Effects of Berberine on Lipid Metabolism, Antioxidant Status, and Immune Response in Liver of Tilapia (Oreochromis niloticus) under a High-Fat Diet Feeding
Abstract
1. Introduction
2. Materials and Methods
2.1. Tilapia, Experimental Design, and Sampling
2.2. Biochemical Parameter Analysis
2.3. Measurement of Target Gene Expression
2.4. Statistical Analysis
3. Results
3.1. Changes in Hepatic Damage Parameters in Plasma
3.2. Change in Lipid Metabolism in Plasma
3.3. Changes in the Expression of Genes Related to Metabolism Function
3.4. Changes in Antioxidation Status in Liver
3.5. Changes in the Expression of Genes Related to Antioxidant Status
3.6. Changes in the Expression of Genes Related to Inflammatory Response
3.7. Changes in the Expression of Genes Related to Immune Function
4. Discussion
4.1. Effects of Berberine on the Metabolism Function
4.2. Effect of Berberine on Antioxidant Status
4.3. Effect of Berberine on Inflammatory and Immune Response
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- de Lima-Faria, J.M.; da Silva, V.C.; Chen, L.C.; Martinez, D.S.T.; de Sabóia-Morais, S.M.T. Co-exposure of iron oxide nanoparticles with glyphosate herbicides in Poecilia reticulata: Fish liver damages is reversible during iron accumulation and elimination period. Chemosphere 2023, 328, 138590. [Google Scholar] [CrossRef] [PubMed]
- Wolf, J.C.; Wolfe, M.J. A brief overview of nonneoplastic hepatic toxicity in fish. Toxicol. Pathol. 2005, 33, 75–85. [Google Scholar] [CrossRef] [PubMed]
- Wang, T.; Wei, X.; Chen, T.; Wang, W.; Xia, X.; Miao, J.; Yin, S. Studies of the mechanism of fatty liver formation in Takifugu fasciatus following copper exposure. Ecotoxicol. Environ. Saf. 2019, 181, 353–361. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Li, Y.; Hou, C.; Gao, Y.; Wang, Y. Physiological and molecular changes in large yellow croaker (P seudosciaena crocea R.) with high-fat diet-induced fatty liver disease. Aquac. Res. 2015, 46, 272–282. [Google Scholar] [CrossRef]
- Schlegel, A. Studying non-alcoholic fatty liver disease with zebrafish: A confluence of optics, genetics, and physiology. Cell. Mol. Life Sci. 2012, 69, 3953–3961. [Google Scholar] [CrossRef] [PubMed]
- Asaoka, Y.; Terai, S.; Sakaida, I.; Nishina, H. The expanding role of fish models in understandingnon-alcoholic fatty liver disease. Dis. Models Mech. 2013, 6, 905–914. [Google Scholar]
- Tao, Y.-F.; Qiang, J.; Bao, J.-W.; Chen, D.-J.; Yin, G.-J.; Xu, P.; Zhu, H.-J. Changes in Physiological Parameters, Lipid Metabolism, and Expression of MicroRNAs in Genetically Improved Farmed Tilapia (Oreochromis niloticus) With Fatty Liver Induced by a High-Fat Diet. Front. Physiol. 2018, 9, 1521. [Google Scholar] [CrossRef]
- Qiang, J.; He, J.; Yang, H.; Sun, Y.-L.; Tao, Y.-F.; Xu, P.; Zhu, Z.-X. Dietary lipid requirements of larval genetically improved farmed tilapia, Oreochromis niloticus (L.), and effects on growth performance, expression of digestive enzyme genes, and immune response. Aquac. Res. 2017, 48, 2827–2840. [Google Scholar] [CrossRef]
- Dai, Y.-J.; Cao, X.-F.; Zhang, D.-D.; Li, X.-F.; Liu, W.-B.; Jiang, G.-Z. Chronic inflammation is a key to inducing liver injury in blunt snout bream (Megalobrama amblycephala) fed with high-fat diet. Dev. Comp. Immunol. 2019, 97, 28–37. [Google Scholar] [CrossRef] [PubMed]
