, Actinobacteriota, Proteobacteria, Patescibacteria, Bacteroidota, and Verrucomicrobiota were the top six phyla in the cecal microbiota. As shown in Figure 6b, the TCE group showed an increase in Verrucomicrobiota (p = 0.002). At the family level, Lactobacillaceae, Ruminococcaceae, Lachnospiraceae, Streptococcaceae, Atopobiaceae, and peptostreptococcaceae were the top six in the cecal microbiota (Figure 6c). Higher abundances of Lactobacillaceae (p = 0.000), and lower levels of Streptococcaceae (p = 0.000) and Peptostreptococcaceae (p = 0.035), in cecal contents were in the pigs fed the ZnO and TCE diets compared with CON pigs. Furthermore, compared with the CON group, TCE dietary treatment improved the abundance of Ruminococcaceae (p = 0.040). Additionally, administering ZnO or TCE in diets of pigs did not alter the Lachnospiraceae and Atopobiaceae compared to the CON group (p > 0.05).

3.5. Effects of Different Doses of TCE on Piglet Growth Performance, Diarrhea Rate, and Serum and Intestinal Mucosal Antioxidant Indices

As shown in Table 4, TCE increased ADG (p = 0.004), and both 1 g/kg and 4 g/kg of TCE reduced the F:G (p = 0.005) in piglets. As the dose of TCE increased, the diarrhea rate decreased (p = 0.014). Analysis of serum and intestinal related antioxidant indices indicated that LTCE group reduced serum CAT activity compared with the MTCE group (p = 0.021). Furthermore, compared with the CON group, the LTCE group increased GSH-Px activity in serum (p = 0.016), while the MTCE and HTCE groups increased GSH-Px activity in jejunal mucosa (p = 0.39, Figure 7).

3.6. Effects of Different Doses of TCE on Piglet Immunity

In serum, compared with the CON group, the MTCE group increased IgG levels (p = 0.047) and reduced IL-1β (p = 0.003), while the LTCE group reduced TNF-α (p = 0.043), and the HTCE group increased IFN-α (p = 0.007) concentrations (Figure 8).
Compared to the CON diet, TCE with different concentrations of supplementation increased IgA level in jejunal mucosa (p = 0.000), while TCE with middle-dose supplementation decreased the IL-2 level in jejunal mucosa (p = 0.039). Additionally, compared to CON pigs, pigs in the HTCE group had higher IgG (p = 0.039) and lower IFN-α (p = 0.030) levels in jejunal mucosa. Moreover, compared to the control group, the intestinal mucosal TNF-α (p = 0.000) was decreased and IL-4 (p = 0.030) was increased in LTCE group (Figure 9).
The results of relative expression for inflammatory cytokines in the jejunal mucosa were presented in Figure 10. Compared to the CON group, high doses of TCE reduced IFN-γ expression (p = 0.029), and low doses of TCE decreased IFN-α1 expression (p = 0.001). Compared to the CON and LTCE groups, IL-10 expression in the HTCE group was increased (p = 0.004).

3.7. Effects of Different Doses of TCE on Piglet Intestinal Morphology

Compared with the MTCE group, the HTCE group increased duodenal VH (p = 0.000), while the LTCE and HTCE groups decreased the jejunum VH (p = 0.008, Figure 11a). Compared with the CON and LTCE groups, the MTCE group increased ileum VH (p = 0.045) and ileum VH:CD (p = 0.001). Compared with the CON group, the MTCE and HTCE groups decreased the CD in duodenal (p = 0.007) and jejunum (p = 0.000), and the HTCE group decreased the jejunum CD (p = 0.000, Figure 11b). Additionally, compared with CON, LTCE, and MTCE groups, the HTCE group increased the duodenum VH:CD (p < 0.000, Figure 11c). Compared with the CON group, the MTCE and HTCE groups increased jejunum VH:CD (p < 0.001).