- Cao, X.-F.; Dai, Y.-J.; Liu, M.-Y.; Yuan, X.-Y.; Wang, C.-C.; Huang, Y.-Y.; Liu, W.-B.; Jiang, G.-Z. High-fat diet induces aberrant hepatic lipid secretion in blunt snout bream by activating endoplasmic reticulum stress-associated IRE1/XBP1 pathway. Biochim. Biophys. Acta BBA Mol. Cell Biol. Lipids 2019, 1864, 213–223. [Google Scholar] [CrossRef] [PubMed]
- Du, Z. Causes of fatty liver in farmed fish: A review and new perspectives. J. Fish. China 2014, 38, 1628–1638. [Google Scholar]
- Zhang, F.-L.; Hao, Q.; Zhang, Q.-S.; Lv, H.-Y.; Yang, Y.-L.; Chao, R.; Zhang, Z.; Zhou, Z.-G. Influences of dietary Eucommia ulmoides leaf extract on the hepatic lipid metabolism, inflammation response, intestinal antioxidant capacity, intestinal microbiota, and disease resistance of the channel catfish (Ictalurus punctatus). Fish Shellfish Immunol. 2022, 123, 75–84. [Google Scholar] [CrossRef] [PubMed]
- Zheng, Y.; Shi, Y.; Yang, X.; Gao, J.; Nie, Z.; Xu, G. Effects of resveratrol on lipid metabolism in liver of red tilapia Oreochromis niloticus. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2022, 261, 109408. [Google Scholar] [CrossRef]
- Zou, C.Y.; Du, L.K.; Wu, J.H.; Gan, S.Y.; Li, Q.Q.; Babu, V.S.; Wu, Y.X.; Lin, L. Saikosaponin d alleviates high-fat-diet induced hepatic steatosis in hybrid grouper (Epinephelus lanceolatusd♂ × Epinephelus fuscoguttatus♀) by targeting AMPK/PPARα pathway. Aquaculture 2022, 553, 738088. [Google Scholar] [CrossRef]
- Jin, M.; Shen, Y.D.; Pan, T.T.; Zhu, T.T.; Li, X.J.; Xu, F.M.; Betancor, M.B.; Jiao, L.F.; Tocher, D.R.; Zhou, Q.C. Dietary Betaine Mitigates Hepatic Steatosis and Inflammation Induced by a High-Fat-Diet by Modulating the Sirt1/Srebp-1/Pparalpha Pathway in Juvenile Black Seabream (Acanthopagrus schlegelii). Front. Immunol. 2021, 12, 694720. [Google Scholar] [CrossRef] [PubMed]
- Zhou, M.; Deng, Y.; Liu, M.; Liao, L.; Dai, X.; Guo, C.; Zhao, X.; He, L.; Peng, C.; Li, Y. The pharmacological activity of berberine, a review for liver protection. Eur. J. Pharmacol. 2021, 890, 173655. [Google Scholar] [CrossRef] [PubMed]
- Kavyani, Z.; Shahhosseini, E.; Moridpour, A.H.; Falahatzadeh, M.; Vajdi, M.; Musazadeh, V.; Askari, G. The effect of berberine supplementation on lipid profile and obesity indices: An umbrella review of meta-analysis. PharmaNutrition 2023, 26, 100364. [Google Scholar] [CrossRef]
- Gaba, S.; Saini, A.; Singh, G.; Monga, V. An insight into the medicinal attributes of berberine derivatives: A review. Bioorg. Med. Chem. 2021, 38, 116143. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Sagada, G.; Wang, C.; Gao, C.; Wang, B.; Shao, Q.; Yan, Y. Berberine in fish nutrition: Impact on hepatoenteric health, antioxidative and immune status. Front. Mar. Sci. 2022, 9, 967748. [Google Scholar] [CrossRef]
- Xu, W.-N.; Chen, D.-H.; Chen, Q.-Q.; Liu, W.-B. Growth performance, innate immune responses and disease resistance of fingerling blunt snout bream, Megalobrama amblycephala adapted to different berberine-dietary feeding modes. Fish Shellfish Immunol. 2017, 68, 458–465. [Google Scholar] [CrossRef]
- Yu, C.B.; Zhang, J.; Qin, Q.; Liu, J.; Xu, J.X.; Xu, W.N. Berberine improved intestinal barrier function by modulating the intestinal microbiota in blunt snout bream (Megalobrama amblycephala) under dietary high-fat and high-carbohydrate stress. Fish Shellfish Immunol. 2020, 102, 336–349. [Google Scholar] [CrossRef]