4. Discussion

Under the influence of weaning stress and various diseases, piglets experience increased stress intensity, decreased immunity, and intestinal damage, it and may even lead to severe diarrhea and weight loss [17,18]. Against the backdrop of antibiotic prohibition, limited use of ZnO, and an emphasis on healthy farming practices, the development and application of feed additives such as plant extracts and probiotics have garnered widespread attention [19,20]. TCE exhibits strong antioxidant properties as well as antibacterial and anticancer effects [21,22], showing potential in alleviating piglet weaning stress and improving productivity. Rustia et al. demonstrated that TCE increases the G:F in fattening pigs [23]. Furthermore, TCE inhibits pathogens such as Escherichia coli, Salmonella, Shigella, Clostridium perfringens, and Staphylococcus aureus [24,25]. Previous studies also indicate that TCE can enhance the immune function and antioxidant capacity of broiler chickens, thereby improving intestinal health and growth performance [14]. TCE can increase the relative abundance of beneficial bacteria such as Bacteroides in the gut while reducing the relative abundance of harmful bacteria like Alistipes, thus alleviating inflammation and improving growth performance [14,26]. These studies collectively indicate that TCE can modulate the gut microbiota, enhance immune function, and enhance antioxidant capacity, thereby improving intestinal health and growth performance in animals. However, the effects of TCE as a substitute for ZnO on piglets and its potential mechanisms was not studied. The present study first found that both TCE and ZnO supplementation reduce the piglet diarrhea rate and increase ADG, with the reduction in diarrhea rate showing a dose-dependent relationship with TCE supplementation. Furthermore, 1 g/kg and 4 g/kg TCE reduce the F:G in piglets, suggesting that TCE may substitute for ZnO in controlling diarrhea and promoting piglet growth. Similarly, Xu et al., (2023) [27] demonstrated that 0.15% tannin could improve growth performance, digestibility, and intestinal function of weaned piglets; this positive effect may be associated with various biological functions of tannic acid, such as its astringency or anti-inflammatory effect, which has good potential to improve diarrhea and intestinal health of animals.
TCE exhibits strong antioxidant capacity, primarily attributed to polyphenolic compounds, polysaccharides, certain active proteins, and phenolic acid compounds [28,29]. Saha et al., (2016) [30] found that polyphenols contained in TCE have a phenolic hydroxyl group structure, which has the ability to scour free radicals. Furthermore, TCE can reduce serum MDA levels and increase GSH-px levels in diabetic patients, thereby relieving oxidative stress [10]. Moreover, TCE can reduce reactive oxygen species (ROS) levels, and enhance the activities of SOD, CAT, and GSH, thereby mitigating oxidative damage [26,31,32]. GSH-Px is one of the main antioxidant enzymes in animals, protecting cells from oxidative damage and reducing oxidative stress [13]. Our study found that both TCE and ZnO supplementation increase serum T-AOC. Furthermore, 2 or 4 g/kg TCE can increase duodenal mucosal GSH-Px activity, indicating that 2 or 4 g/kg TCE can substitute for ZnO to enhance piglet antioxidant capacity.
Plant extracts such as TCE can enhance animal immunity, thereby aiding animals in achieving better growth performance and health [33]. TCE can reduce colonic inflammation in mice with colitis [26]. TC exhibits a dose-dependent reduction in serum inflammatory markers in diabetic patients [10]. White lupin (another plant extract) in TCE reduces intestinal inflammation factors such as IFN-γ and TNF-α in mice infected with Salmonella, thereby enhancing mouse immunity [34]. Gallic acid and ellagic acid in TCE can inhibit the production of NO and IL-6 in LPS-induced RAW264.7 cells, exhibiting anti-inflammatory effects [35]. Hydrolyzable tannins in TCE can reduce serum levels of TNF-α, IL-1β, and IL-6 in a dose-dependent manner [36]. IgA is produced by plasma cells differentiated from B cells and reflects the strength of humoral immunity [37]. IL-10 is an anti-inflammatory cytokine with anti-inflammatory effects [38]. IFNs were initially considered substances that “interfere” with virus replication in vitro and are crucial for the immune response to most tested viruses [39]. In our study, different doses of TCE increased intestinal IgA levels and intestinal IL-10 expression, while serum and intestinal mucosal IFN-α levels decreased with increasing doses, indicating that TCE can enhance piglet immune function.
Intestinal morphology and development are closely related to an animal’s ability to absorb nutrients and serve as the first line of defense against harmful substances, making them primary indicators of intestinal health [40]. Studies have found that TCE alleviates pathological damage in mouse intestines, improving the VH:CD [34]. In this study, TCE reduced the duodenal CD and increased ileal VH, with increasing doses leading to an increase in the VHCD in both the duodenum and jejunum. This suggests that TCE can improve the intestinal morphology of piglets. In broiler chicken, TCE-containing diets for broilers resulted in a higher villus height and a higher ratio of villus height to crypt depth [40]. Thus, that research indicated that the integrity of intestinal morphology induced by TCE treatment may increase the beneficial effects on the gut and contribute to improved growth performance.
The gut is the primary site for microbial colonization, with its physiological and metabolic functions, such as nutrient absorption and immune protection, dependent on the gut microbiota [41,42]. Increasing evidence suggests that the gut microbiome may influence swine production. TCE exhibits antibacterial effects against organisms such as Streptococcus mutans and Salmonella typhi [24]. Streptococcaceae are marker microbes in the stools of patients with intestinal inflammation [43]. In addition, studies have shown that Peptostreptococcaceae are positively correlated with obesity and colorectal cancer [44,45]. Lactobacillaceae, a beneficial bacterium, can absorb plant-derived exosome-like nanoparticles to improve intestinal barrier functions, thereby alleviating intestinal diseases [46]. Ruminococcaceae form a multi-enzyme cellulolytic complex that can degrade plant cell wall polysaccharides, and TCE increases their presence in mouse feces [34].
We found that dietary supplementation of ZnO or TCE reduced the relative abundance of Streptococcaceae and Peptostreptococcaceae and increased the relative abundance of Lactobacillaceae. Furthermore, the TCE group showed an increase in Ruminococcaceae abundance. The anti-bacteria activity of TCE proved that the tannin component of TCE could prevent biofilm formation of pathogenic bacteria [47]. These results may support the dietary inclusion of TCE as an alternative to ZnO for increasing the quantity of beneficial microbes and reducing the number of harmful microbes in the piglet cecum, and inflammation-associated microbes, thereby regulating intestinal health.

5. Conclusions

In summary, dietary TCE was firstly presented as it can replace ZnO to improve piglet intestinal morphology, enhance antioxidant capacity, and boost immune function, as well as modulate the gut microbiome, thereby protecting the intestinal mucosa and promoting piglet growth. Furthermore, the recommended dose of TCE in piglet feed is 4 g/kg, positioning TCE as a potential feed additive.

Author Contributions

The study was conceived by T.W., Y.L. and K.Y. The original draft of this article was written by T.W., supervised by Y.L. and K.Y.; L.Y., J.C., P.S., F.W., K.W. and Y.Y. have contributed to the development of the methodology, design of the study, and data analysis, and reviewed and edited the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Key Research and Development Program of China (2023YFD1301005), Natural Science Foundation of Changsha Municipal (kq2208249), Central Public-interest Scientific Institution Basal Research Fund (1610242022001-02; 1610242024009) and Agricultural Science and Technology Innovation Project Special Fund of Chinese Academy of Agricultural Sciences (ASTIP-IBFC).

Institutional Review Board Statement

I The procedures in this study were agreed by the Animal Care and Use Committee of the Institute of Subtropical Agriculture, Chinese Academy of Science (no. ISA-2018-4-25).

Informed Consent Statement

Not applicable.

Data Availability Statement

Dataset available on request from the authors.

Conflicts of Interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

References

  1. Hansen, L.H.B.; Nielsen, B.; Boll, E.; Skjøt-Rasmussen, L.; Wellejus, A.; Jørgensen, L.; Lauridsen, C.; Canibe, N.J. Functional in vitro screening of probiotic strains for inoculation of piglets as a prophylactic measure towards Enterotoxigenic Escherichia coli infection. J. Microbiol. Methods 2021, 180, 106126. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Yin, J.; Wu, M.M.; Xiao, H.; Ren, W.K.; Duan, J.L.; Yang, G.; Li, T.J.; Yin, Y.L. Development of an antioxidant system after early weaning in piglets. J. Anim. Sci. 2014, 92, 612. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Zhou, X.; Zhang, Y.; Wu, X.; Wan, D.; Yin, Y. Effects of Dietary Serine Supplementation on Intestinal Integrity, Inflammation and Oxidative Status in Early-Weaned Piglets. Cell. Physiol. Biochem. 2018, 48, 993–1002. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Hill, G.; Cromwell, G.; Crenshaw, T.; Dove, C.; Ewan, R.; Knabe, D.; Lewis, A.; Libal, G.; Mahan, D.; Shurson, G. Growth promotion effects and plasma changes from feeding high dietary concentrations of zinc and copper to weanling pigs (regional study). J. Anim. Sci. 2000, 78, 1010–1016. [Google Scholar] [CrossRef] [Scilit]
  5. Bednorz, C.; Oelgeschläger, K.; Kinnemann, B.; Hartmann, S.; Neumann, K.; Pieper, R.; Bethe, A.; Semmler, T.; Tedin, K.; Schierack, P. The broader context of antibiotic resistance: Zinc feed supplementation of piglets increases the proportion of multi-resistant Escherichia coli in vivo. Int. J. Med. Microbiol. 2013, 303, 396–403. [Google Scholar] [CrossRef] [Scilit]
  6. Li, Y.; Bao, X.; Yang, F.; Tian, J.; Su, W.; Yin, J.; Yao, K.; Li, T.; Yin, Y. Ornithine α-Ketoglutarate Alleviates Inflammation via Regulating Ileal Mucosa Microbiota and Metabolites in Enterotoxigenic Escherichia coli-Infected Pigs. Front. Nutr. 2022, 9, 862498. [Google Scholar] [CrossRef] [Scilit]
  7. Wang, J.; Xiao, Y.; Li, J.; Qi, M.; Tan, B. Serum biochemical parameters and amino acids metabolism are altered in piglets by early-weaning and proline and putrescine supplementations. Anim. Nutr. 2021, 7, 334–345. [Google Scholar] [CrossRef] [Scilit]
  8. Tian, J.; Jiang, Q.; Bao, X.; Yang, F.; Li, Y.; Sun, H.; Yao, K.; Yin, Y. Plant-derived squalene supplementation improves growth performance and alleviates acute oxidative stress-induced growth retardation and intestinal damage in piglets. Anim. Nutr. 2023, 15, 386–398. [Google Scholar] [CrossRef] [Scilit]
  9. Long, S.; Liu, S.; Wang, J.; Mahfuz, S.; Piao, X. Natural capsicum extract replacing chlortetracycline enhances performance via improving digestive enzyme activities, antioxidant capacity, anti-inflammatory function, and gut health in weaned pigs. Anim. Nutr. 2021, 7, 305–314. [Google Scholar] [CrossRef] [Scilit]
  10. Pingali, U.; Sukumaran, D.; Nutalapati, C. Effect of an aqueous extract of Terminalia chebula on endothelial dysfunction, systemic inflammation, and lipid profile in type 2 diabetes mellitus: A randomized double-blind, placebo-controlled clinical study. Phytother. Res. 2020, 34, 3226–3235. [Google Scholar] [CrossRef] [Scilit]
  11. Nigam, M.; Mishra, A.P.; Adhikari-Devkota, A.; Dirar, A.I.; Hassan, M.M.; Adhikari, A.; Belwal, T.; Devkota, H.P. Fruits of Terminalia chebula Retz.: A review on traditional uses, bioactive chemical constituents and pharmacological activities. Phytother. Res. 2020, 34, 2518–2533. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Jeong, H.K.; Lee, D.; Kim, H.P.; Baek, S.-H. Structure analysis and antioxidant activities of an amylopectin-type polysaccharide isolated from dried fruits of Terminalia chebula. Carbohydr. Polym. 2019, 211, 100–108. [Google Scholar] [CrossRef] [Scilit]
  13. Bostami, A.R.; Khan, M.R.I.; Rabbi, A.Z.; Siddiqui, M.N.; Islam, M.T. Boosting animal performance, immune index and antioxidant status in post-weaned bull calves through dietary augmentation of selective traditional medicinal plants. Vereinary Anim. Sci. 2021, 14, 100197. [Google Scholar] [CrossRef] [Scilit]
  14. Cheng, Y.; Liu, S.; Wang, F.; Wang, T.; Yin, L.; Chen, J.; Fu, C. Effects of Dietary Terminalia chebula Extract on Growth Performance, Immune Function, Antioxidant Capacity, and Intestinal Health of Broilers. Animals 2024, 14, 746. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Song, Y.; Luo, Y.; Yu, B.; He, J.; Zheng, P.; Mao, X.; Huang, Z.; Luo, J.; Luo, Y.; Yan, H.; et al. Tannic acid extracted from gallnut prevents post-weaning diarrhea and improves intestinal health of weaned piglets. Anim. Nutr. 2021, 7, 1078–1086. [Google Scholar] [CrossRef] [Scilit]