- Ming, J.H.; Wang, T.; Wang, T.H.; Ye, J.Y.; Zhang, Y.X.; Yang, X.; Shao, X.P.; Ding, Z.Y. Effects of dietary berberine on growth performance, lipid metabolism, antioxidant capacity and lipometabolism-related genes expression of AMPK signaling pathway in juvenile black carp (Mylopharyngodon piceus) fed high-fat diets. Fish Physiol. Biochem. 2023, 49, 769–786. [Google Scholar] [CrossRef] [PubMed]
- Lu, K.-L.; Wang, L.-N.; Zhang, D.-D.; Liu, W.-B.; Xu, W.-N. Berberine attenuates oxidative stress and hepatocytes apoptosis via protecting mitochondria in blunt snout bream Megalobrama amblycephala fed high-fat diets. Fish Physiol. Biochem. 2017, 43, 65–76. [Google Scholar] [CrossRef]
- Wang, C.; Wang, L.; Yang, L.; Gao, C.; Wang, B.; Shu, Y.; Wang, H.; Yan, Y. Protective effects of berberine in chronic copper-induced liver and gill injury in freshwater grouper (Acrossocheilus fasciatus). Ecotoxicol. Environ. Saf. 2023, 267, 115672. [Google Scholar] [CrossRef] [PubMed]
- Xu, F.; Xu, C.; Xiao, S.; Lu, M.; Limbu, S.M.; Wang, X.; Du, Z.; Qin, J.G.; Chen, L. Effects of α-lipoic acid on growth performance, body composition, antioxidant profile and lipid metabolism of the GIFT tilapia (Oreochromis niloticus) fed high-fat diets. Aquac. Nutr. 2019, 25, 585–596. [Google Scholar] [CrossRef]
- Lin, J.-J.; Liu, Y.-C.; Chang, C.-J.; Pan, M.-H.; Lee, M.-F.; Pan, B.S. Hepatoprotective mechanism of freshwater clam extract alleviates non-alcoholic fatty liver disease: Elucidated in vitro and in vivo models. Food Funct. 2018, 9, 6315–6325. [Google Scholar] [CrossRef] [PubMed]
- Qiang, J.; Tao, Y.F.; Bao, J.W.; Chen, D.J.; Li, H.X.; He, J.; Xu, P. High Fat Diet-Induced miR-122 Regulates Lipid Metabolism and Fat Deposition in Genetically Improved Farmed Tilapia (GIFT, Oreochromis niloticus) Liver. Front. Physiol. 2018, 9, 1422. [Google Scholar] [CrossRef] [PubMed]
- Yu, K.; Huang, K.; Tang, Z.; Huang, X.; Sun, L.; Pang, L.; Mo, C. Metabolism and antioxidation regulation of total flavanones from Sedum sarmentosum Bunge against high-fat diet-induced fatty liver disease in Nile tilapia (Oreochromis niloticus). Fish Physiol. Biochem. 2021, 47, 1149–1164. [Google Scholar] [CrossRef] [PubMed]
- Du, J.; Jia, R.; Cao, L.; Gu, Z.; He, Q.; Xu, P.; Yin, G.; Ma, Y. Regulatory effects of Glycyrrhiza total flavones on fatty liver injury induced by a high-fat diet in tilapia (Oreochromis niloticus) via the Nrf2 and TLR signaling pathways. Aquac. Int. 2022, 30, 1527–1548. [Google Scholar] [CrossRef]
- Sheng, C.H.; Jing, J.L.; Lee, M.F.; Liu, Y.C.; Pan, B.S. Freshwater clam extracts alleviate dyslipidaemia of tilapia fed a high-fat diet as an animal model. J. Funct. Foods 2016, 25, 559–567. [Google Scholar]
- He, A.Y.; Ning, L.J.; Chen, L.Q.; Chen, Y.L.; Xing, Q.; Li, J.M.; Qiao, F.; Li, D.L.; Zhang, M.L.; Du, Z.Y. Systemic adaptation of lipid metabolism in response to low- and high-fat diet in Nile tilapia (Oreochromis niloticus). Physiol. Rep. 2015, 3, e12485. [Google Scholar] [CrossRef]
- Zhou, W.H.; Rahimnejad, S.; Lu, K.L.; Wang, L.N.; Liu, W.B. Effects of berberine on growth, liver histology, and expression of lipid-related genes in blunt snout bream (Megalobrama amblycephala) fed high-fat diets. Fish Physiol. Biochem. 2019, 45, 83–91. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Sagada, G.; Xu, B.; Zhang, J.; Shao, Q. Influence of dietary berberine on liver immune response and intestinal health of black sea bream (Acanthopagrus schlegelii) fed with normal and high-lipid diets. Aquac. Nutr. 2022, 2022, 6285266. [Google Scholar] [CrossRef]