  16. Wang, F.; Yin, Y.; Yang, M.; Chen, J.; Fu, C.; Huang, K. Effects of Combined Supplementation of Macleaya cordata Extract and Benzoic Acid on the Growth Performance, Immune Responses, Antioxidant Capacity, Intestinal Morphology, and Microbial Composition in Weaned Piglets. Front. Vet. Sci. 2021, 8, 708597. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  17. He, L.; Huang, N.; Li, H.; Tian, J.; Zhou, X.; Li, T.; Yao, K.; Wu, G.; Yin, Y. AMPK/α-ketoglutarate axis regulates intestinal water and ion homeostasis in young pigs. J. Agric. Food Chem. 2017, 65, 2287–2298. [Google Scholar] [CrossRef] [Scilit]
  18. Yu, J.; Song, Y.; Yu, B.; He, J.; Zheng, P.; Mao, X.; Huang, Z.; Luo, Y.; Luo, J.; Yan, H.; et al. Tannic acid prevents post-weaning diarrhea by improving intestinal barrier integrity and function in weaned piglets. J. Anim. Sci. Biotechnol. 2020, 11, 87. [Google Scholar] [CrossRef] [Scilit]
  19. Gao, Y.; Meng, Q.; Qin, J.; Zhao, Q.; Shi, B. Biotechnology. Resveratrol alleviates oxidative stress induced by oxidized soybean oil and improves gut function via changing gut microbiota in weaned piglets. J. Anim. Sci. Biotechnol. 2023, 14, 54. [Google Scholar] [CrossRef] [Scilit]
  20. Ma, J.; Duan, Y.; Li, R.; Liang, X.; Li, T.; Huang, X.; Yin, Y.; Yin, J. Gut microbial profiles and the role in lipid metabolism in Shaziling pigs. Anim. Nutr. 2022, 9, 345–356. [Google Scholar] [CrossRef] [Scilit]
  21. Mohammadi, T.; Soltani, L. Effects of hydroethanolic extracts of Terminalia chebula and Thymbra spicata on ram fresh semen under normal and oxidative stress conditions. Vet. Med. Sci. 2021, 7, 1778–1785. [Google Scholar] [CrossRef] [Scilit]
  22. Zhao, L.; Duan, Z.; Wang, Y.; Wang, M.; Liu, Y.; Wang, X.; Li, H. Protective effect of Terminalia chebula Retz. extract against Aβ aggregation and Aβ-induced toxicity in Caenorhabditis elegans. J. Ethnopharmacol. 2021, 268, 113640. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Rustia, H.M.A.; Decena, K.S.; Iranzo, M.F.M.; Sulabo, R.C. Effect of a plant extract mixture as an alternative to ractopamine hydrochloride on growth performance and carcass characteristics of finishing pigs. Philipp. J. Vet. Anim. Sci. 2020, 46, 31–39. [Google Scholar]
  24. Nam, Y.J.; Hwang, Y.S. Antibacterial and antioxidant effect of ethanol extracts of Terminalia chebula on Streptococcus mutans. Clin. Exp. Dent. Res. 2021, 7, 987–994. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Khan, I.; Ullah, Z.; Shad, A.A.; Fahim, M.; Öztürk, M. In vitro antioxidant, anticholinesterase inhibitory, and antimicrobial activity studies of Terminalia chebula (Retz) and Terminalia arjuna (Roxb). S. Afr. J. Bot. 2022, 146, 395–400. [Google Scholar] [CrossRef] [Scilit]
  26. Dong, W.-R.; Li, Y.-Y.; Liu, T.-T.; Zhou, G.; Chen, Y.-X. Ethyl acetate extract of Terminalia chebula alleviates DSS-induced ulcerative colitis in C57BL/6 mice. Front. Pharmacol. 2023, 14, 1229772. [Google Scholar] [CrossRef] [Scilit]
  27. Xu, T.; Ma, X.; Zhou, X.; Qian, M.; Yang, Z.; Cao, P.; Han, X. Coated tannin supplementation improves growth performance, nutrients digestibility, and intestinal function in weaned piglets. J. Anim. Sci. 2022, 100, skac088. [Google Scholar] [CrossRef] [Scilit]
  28. Srivastava, P.; Raut, H.N.; Wagh, R.S.; Puntambekar, H.M.; Kulkarni, M.J. Purification and characterization of an antioxidant protein (∼16 kDa) from Terminalia chebula fruit. Food Chem. 2012, 131, 141–148. [Google Scholar] [CrossRef] [Scilit]
  29. Liang, X.; Fei, W.; He, M.; Li, X. Enhanced antioxidant capacities in vivo caused by the change in key constituent of Terminalia chebula Retz. treated with Tibet traditional process. Wuhan Univ. J. Nat. Sci. 2016, 21, 544–548. [Google Scholar] [CrossRef] [Scilit]
  30. Lee, H.S.; Won, N.H.; Kim, K.H.; Lee, H.; Jun, W.; Lee, K.W. Antioxidant effects of aqueous extract of Terminalia chebula in vivo and in vitro. Biol. Pharm. Bull. 2005, 28, 1639–1644. [Google Scholar] [CrossRef] [Scilit]
  31. Kim, M.-S.; Lee, D.Y.; Lee, J.; Kim, H.W.; Sung, S.H.; Han, J.-S.; Jeon, W.K. Terminalia chebula extract prevents scopolamine-induced amnesia via cholinergic modulation and anti-oxidative effects in mice. BMC Complement. Altern. Med. 2018, 18, 136. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. Feng, X.-H.; Xu, H.-Y.; Wang, J.-Y.; Duan, S.; Wang, Y.-C.; Ma, C.-M. In vivo hepatoprotective activity and the underlying mechanism of chebulinic acid from Terminalia chebula fruit. Phytomedicine 2021, 83, 153479. [Google Scholar] [CrossRef] [Scilit]
  33. Zhong, X.; Shi, Y.; Chen, J.; Xu, J.; Wang, L.; Beier, R.C.; Hou, X.; Liu, F. Polyphenol extracts from Punica granatum and Terminalia chebula are anti-inflammatory and increase the survival rate of chickens challenged with Escherichia coli. Biol. Pharm. Bull. 2014, 37, 1575–1582. [Google Scholar] [CrossRef] [Scilit]
  34. Kong, Q.; Shang, Z.; Liu, Y.; Fakhar-e-Alam Kulyar, M.; Suo-lang, S.; Xu, Y.; Tan, Z.; Li, J.; Liu, S. Preventive effect of Terminalia bellirica (Gaertn.) Roxb. extract on mice infected with Salmonella Typhimurium. Front. Cell. Infect. Microbiol. 2023, 12, 1054205. [Google Scholar] [CrossRef] [Scilit]
  35. BenSaad, L.A.; Kim, K.H.; Quah, C.C.; Kim, W.R.; Shahimi, M. Anti-inflammatory potential of ellagic acid, gallic acid and punicalagin A&B isolated from Punica granatum. BMC Complement. Altern. Med. 2017, 17, 47. [Google Scholar] [CrossRef] [Scilit]
  36. Ekambaram, S.P.; Perumal, S.S.; Erusappan, T.; Srinivasan, A. Hydrolysable tannin-rich fraction from Terminalia chebula Retz. fruits ameliorates collagen-induced arthritis in BALB/c mice. Inflammopharmacology 2020, 28, 275–287. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  37. Patel, N.C.; Hertel, P.M.; Estes, M.K.; De La Morena, M.; Petru, A.M.; Noroski, L.M.; Revell, P.A.; Hanson, I.C.; Paul, M.E.; Rosenblatt, H.M. Vaccine-acquired rotavirus in infants with severe combined immunodeficiency. N. Engl. J. Med. 2010, 362, 314–319. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  38. Sabat, R. IL-10 family of cytokines. Cytokine Growth Factor Rev. 2010, 21, 315–324. [Google Scholar] [CrossRef] [Scilit]
  39. Zhang, S.Y.; Boisson-Dupuis, S.; Chapgier, A.; Yang, K.; Bustamante, J.; Puel, A.; Picard, C.; Abel, L.; Jouanguy, E.; Casanova, J.L. Inborn errors of interferon (IFN)-mediated immunity in humans: Insights into the respective roles of IFN-α/β, IFN-γ, and IFN-λ in host defense. Immunol. Rev. 2008, 226, 29–40. [Google Scholar] [CrossRef] [Scilit]
  40. Ma, L.; Ni, Y.; Wang, Z.; Tu, W.; Ni, L.; Zhuge, F.; Zheng, A.; Hu, L.; Zhao, Y.; Zheng, L. Spermidine improves gut barrier integrity and gut microbiota function in diet-induced obese mice. Gut Microbes 2020, 12, 1832857. [Google Scholar] [CrossRef] [Scilit]
  41. Yin, J.; Li, Y.; Han, H.; Liu, Z.; Zeng, X.; Li, T.; Yin, Y. Long-term effects of lysine concentration on growth performance, intestinal microbiome, and metabolic profiles in a pig model. Food Funct. 2018, 9, 4153–4163. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  42. Yin, J.; Li, Y.; Han, H.; Chen, S.; Gao, J.; Liu, G.; Wu, X.; Deng, J.; Yu, Q.; Huang, X.; et al. Melatonin reprogramming of gut microbiota improves lipid dysmetabolism in high-fat diet-fed mice. J. Pineal Res. 2018, 65, e12524. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  43. Pinto, S.; Benincà, E.; Galazzo, G.; Jonkers, D.; Penders, J.; Bogaards, J.A. Heterogeneous associations of gut microbiota with Crohn’s disease activity. Gut Microbes 2024, 16, 2292239. [Google Scholar] [CrossRef] [Scilit]
  44. Jennings, A.; Kühn, T.; Bondonno, N.P.; Waniek, S.; Bang, C.; Franke, A.; Kassubek, J.; Müller, H.-P.; Both, M.; Weber, K.S. The gut microbiome modulates associations between adherence to a Mediterranean-style diet, abdominal adiposity, and C-reactive protein in population-level analysis. Am. J. Clin. Nutr. 2024, 119, 136–144. [Google Scholar] [CrossRef] [Scilit]
  45. Wang, J.; Tang, L.; Zhou, H.; Zhou, J.; Glenn, T.C.; Shen, C.-L.; Wang, J.-S. Long-term treatment with green tea polyphenols modifies the gut microbiome of female sprague-dawley rats. J. Nutr. Biochem. 2018, 56, 55–64. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  46. Teng, Y.; Ren, Y.; Sayed, M.; Hu, X.; Lei, C.; Kumar, A.; Hutchins, E.; Mu, J.; Deng, Z.; Luo, C.; et al. Plant-derived exosomal microRNAs shape the gut microbiota. Cell Host Microbe 2018, 24, 637–652. e638. [Google Scholar] [CrossRef] [Scilit]
  47. Shukla, V.; Bhathena, Z. Sustained release of a purified tannin component of Terminalia chebula from a titanium implant surface prevents biofilm formation by Staphylococcus aureus. Appl. Biochem. Biotechnol. 2015, 175, 3542–3556. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Effects of replacing ZnO with TCE on piglet serum and intestinal mucosal antioxidant indices (n = 6). (a) Serum T-AOC; (b) Serum SOD; (c) Serum CAT; (d) Serum GSH-px; (e) Serum MDA; (f) Jejunal mucosa T-AOC; (g) Jejunal mucosa SOD; (h) Jejunal mucosa CAT; (i) Jejunal mucosa GSH-px; (j) Jejunal mucosa MDA. Bars sharing different letter notations (a, b) are significantly different from each other (p < 0.05).
Figure 1. Effects of replacing ZnO with TCE on piglet serum and intestinal mucosal antioxidant indices (n = 6). (a) Serum T-AOC; (b) Serum SOD; (c) Serum CAT; (d) Serum GSH-px; (e) Serum MDA; (f) Jejunal mucosa T-AOC; (g) Jejunal mucosa SOD; (h) Jejunal mucosa CAT; (i) Jejunal mucosa GSH-px; (j) Jejunal mucosa MDA. Bars sharing different letter notations (a, b) are significantly different from each other (p < 0.05).
Antioxidants 13 01087 g001
Figure 2. Effects of replacing ZnO with TCE on serum inflammatory cytokines (n = 6). (a) IgA; (b) IgG; (c) IgM; (d) TNF-α; (e) INF-α; (f) IL-1β; (g) IL-2; (h) IL-4; (i) IL-6; (j) IL-10. Bars sharing different letter notations (a, b) are significantly different from each other (p < 0.05).
Figure 2. Effects of replacing ZnO with TCE on serum inflammatory cytokines (n = 6). (a) IgA; (b) IgG; (c) IgM; (d) TNF-α; (e) INF-α; (f) IL-1β; (g) IL-2; (h) IL-4; (i) IL-6; (j) IL-10. Bars sharing different letter notations (a, b) are significantly different from each other (p < 0.05).