- Livak, K.; Schmittgen, T. Analysis of relative gene expression data using real-time quantitative PCR and the 2−∆∆CT Method. Methods-Companion Methods Enzymol. 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Limbu, S.M.; Zhou, L.; Sun, S.X.; Zhang, M.L.; Du, Z.Y. Chronic exposure to low environmental concentrations and legal aquaculture doses of antibiotics cause systemic adverse effects in Nile tilapia and provoke differential human health risk. Environ. Int. 2018, 115, 205–219. [Google Scholar] [CrossRef] [PubMed]
- Ken, C.F.; Chen, C.N.; Ting, C.H.; Pan, C.Y.; Chen, J.Y. Transcriptome analysis of hybrid tilapia (Oreochromis spp.) with Streptococcus agalactiae infection identifies Toll-like receptor pathway-mediated induction of NADPH oxidase complex and piscidins as primary immune-related responses. Fish Shellfish Immunol. 2017, 70, 106–120. [Google Scholar] [CrossRef] [PubMed]
- Chang, G.Y.; Xian, L.W.; Tian, J.; Wei, L.; Fan, W.; Ming, J.; Hua, W. Evaluation of reference genes for quantitative real-time RT-PCR analysis of gene expression in Nile tilapia (Oreochromis niloticus). Gene 2013, 527, 183–192. [Google Scholar]
- Feng, Y.; Siu, K.-Y.; Ye, X.; Wang, N.; Yuen, M.-F.; Leung, C.-H.; Tong, Y.; Kobayashi, S. Hepatoprotective effects of berberine on carbon tetrachloride-induced acute hepatotoxicity in rats. Chin. Med. 2010, 5, 33. [Google Scholar] [CrossRef]
- Zhu, Y.; Li, J.; Zhang, P.; Peng, B.; Li, C.; Ming, Y.; Liu, H. Berberine protects hepatocyte from hypoxia/reoxygenation-induced injury through inhibiting circDNTTIP2. PeerJ 2023, 11, e16080. [Google Scholar] [CrossRef] [PubMed]
- Gong, X.; Li, T.; Wan, R.; Sha, L. Cordycepin attenuates high-fat diet-induced non-alcoholic fatty liver disease via down-regulation of lipid metabolism and inflammatory responses. Int. Immunopharmacol. 2021, 91, 107173. [Google Scholar] [CrossRef] [PubMed]
- Yang, B.; Shen, Y.; Monroig, Ó.; Zhao, W.; Bao, Y.; Tao, S.; Jiao, L.; Zhou, Q.; Jin, M. The ameliorative role of methionine in hepatic steatosis and stress response in juvenile black seabream (Acanthopagrus schlegelii) fed with a high-fat diet. Aquaculture 2024, 580, 740306. [Google Scholar] [CrossRef]
- Barter, P. HDL-C: Role as a risk modifier. Atheroscler. Suppl. 2011, 12, 267–270. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Gao, C.; Yang, L.; Wang, C.; Wang, B.; Wang, H.; Shu, Y.; Yan, Y. The growth-promoting and lipid-lowering effects of berberine are associated with the regulation of intestinal bacteria and bile acid profiles in yellow catfish (Pelteobagrus fulvidraco). Aquac. Rep. 2023, 33, 101848. [Google Scholar] [CrossRef]
- Tian, J.-J.; Jin, Y.-Q.; Yu, E.-M.; Sun, J.-H.; Xia, Y.; Zhang, K.; Li, Z.-F.; Gong, W.-B.; Wang, G.-J.; Xie, J. Intestinal farnesoid X receptor mediates the effect of dietary berberine on lipid accumulation in grass carp (Ctenopharyngodon idella). Aquaculture 2022, 553, 738055. [Google Scholar] [CrossRef]
- Wang, Y.P.; Nakajima, T.; Gonzalez, F.J.; Tanaka, N. PPARs as Metabolic Regulators in the Liver: Lessons from Liver-Specific PPAR-Null Mice. Int. J. Mol. Sci. 2020, 21, 2061. [Google Scholar] [CrossRef]
- Yang, Z.; Roth, K.; Agarwal, M.; Liu, W.; Petriello, M.C. The transcription factors CREBH, PPARa, and FOXO1 as critical hepatic mediators of diet-induced metabolic dysregulation. J. Nutr. Biochem. 2021, 95, 108633. [Google Scholar] [CrossRef] [PubMed]