Antioxidants 13 01087 g002
Figure 3. Effects of replacing ZnO with TCE on piglet jejunal mucosa inflammatory cytokines (n = 6). (a) IgA; (b) IgG; (c) IgM; (d) TNF-α; (e) IFN-α; (f) IL-1β; (g) IL-2; (h) IL-4; (i) IL-6; (j) IL-10. Bars sharing different letter notations (a, b) are significantly different from each other (p < 0.05).
Figure 3. Effects of replacing ZnO with TCE on piglet jejunal mucosa inflammatory cytokines (n = 6). (a) IgA; (b) IgG; (c) IgM; (d) TNF-α; (e) IFN-α; (f) IL-1β; (g) IL-2; (h) IL-4; (i) IL-6; (j) IL-10. Bars sharing different letter notations (a, b) are significantly different from each other (p < 0.05).
Antioxidants 13 01087 g003
Figure 4. Effects of replacing ZnO with TCE on piglets relative to expression of inflammatory cytokines in the jejunal mucosa (n = 6). (a) TNF-α; (b) INF-γ; (c) IFN-α1; (d) IFN-β1; (e) IL-1β; (f) IL-4; (g) IL-6; (h) IL-10. Bars sharing different letter notations (a, b) are significantly different from each other (p < 0.05).
Figure 4. Effects of replacing ZnO with TCE on piglets relative to expression of inflammatory cytokines in the jejunal mucosa (n = 6). (a) TNF-α; (b) INF-γ; (c) IFN-α1; (d) IFN-β1; (e) IL-1β; (f) IL-4; (g) IL-6; (h) IL-10. Bars sharing different letter notations (a, b) are significantly different from each other (p < 0.05).
Antioxidants 13 01087 g004
Figure 5. Effects of replacing ZnO with TCE on piglet intestinal morphology (n = 6). (a) Villus height; (b) Crypt depth; (c) Villus height:Crypt depth. Bars sharing different letter notations (a, b) are significantly different from each other (p < 0.05).
Figure 5. Effects of replacing ZnO with TCE on piglet intestinal morphology (n = 6). (a) Villus height; (b) Crypt depth; (c) Villus height:Crypt depth. Bars sharing different letter notations (a, b) are significantly different from each other (p < 0.05).
Antioxidants 13 01087 g005
Figure 6. Effects of replacing ZnO with TCE on piglet cecal microbiota composition (n = 6). (a) α-Diversity; (b) at the phylum; (c) at the family. Bars sharing different letter notations (a, b) are significantly different from each other (p < 0.05).
Figure 6. Effects of replacing ZnO with TCE on piglet cecal microbiota composition (n = 6). (a) α-Diversity; (b) at the phylum; (c) at the family. Bars sharing different letter notations (a, b) are significantly different from each other (p < 0.05).
Antioxidants 13 01087 g006
Figure 7. Effects of different doses of TCE on piglet serum and intestinal mucosal antioxidant indices (n = 6). (a) Serum T-AOC; (b) Serum SOD; (c) Serum CAT; (d) Serum GSH-px; (e) Serum MDA; (f) Jejunal mucosa T-AOC; (g) Jejunal mucosa SOD; (h) Jejunal mucosa CAT; (i) Jejunal mucosa GSH-px; (j) Jejunal mucosa MDA. Bars sharing the different letter notations (a, b) are significantly different from each other (p < 0.05).
Figure 7. Effects of different doses of TCE on piglet serum and intestinal mucosal antioxidant indices (n = 6). (a) Serum T-AOC; (b) Serum SOD; (c) Serum CAT; (d) Serum GSH-px; (e) Serum MDA; (f) Jejunal mucosa T-AOC; (g) Jejunal mucosa SOD; (h) Jejunal mucosa CAT; (i) Jejunal mucosa GSH-px; (j) Jejunal mucosa MDA. Bars sharing the different letter notations (a, b) are significantly different from each other (p < 0.05).
Antioxidants 13 01087 g007
Figure 8. Effects of different doses of TCE on piglet serum inflammatory cytokines (n = 6). (a) IgA; (b) IgG; (c) IgM; (d) TNF-α; (e) INF-α; (f) IL-1β; (g) IL-2; (h) IL-4; (i) IL-6; (j) IL-10. Bars sharing different letter notations (a, b) are significantly different from each other (p < 0.05).
Figure 8. Effects of different doses of TCE on piglet serum inflammatory cytokines (n = 6). (a) IgA; (b) IgG; (c) IgM; (d) TNF-α; (e) INF-α; (f) IL-1β; (g) IL-2; (h) IL-4; (i) IL-6; (j) IL-10. Bars sharing different letter notations (a, b) are significantly different from each other (p < 0.05).
Antioxidants 13 01087 g008
Figure 9. Effects of different doses of TCE on piglet jejunal mucosa inflammatory cytokines (n = 6). (a) IgA; (b) IgG; (c) IgM; (d) TNF-α; (e) IFN-α; (f) IL-1β; (g) IL-2; (h) IL-4; (i) IL-6; (j) IL-10. Bars sharing different letter notations (a, b) are significantly different from each other (p < 0.05).
Figure 9. Effects of different doses of TCE on piglet jejunal mucosa inflammatory cytokines (n = 6). (a) IgA; (b) IgG; (c) IgM; (d) TNF-α; (e) IFN-α; (f) IL-1β; (g) IL-2; (h) IL-4; (i) IL-6; (j) IL-10. Bars sharing different letter notations (a, b) are significantly different from each other (p < 0.05).
Antioxidants 13 01087 g009
Figure 10. Effects of different doses of TCE on piglets relative to expression of inflammatory cytokines in the jejunal mucosa (n = 6). (a) TNF-α; (b) INF-γ; (c) IFN-α1; (d) IFN-β1; (e) IL-1β; (f) IL-4; (g) IL-6; (h) IL-10. Bars sharing different letter notations (a, b) are significantly different from each other (p < 0.05).
Figure 10. Effects of different doses of TCE on piglets relative to expression of inflammatory cytokines in the jejunal mucosa (n = 6). (a) TNF-α; (b) INF-γ; (c) IFN-α1; (d) IFN-β1; (e) IL-1β; (f) IL-4; (g) IL-6; (h) IL-10. Bars sharing different letter notations (a, b) are significantly different from each other (p < 0.05).
Antioxidants 13 01087 g010
Figure 11. Effects of different doses of TCE on piglet intestinal morphology (n = 6). (a) Villus height; (b) Crypt depth; (c) Villus height: Crypt depth. Bars sharing different letter notations (a, b) are significantly different from each other (p < 0.05).
Figure 11. Effects of different doses of TCE on piglet intestinal morphology (n = 6). (a) Villus height; (b) Crypt depth; (c) Villus height: Crypt depth. Bars sharing different letter notations (a, b) are significantly different from each other (p < 0.05).
Antioxidants 13 01087 g011
Table 1. Ingredients and nutrient levels of basal diets (%, as-fed basis).
Table 1. Ingredients and nutrient levels of basal diets (%, as-fed basis).
IngredientsCONZnOLTCEMTCEHTCE
Corn (crude protein, 7.8%)55.0054.6054.7554.6054.20
Full-fat soybean powder (crude protein, 35%)10.0010.0010.0010.0010.00
Soybean meal (crude protein, 43%)19.0019.1019.1019.1019.20
Whey powder6.156.156.156.156.15
Fish meal (crude protein, 65%)5.005.005.005.005.00
Soybean oil1.501.601.551.601.70
L-Lysine·HCl (lysine, 78%)0.480.480.480.480.48
DL-Methionine (methionine, 98%)0.100.100.100.100.10
L-Threonine (threonine, 98%)0.050.050.050.050.05
L-Tryptophan (tryptophan, 98%)0.020.020.020.020.02
Dicalcium phosphate0.900.900.900.900.90
Limestone0.500.500.500.500.50
Sodium chloride0.300.300.300.300.30
Compound vitamin and mineral Premix 11.001.001.001.001.00
Zinc oxide 0.2
TCE 0.10.20.4
Total100100100100100
Nutrient level 2
Dry matter86.7886.8286.8086.8286.86
Digestible energy (MJ/kg)14.2914.2914.2914.2914.28
Crude protein20.0920.1020.1120.1020.11
Lysine1.491.491.491.491.49
Methionine0.450.450.450.450.45
Methionine + cysteine0.780.780.780.780.78
Threonine0.820.820.820.820.82
Tryptophan0.250.250.250.250.25
Calcium0.740.740.740.740.74
Total phosphorus0.640.640.640.640.64
1 The premix provide the following (per kg of the diet): vitamin A, 12,000 IU; vitamin D, 2500 IU; vitamin E, 30 IU; vitamin B12, 12 μg; vitamin K3, 3 mg; pantothenic acid, 15 mg; niacin, 40 mg; choline chloride, 400 mg; Mn (MnSO4·H2O), 40 mg; Zn (ZnSO4·H2O), 100 mg; Fe (FeSO4·H2O), 90 mg; Cu (CuSO4·5H2O), 8.8 mg; I (KI), 0.35 mg; Se (Na2SeO3), 0.3 mg. 2 The nutrient levels were calculated values.
Table 2. Primer sequences for real-time PCR.
Table 2. Primer sequences for real-time PCR.
GenePrimers SequencesSize (bp)Accession No.
TNF-αF: CCACGCTCTTCTGCCTACTGC132NM_214022.1
R: CGACGGGCTTATCTGAGGTTTG
IFN-γF: CCATTCAAAGGAGCATGGAT146NM_213948.1
R: GAGTTCACTGATGGCTTTGC
IFN-α1F: GACTCCATCCTGGCTGTG103M28623
R: TGACTTCTGCCCTGACGA
IFN-β1F: CAACAAAGGAGCAGCAAT111S41178
R: CCTCAGGGACCTCAAAGT
IL-1βF: ATGCTGAAGGCTCTCCACCTC89NM_214055.1
R: TTGTTGCTATCATCTCCTTGCAC
IL-4F: CAACCCTGGTCTGCTTACTG173NM_214123.1
R: CTTCTCCGTCGTGTTCTCTG
IL-6F: CTTCAGTCCAGTCGCCTTCTCC96NM_001252429.1
R: GCATCACCTTTGGCATCTTCTT
IL-10F: GGGCTATTTGTCCTGACTGC105NM_214041.1
R: GGATTCTTCATCGGCTTCT
Table 3. Effects of replacing ZnO with TCE on piglet growth performance and diarrhea rate.
Table 3. Effects of replacing ZnO with TCE on piglet growth performance and diarrhea rate.
ItemsCONZnOTCEp-Value
Initial weight, kg7.49 ± 0.347.39 ± 0.207.42 ± 0.220.962
Final weight, kg18.60 ± 0.5219.67 ± 0.5719.81 ± 0.420.213
ADG, g/day395.24 ± 9.29 b438.69 ± 12.22 a442.41 ± 10.96 a0.014
ADFI, g/day747.03 ± 5.06772.05 ± 4.42769.71 ± 15.170.159
F:G (feed/gain, g/g)1.85 ± 0.031.77 ± 0.041.74 ± 0.030.097
Diarrhea rate, %5.50 ± 0.42 a2.08 ± 0.75 b3.32 ± 0.42 b0.002
Data are shown as the mean ± SEM. a,b Within a row, different superscripts refer to significant difference (p < 0.05). ADG: average daily gain; ADFI: average daily feed intake; F:G: feed-to-gain ratio.
Table 4. Effects of different doses of TCE on piglet growth performance and diarrhea rate.
Table 4. Effects of different doses of TCE on piglet growth performance and diarrhea rate.
ItemsCONLTCEMTCEHTCEp-Value
Initial weight, kg7.49 ± 0.347.38 ± 0.67.42 ± 0.227.39 ± 0.200.991
Final weight, kg18.60 ± 0.5220.03 ± 0.6019.81 ± 0.4219.96 ± 0.490.192
ADG, g/day395.24 ± 9.29 b448.84 ± 10.31 a442.41 ± 10.96 a451.79 ± 11.69 a0.004
ADFI, g/day747.03 ± 5.06769.71 ± 15.17769.71 ± 15.17763.57 ± 11.670.497
F:G (feed/gain, g/g)1.85 ± 0.03 a1.68 ± 0.02 b1.74 ± 0.03 ab1.70 ± 0.04 b0.005
Diarrhea rate, %5.50 ± 0.42 a3.42 ± 0.58 ab3.32 ± 0.42 b2.99 ± 0.69 b0.014
Data are shown as the mean ± SEM. a,b Within a row, different superscripts indicate significant difference (p < 0.05). ADG: average daily gain; ADFI: average daily feed intake; F:G: feed to gain ratio.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Wang, T.; Li, Y.; Yin, L.; Chen, J.; Shi, P.; Wang, F.; Wu, K.; Yao, K.; Yin, Y. Terminalia Chebula Extract Replacing Zinc Oxide Enhances Antioxidant and Anti-Inflammatory Capabilities, Improves Growth Performance, and Promotes Intestinal Health in Weaned Piglets. Antioxidants 2024, 13, 1087. https://doi.org/10.3390/antiox13091087