- Jia, R.; Cao, L.-P.; Du, J.-L.; He, Q.; Gu, Z.-Y.; Jeney, G.; Xu, P.; Yin, G.-J. Effects of high-fat diet on steatosis, endoplasmic reticulum stress and autophagy in liver of tilapia (Oreochromis niloticus). Front. Mar. Sci. 2020, 7, 363. [Google Scholar] [CrossRef]
- Lu, K.-L.; Zhang, D.-D.; Wang, L.-N.; Xu, W.-N.; Liu, W.-B. Molecular characterization of carnitine palmitoyltransferase IA in Megalobrama amblycephala and effects on its expression of feeding status and dietary lipid and berberine. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2016, 191, 20–25. [Google Scholar] [CrossRef] [PubMed]
- Frieg, B.; Görg, B.; Gohlke, H.; Häussinger, D. Glutamine synthetase as a central element in hepatic glutamine and ammonia metabolism: Novel aspects. Biol. Chem. 2021, 402, 1063–1072. [Google Scholar] [CrossRef] [PubMed]
- Savilov, P.N.; Yakovlev, V.N. Effect of Liver Damage and Hyperbaric Oxygenation on Glutamine Synthetase of Hepatocytes. Bull. Exp. Biol. Med. 2016, 160, 295–297. [Google Scholar] [CrossRef] [PubMed]
- Fan, Z.; Wang, S.; Meng, Y.; Wen, C.; Xu, M.; Li, X. Butyrate Alleviates High-Fat-Induced Metabolic Disorders Partially through Increasing Systematic Glutamine. J. Agric. Food Chem. 2023, 72, 449–460. [Google Scholar] [CrossRef] [PubMed]
- Xu, L.; Zheng, R.; Xie, P.; Guo, Q.; Ji, H.; Li, T. Dysregulation of UDP-glucuronosyltransferases in CCl4 induced liver injury rats. Chem. Biol. Interact. 2020, 325, 109115. [Google Scholar] [CrossRef] [PubMed]
- Hardwick, R.N.; Ferreira, D.W.; More, V.R.; Lake, A.D.; Lu, Z.; Manautou, J.E.; Slitt, A.L.; Cherrington, N.J. Altered UDP-glucuronosyltransferase and sulfotransferase expression and function during progressive stages of human nonalcoholic fatty liver disease. Drug Metab. Dispos. 2013, 41, 554–561. [Google Scholar] [CrossRef] [PubMed]
- Pandit, K.; Kumar, A.; Kaur, S.; Kumar, V.; Jain, S.K.; Bhardwaj, R.; Kaur, S. Amelioration of oxidative stress by trans-Anethole via modulating phase I and phase II enzymes against hepatic damage induced by CCl4 in male Wistar rats. Environ. Sci. Pollut. Res. Int. 2022, 29, 6317–6333. [Google Scholar] [CrossRef] [PubMed]
- Victor Antony Santiago, J.; Jayachitra, J.; Shenbagam, M.; Nalini, N. Dietary d-limonene alleviates insulin resistance and oxidative stress-induced liver injury in high-fat diet and L-NAME-treated rats. Eur. J. Nutr. 2012, 51, 57–68. [Google Scholar] [CrossRef] [PubMed]
- Ma, X.; Chen, Z.; Wang, L.; Wang, G.; Wang, Z.; Dong, X.; Wen, B.; Zhang, Z. The pathogenesis of diabetes mellitus by oxidative stress and inflammation: Its inhibition by berberine. Front. Pharmacol. 2018, 9, 782. [Google Scholar] [CrossRef] [PubMed]
- Chen, S.; Jiang, X.; Liu, N.; Ren, M.; Wang, Z.; Li, M.; Chen, N.; Li, S. Effects of dietary berberine hydrochloride inclusion on growth, antioxidant capacity, glucose metabolism and intestinal microbiome of largemouth bass (Micropterus salmoides). Aquaculture 2022, 552, 738023. [Google Scholar] [CrossRef]
- Grădinariu, L.; Dediu, L.; Crețu, M.; Grecu, I.R.; Docan, A.; Istrati, D.I.; Dima, F.M.; Stroe, M.D.; Vizireanu, C. The Antioxidant and Hepatoprotective Potential of Berberine and Silymarin on Acetaminophen Induced Toxicity in Cyprinus carpio L. Animals 2024, 14, 373. [Google Scholar] [CrossRef] [PubMed]
- Desouky, H.E.; Jiang, G.-z.; Abasubong, K.P.; Dai, Y.-J.; Yuan, X.; Adjoumani, J.-J.Y.; Liu, W.-b. Plant-Based Additivities Improved the Growth Performance and Immune Response, and Mitigated the Inflammatory Signalling in Channel Catfish Fed a High-Fat Diet. Aquac. Res. 2023, 2023, 3525041. [Google Scholar] [CrossRef]
- Deng, Y.; Tang, K.; Chen, R.; Nie, H.; Liang, S.; Zhang, J.; Zhang, Y.; Yang, Q. Berberine attenuates hepatic oxidative stress in rats with non-alcoholic fatty liver disease via the Nrf2/ARE signalling pathway. Exp. Ther. Med. 2019, 17, 2091–2098. [Google Scholar] [CrossRef] [PubMed]
- Huang, Y.; Li, W.; Su, Z.-y.; Kong, A.-N.T. The complexity of the Nrf2 pathway: Beyond the antioxidant response. J. Nutr. Biochem. 2015, 26, 1401–1413. [Google Scholar] [CrossRef] [PubMed]
- Ashrafizadeh, M.; Fekri, H.S.; Ahmadi, Z.; Farkhondeh, T.; Samarghandian, S. Therapeutic and biological activities of berberine: The involvement of Nrf2 signaling pathway. J. Cell. Biochem. 2020, 121, 1575–1585. [Google Scholar] [CrossRef] [PubMed]
- Mahmoud, A.M.; Hozayen, W.G.; Ramadan, S.M. Berberine ameliorates methotrexate-induced liver injury by activating Nrf2/HO-1 pathway and PPARγ, and suppressing oxidative stress and apoptosis in rats. Biomed. Pharmacother. 2017, 94, 280–291. [Google Scholar] [CrossRef] [PubMed]
- Han, C.Y.; Sun, T.T.; Xv, G.P.; Wang, S.S.; Gu, J.G.; Liu, C.Y. Berberine ameliorates CCl4-induced liver injury in rats through regulation of the Nrf2-Keap1-ARE and p53 signaling pathways. Mol. Med. Rep. 2019, 20, 3095–3102. [Google Scholar] [CrossRef] [PubMed]
- Sagada, G.; Wang, L.; Xu, B.; Tegomo, F.A.; Chen, K.; Zheng, L.; Sun, Y.; Liu, Y.; Yang, Y.; Ullah, S.; et al. Synergistic Effect of Dietary Inactivated Lactobacillus plantarum and Berberine Supplementation on Growth Performance, Antioxidant Capacity, and Immune Function of Juvenile Black Sea Bream (Acanthopagrus schlegelii). Aquac. Nutr. 2022, 2022, 3053724. [Google Scholar] [CrossRef]
- Khanmohammadi, S.; Kuchay, M.S. Toll-like receptors and metabolic (dysfunction)-associated fatty liver disease. Pharmacol. Res. 2022, 185, 106507. [Google Scholar] [CrossRef] [PubMed]
- Ma, J.Q.; Li, Z.; Xie, W.R.; Liu, C.M.; Liu, S.S. Quercetin protects mouse liver against CCl₄-induced inflammation by the TLR2/4 and MAPK/NF-κB pathway. Int. Immunopharmacol. 2015, 28, 531–539. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Zhuang, Z.J.; Bian, D.X.; Ma, X.J.; Xun, Y.H.; Yang, W.J.; Luo, Y.; Liu, Y.L.; Jia, L.; Wang, Y.; et al. Toll-like receptor-4 signalling in the progression of non-alcoholic fatty liver disease induced by high-fat and high-fructose diet in mice. Clin. Exp. Pharmacol. Physiol. 2014, 41, 482–488. [Google Scholar] [CrossRef] [PubMed]
- Miura, K.; Yang, L.; van Rooijen, N.; Brenner, D.A.; Ohnishi, H.; Seki, E. Toll-like receptor 2 and palmitic acid cooperatively contribute to the development of nonalcoholic steatohepatitis through inflammasome activation in mice. Hepatology 2013, 57, 577–589. [Google Scholar] [CrossRef] [PubMed]
- Jang, H.-J.; Kim, H.-S.; Hwang, D.H.; Quon, M.J.; Kim, J.-A. Toll-like receptor 2 mediates high-fat diet-induced impairment of vasodilator actions of insulin. Am. J. Physiol. Endocrinol. Metab. 2013, 304, E1077–E1088. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.-P.; Lei, F.; Du, F.; Chai, Y.-S.; Jiang, J.-F.; Wang, Y.-G.; Yu, X.; Yan, X.-J.; Xing, D.-M.; Du, L.-J. Protection of gastrointestinal mucosa from acute heavy alcohol consumption: The effect of berberine and its correlation with TLR2, 4/IL1β-TNFα signaling. PLoS ONE 2015, 10, e0134044. [Google Scholar] [CrossRef] [PubMed]
- Shan, J.-L.; Wei, R.-R.; Lu, W.; Ouyang, X.; Cheng, H.-Y.; Zhong, G.-Y.; Liu, J.-C.; Zhu, J.-X. Mechanism of anti-chronic alcoholic liver injury in rats of tibetan medicine Lagotis brachystachys extracts by TLR2/MyD88/NF-κB and NALP3 signaling pathway. Chin. J. Exp. Tradit. Med. Formulae 2020, 026, 80–85. [Google Scholar]
- Ghezelbash, B.; Shahrokhi, N.; Khaksari, M.; Asadikaram, G.; Shahrokhi, M.; Shirazpour, S. Protective Roles of Shilajit in Modulating Resistin, Adiponectin, and Cytokines in Rats with Non-alcoholic Fatty Liver Disease. Chin. J. Integr. Med. 2022, 28, 531–537. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Jia, Z.; Wang, B.; Zhang, B. Berberine inhibits liver damage in rats with non-alcoholic fatty liver disease by regulating TLR4/MyD88/NF-κB pathway. Turk. J. Gastroenterol. 2020, 31, 902–909. [Google Scholar] [CrossRef]
- Shailesh, S.; Sahoo, P.K. Lysozyme: An important defence molecule of fish innate immune system. Aquac. Res. 2008, 39, 223–239. [Google Scholar]
- Bao, B.; Peatman, E.; Li, P.; He, C.; Liu, Z. Catfish hepcidin gene is expressed in a wide range of tissues and exhibits tissue-specific upregulation after bacterial infection. Dev. Comp. Immunol. 2005, 29, 939–950. [Google Scholar] [CrossRef]
- Abasubong, K.P.; Li, X.F.; Adjoumani, J.J.Y.; Jiang, G.Z.; Desouky, H.E.; Liu, W.B. Effects of dietary xylooligosaccharide prebiotic supplementation on growth, antioxidant and intestinal immune-related genes expression in common carp Cyprinus carpio fed a high-fat diet. J. Anim. Physiol. Anim. Nutr. 2022, 106, 403–418. [Google Scholar] [CrossRef] [PubMed]
- Abasubong, K.P.; Jiang, G.-Z.; Guo, H.-X.; Wang, X.; Huang, Y.-Y.; Dai, Y.-J.; Li, X.-F.; Dong, Y.-Z.; Gabriel, N.N.; Liu, W.-B. Oral bovine serum albumin administration alleviates inflammatory signals and improves antioxidant capacity and immune response under thioacetamide stress in blunt snout bream fed a high-calorie diet. Fish Shellfish Immunol. 2023, 141, 108996. [Google Scholar] [CrossRef] [PubMed]
- Padda, R.S.; Gkouvatsos, K.; Guido, M.; Mui, J.; Vali, H.; Pantopoulos, K. A high-fat diet modulates iron metabolism but does not promote liver fibrosis in hemochromatotic Hjv-/- mice. Am. J. Physiol.-Gastrointest. Liver Physiol. 2015, 308, G251–G261. [Google Scholar] [CrossRef]
- Li, Y.; Jiang, W.; Feng, Y.; Wu, L.; Jia, Y.; Zhao, R. Betaine Alleviates High-Fat Diet-Induced Disruption of Hepatic Lipid and Iron Homeostasis in Mice. Int. J. Mol. Sci. 2022, 23, 6263. [Google Scholar] [CrossRef]
- Qian, Y.-C.; Wang, X.; Ren, J.; Wang, J.; Limbu, S.M.; Li, R.-X.; Zhou, W.-H.; Qiao, F.; Zhang, M.-L.; Du, Z.-Y. Different effects of two dietary levels of tea polyphenols on the lipid deposition, immunity and antioxidant capacity of juvenile GIFT tilapia (Oreochromis niloticus) fed a high-fat diet. Aquaculture 2021, 542, 736896. [Google Scholar] [CrossRef]
- Doan, H.V.; Hoseinifar, S.H.; Jaturasitha, S.; Dawood, M.A.O.; Harikrishnan, R. The effects of berberine powder supplementation on growth performance, skin mucus immune response, serum immunity, and disease resistance of Nile tilapia (Oreochromis niloticus) fingerlings. Aquaculture 2020, 520, 734927. [Google Scholar] [CrossRef]
Gene | Primer Sequence (5′-3′) | GenBank Number/References |
---|---|---|
Nuclear factor erythroid 2-related factor 2 (nrf2) | F: CTGCCGTAAACGCAAGATGG | XM_003447296.5 |
R: ATCCGTTGACTGCTGAAGGG | ||
NAD(P)H dehydrogenase 1 (nqo1) | F: TGGATTTCAGGTTCTGGCTCC | XM_013273094.3 |
R: TCCTGTGGAGATGCCGAGA | ||
Glutathione S-transferase (gsta) | F: TAATGGGAGAGGGAAGATGG | NM_001279635.1 |
R: CTCTGCGATGTAATTCAGGA | ||
Heme oxygenase (ho-1) | F: CTTGCCCGTGTGGAATCACT | XM_013270165.3 |
R: AGATCACCGAGGTAGCGAGT | ||
Peroxisome proliferator activated receptor alpha (pparα) | F: CTGATAAAGCTTCGGGCTTCCA | NM_001290066.1 |
R: CGCTCACACTTATCATACTCCAGCT | ||
Carnitine O-palmitoyltransferase 1 (cpt-1) | F: TTTCCAGGCCTCCTTACCCA | XM_013268638.3 |
R: TGTACTGCTCATTGTCCAGCAGA | ||
Acyl-CoA oxidase 1 (acox-1) | F: GGTCAAAGGCAACAATCAGGAG | NM_001290199.1 |
R: GACTCTGCCAAAGGCAACCA | ||
Toll-like receptor 2 (tlr2) | F: AAAAGCATAGATGAGTTCCACATCC | JQ809459.1 |
R: GTAAGACAAGGCATCACAAACACC | ||
Myloid differentiation factor 88 (myd88) | F: CAGGTTCCTGAGGTCGACAG | KJ130039.1 |
R: CATTTCGTGGACGAACGCAA | ||
NF-kB subunit (relb) | F: TCACTGCCTCCACCTTTGCT | XM_005459330.4 |
R: ATCCTCATAGTTCCTCTTCCGTTTT | ||
Tumor necrosis factor-alpha (tnf-α) | F: AAGCCAAGGCAGCCATCCAT | [35] |
R: TTGACCATTCCTCCACTCCAGA | ||
Interleukin-1 beta (il-1β) | F: TCAGTTCACCAGCAGGGATG | [36] |
R: GACAGATAGAGGTTTGTGCC | ||
Interleukin-8 (il-8) | F: CTGTGAAGGCATGGGTGTGGAG | [35] |
R: TCGCAGTGGGAGTTGGGAAGAA | ||
Glutamine synthase a (gs) | F: AGCTACCACATTCGTGCCTAC | NM_001279668.1 |
R: TACGAGGAATGCGAATGCTGG | ||
UDP-glucuronosyltransferase 2A2 (ugt2a2) | F: GGTGCTGTGTCAGGAAAGGAA | XM_025896953.1 |
R: ATCAAACTAGCCACCTTTGGCA | ||
NADH-cytochrome b5 reductase 2 (cbr2) | F: ATCGCTGGTGGAACAGGTATC | XM_003439423.3 |
R:TGTGGAGGTTTGTCCAGTGT | ||
Lysozyme C (lzm) | F: AAGGGAAGCAGCAGCAGTTGTG | XM_019361339.1 |
R: CGTCCATGCCGTTAGCCTTGAG | ||
Immunoglobulin (igm) | F: ACCGAATCGAAAAATGCGGC | KJ676389.1 |
R: AACACAACCAGGACATTGGTTC | ||
Complement C3 (c3) | F: GGTGTGGATGCACCTGAGAA | XM_013274267.3 |
R: GGGAAATCGGTACTTGGCCT | ||
Hepcidin (hep) | F: GACACAAGCGTGGCATCAAG | XM_019365122.2 |
R: GTTGAGGCAGTAACTGAGGACA | ||
Ubiquitin-conjugating enzyme (ubce) | F: CTCTCAAATCAATGCCACTTCC | [37] |
R: CCCTGGTGGAGGTTCCTTGT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jia, R.; Hou, Y.; Zhang, L.; Li, B.; Zhu, J. Effects of Berberine on Lipid Metabolism, Antioxidant Status, and Immune Response in Liver of Tilapia (Oreochromis niloticus) under a High-Fat Diet Feeding. Antioxidants 2024, 13, 548. https://doi.org/10.3390/antiox13050548
Jia R, Hou Y, Zhang L, Li B, Zhu J. Effects of Berberine on Lipid Metabolism, Antioxidant Status, and Immune Response in Liver of Tilapia (Oreochromis niloticus) under a High-Fat Diet Feeding. Antioxidants. 2024; 13(5):548. https://doi.org/10.3390/antiox13050548
Chicago/Turabian StyleJia, Rui, Yiran Hou, Liqiang Zhang, Bing Li, and Jian Zhu. 2024. "Effects of Berberine on Lipid Metabolism, Antioxidant Status, and Immune Response in Liver of Tilapia (Oreochromis niloticus) under a High-Fat Diet Feeding" Antioxidants 13, no. 5: 548. https://doi.org/10.3390/antiox13050548
APA StyleJia, R., Hou, Y., Zhang, L., Li, B., & Zhu, J. (2024). Effects of Berberine on Lipid Metabolism, Antioxidant Status, and Immune Response in Liver of Tilapia (Oreochromis niloticus) under a High-Fat Diet Feeding. Antioxidants, 13(5), 548. https://doi.org/10.3390/antiox13050548