AMA Style

Wang T, Li Y, Yin L, Chen J, Shi P, Wang F, Wu K, Yao K, Yin Y. Terminalia Chebula Extract Replacing Zinc Oxide Enhances Antioxidant and Anti-Inflammatory Capabilities, Improves Growth Performance, and Promotes Intestinal Health in Weaned Piglets. Antioxidants. 2024; 13(9):1087. https://doi.org/10.3390/antiox13091087

Chicago/Turabian Style

Wang, Tao, Yuying Li, Lichen Yin, Jiashun Chen, Pengjun Shi, Fang Wang, Kangle Wu, Kang Yao, and Yulong Yin. 2024. "Terminalia Chebula Extract Replacing Zinc Oxide Enhances Antioxidant and Anti-Inflammatory Capabilities, Improves Growth Performance, and Promotes Intestinal Health in Weaned Piglets" Antioxidants 13, no. 9: 1087. https://doi.org/10.3390/antiox13091087

APA Style

Wang, T., Li, Y., Yin, L., Chen, J., Shi, P., Wang, F., Wu, K., Yao, K., & Yin, Y. (2024). Terminalia Chebula Extract Replacing Zinc Oxide Enhances Antioxidant and Anti-Inflammatory Capabilities, Improves Growth Performance, and Promotes Intestinal Health in Weaned Piglets. Antioxidants, 13(9), 1087. https://doi.org/10.3390/antiox13091087

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop