Protective Role of Taurine on Rat Offspring Hypertension in the Setting of Maternal Chronic Kidney Disease
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animal Model
2.2. Analysis of H2S-Generating Enzymes and RAAS Components using qPCR
2.3. Tissue H2S-Producing Capacity
2.4. Analysis of NO Parameters Using HPLC
2.5. 16S rRNA Sequencing
2.6. Statistics
3. Results
3.1. Body Weight and BP
3.2. H2S System in the Kidneys
3.3. NO Parameters
3.4. RAAS
3.5. Gut Microbiota Composition
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- World Health Organization. Hypertension. 2023. Available online: https://www.who.int/news-room/fact-sheets/detail/hypertension (accessed on 6 October 2023).
- WHO. Guideline for the Pharmacological Treatment of Hypertension in Adults; Licence: CC BY-NC-SA 3.0 IGO; World Health Organization: Geneva, Switzerland, 2021. [Google Scholar]
- Bromfield, S.; Muntner, P. High blood pressure: The leading global burden of disease risk factor and the need for worldwide prevention programs. Curr. Hypertens. Rep. 2013, 15, 134–136. [Google Scholar] [CrossRef] [PubMed]
- Paauw, N.D.; van Rijn, B.B.; Lely, A.T.; Joles, J.A. Pregnancy as a critical window for blood pressure regulation in mother and child: Programming and reprogramming. Acta Physiol. 2017, 219, 241–259. [Google Scholar] [CrossRef] [PubMed]
- Luyckx, V.A.; Bertram, J.F.; Brenner, B.M.; Fall, C.; Hoy, W.E.; Ozanne, S.E.; Vikse, B.E. Effect of fetal and child health on kidney development and long-term risk of hypertension and kidney disease. Lancet 2013, 382, 273–283. [Google Scholar] [CrossRef] [PubMed]
- Hsu, C.N.; Tain, Y.L. Animal Models for DOHaD Research: Focus on Hypertension of Developmental Origins. Biomedicines 2021, 9, 623. [Google Scholar] [CrossRef] [PubMed]
- Kett, M.M.; Denton, K.M. Renal programming: Cause for concern? Am. J. Physiol. Regul. Integr. Comp. Physiol. 2011, 300, R791–R803. [Google Scholar] [CrossRef] [PubMed]
- Wilcox, C.S. Oxidative stress and nitric oxide deficiency in the kidney: A critical link to hypertension? Am. J. Physiol. Regul. Integr. Comp. Physiol. 2005, 289, R913–R935. [Google Scholar] [CrossRef] [PubMed]
- Tain, Y.L.; Hsu, C.N. Oxidative Stress-Induced Hypertension of Developmental Origins: Preventive Aspects of Antioxidant Therapy. Antioxidants 2022, 11, 511. [Google Scholar] [CrossRef]
- Surai, P.F.; Earle-Payne, K.; Kidd, M.T. Taurine as a Natural Antioxidant: From Direct Antioxidant Effects to Protective Action in Various Toxicological Models. Antioxidants 2021, 10, 1876. [Google Scholar] [CrossRef]
- Baliou, S.; Adamaki, M.; Ioannou, P.; Pappa, A.; Panayiotidis, M.I.; Spandidos, D.A.; Christodoulou, I.; Kyriakopoulos, A.M.; Zoumpourlis, V. Protective role of taurine against oxidative stress (Review). Mol. Med. Rep. 2021, 24, 605. [Google Scholar] [CrossRef]
- Militante, J.D.; Lombardini, J.B. Treatment of hypertension with oral taurine: Experimental and clinical studies. Amino Acids 2002, 23, 381–393. [Google Scholar] [CrossRef]
- Guizoni, D.M.; Freitas, I.N.; Victorio, J.A.; Possebom, I.R.; Araujo, T.R.; Carneiro, E.M.; Davel, A.P. Taurine treatment reverses protein malnutrition-induced endothelial dysfunction of the pancreatic vasculature: The role of hydrogen sulfide. Metabolism 2021, 116, 154701. [Google Scholar] [CrossRef] [PubMed]
- Qian, W.; Li, M.; Yu, L.; Tian, F.; Zhao, J.; Zhai, Q. Effects of Taurine on Gut Microbiota Homeostasis: An Evaluation Based on Two Models of Gut Dysbiosis. Biomedicines 2023, 11, 1048. [Google Scholar] [CrossRef] [PubMed]
- Roysommuti, S.; Lerdweeraphon, W.; Malila, P.; Jirakulsomchok, D.; Wyss, J.M. Perinatal taurine alters arterial pressure control and renal function in adult offspring. Adv. Exp. Med. Biol. 2009, 643, 145–156. [Google Scholar] [PubMed]
- Roysommuti, S.; Wyss, J.M. Perinatal taurine exposure affects adult arterial pressure control. Amino Acids 2014, 46, 57–72. [Google Scholar] [CrossRef] [PubMed]
- Suliman, M.E.; Anderstam, B.; Bergström, J. Evidence of taurine depletion and accumulation of cysteinesulfinic acid in chronic dialysis patients. Kidney Int. 1996, 50, 1713–1717. [Google Scholar] [CrossRef] [PubMed]
- Hsu, C.N.; Yang, H.W.; Hou, C.Y.; Chang-Chien, G.P.; Lin, S.; Tain, Y.L. Maternal Adenine-Induced Chronic Kidney Disease Programs Hypertension in Adult Male Rat Offspring: Implications of Nitric Oxide and Gut Microbiome Derived Metabolites. Int. J. Mol. Sci. 2020, 21, 7237. [Google Scholar] [CrossRef] [PubMed]
- Carlström, M. Nitric oxide signalling in kidney regulation and cardiometabolic health. Nat. Rev. Nephrol. 2021, 17, 575–590. [Google Scholar] [CrossRef]
- Yosypiv, I.V. Renin-angiotensin system in mammalian kidney development. Pediatr. Nephrol. 2020, 36, 479–489. [Google Scholar] [CrossRef]
- Colafella, K.M.M.; Denton, K.M. Sex-specific differences in hypertension and associated cardiovascular disease. Nat. Rev. Nephrol. 2018, 14, 185–201. [Google Scholar] [CrossRef]
- Hsu, C.N.; Hou, C.Y.; Chang-Chien, G.P.; Lin, S.; Tain, Y.L. Maternal N-Acetylcysteine Therapy Prevents Hypertension in Spontaneously Hypertensive Rat Offspring: Implications of Hydrogen Sulfide-Generating Pathway and Gut Microbiota. Antioxidants 2020, 9, 856. [Google Scholar] [CrossRef]
- Tain, Y.L.; Hou, C.Y.; Chang-Chien, G.P.; Lin, S.; Hsu, C.N. Protection by Means of Perinatal Oral Sodium Thiosulfate Administration against Offspring Hypertension in a Rat Model of Maternal Chronic Kidney Disease. Antioxidants 2023, 12, 1344. [Google Scholar] [CrossRef] [PubMed]
- Bolyen, E.; Rideout, J.R.; Dillon, M.R.; Bokulich, N.A.; Abnet, C.C.; Al-Ghalith, G.A.; Alexander, H.; Alm, E.J.; Arumugam, M.; Asnicar, F.; et al. Reproducible, interactive, scalable and extensible microbiome data science using QIIME 2. Nat. Biotechnol. 2019, 37, 852–857. [Google Scholar] [CrossRef] [PubMed]
- Hladunewich, M.A. Chronic Kidney Disease and Pregnancy. Semin. Nephrol. 2017, 37, 337–346. [Google Scholar] [CrossRef] [PubMed]
- Nevis, I.F.; Reitsma, A.; Dominic, A.; McDonald, S.; Thabane, L.; Akl, E.A.; Hladunewich, M.; Akbari, A.; Joseph, G.; Sia, W.; et al. Pregnancy outcomes in women with chronic kidney disease: A systematic review. Clin. J. Am. Soc. Nephrol. 2011, 6, 2587–2598. [Google Scholar] [CrossRef] [PubMed]
- Reyes, A.A.; Klahr, S. Dietary supplementation of L-arginine ameliorates renal hypertrophy in rats fed a high-protein diet. Proc. Soc. Exp. Biol. Med. 1994, 206, 157–161. [Google Scholar] [CrossRef] [PubMed]
- Hsu, C.N.; Hou, C.Y.; Chang-Chien, G.P.; Lin, S.; Tain, Y.L. Dietary Supplementation with Cysteine during Pregnancy Rescues Maternal Chronic Kidney Disease-Induced Hypertension in Male Rat Offspring: The Impact of Hydrogen Sulfide and Microbiota-Derived Tryptophan Metabolites. Antioxidants 2022, 11, 483. [Google Scholar] [CrossRef] [PubMed]
- Sun, Q.; Wang, B.; Li, Y.; Sun, F.; Li, P.; Xia, W.; Zhou, X.; Li, Q.; Wang, X.; Chen, J.; et al. Taurine Supplementation Lowers Blood Pressure and Improves Vascular Function in Prehypertension: Randomized, Double-Blind, Placebo-Controlled Study. Hypertension 2016, 67, 541–549. [Google Scholar] [CrossRef]
- DiNicolantonio, J.J.; Okeefe, J.H.; McCarty, M.F. Boosting endogenous production of vasoprotective hydrogen sulfide via supplementation with taurine and N-acetylcysteine: A novel way to promote cardiovascular health. Open Heart 2017, 4, e000600. [Google Scholar] [CrossRef]
- Rao, S.P.; Dobariya, P.; Bellamkonda, H.; More, S.S. Role of 3-Mercaptopyruvate Sulfurtransferase (3-MST) in Physiology and Disease. Antioxidants 2023, 12, 603. [Google Scholar] [CrossRef]
- Sun, L.; Jin, H.; Sun, L.; Chen, S.; Huang, Y.; Liu, J.; Li, Z.; Zhao, M.; Sun, Y.; Tang, C.; et al. Hydrogen sulfide alleviates myocardial collagen remodeling in association with inhibition of TGF-β/Smad signaling pathway in spontaneously hypertensive rats. Mol. Med. 2015, 20, 503–515. [Google Scholar] [CrossRef]
- Qaradakhi, T.; Gadanec, L.K.; McSweeney, K.R.; Abraham, J.R.; Apostolopoulos, V.; Zulli, A. The Anti-Inflammatory Effect of Taurine on Cardiovascular Disease. Nutrients 2020, 12, 2847. [Google Scholar] [CrossRef] [PubMed]
- Scabora, J.E.; de Lima, M.C.; Lopes, A.; de Lima, I.P.; Mesquita, F.F.; Torres, D.B.; Boer, P.A.; Gontijo, J.A. Impact of taurine supplementation on blood pressure in gestational protein-restricted offspring: Effect on the medial solitary tract nucleus cell numbers, angiotensin receptors, and renal sodium handling. J. Renin-Angiotensin-Aldosterone Syst. 2015, 16, 47–58. [Google Scholar] [CrossRef] [PubMed]
- Thaeomor, A.; Teangphuck, P.; Chaisakul, J.; Seanthaweesuk, S.; Somparn, N.; Roysommuti, S. Perinatal Taurine Supplementation Prevents Metabolic and Cardiovascular Effects of Maternal Diabetes in Adult Rat Offspring. Adv. Exp. Med. Biol. 2017, 975, 295–305. [Google Scholar] [PubMed]
- Roysommuti, S.; Suwanich, A.; Lerdweeraphon, W.; Thaeomor, A.; Jirakulsomchok, D.; Wyss, J.M. Sex dependent effects of perinatal taurine exposure on the arterial pressure control in adult offspring. Adv. Exp. Med. Biol. 2009, 643, 135–144. [Google Scholar] [PubMed]
- Paolocci, N.; Biondi, R.; Bettini, M.; Lee, C.I.; Berlowitz, C.O.; Rossi, R.; Xia, Y.; Ambrosio, G.; L’Abbate, A.; Kass, D.A.; et al. Oxygen radical-mediated reduction basal and agonist-evoked NO release in isolated rat heart. J. Mol. Cell Cardiol. 2001, 33, 671–679. [Google Scholar] [CrossRef] [PubMed]
- Duszka, K. Versatile Triad Alliance: Bile Acid, Taurine and Microbiota. Cells 2022, 11, 2337. [Google Scholar] [CrossRef] [PubMed]
- Hidalgo-Cantabrana, C.; Delgado, S.; Ruiz, L.; Ruas-Madiedo, P.; Sánchez, B.; Margolles, A. Bifidobacteria and Their Health-Promoting Effects. Microbiol. Spectr. 2017, 5. [Google Scholar] [CrossRef]
- Markowiak-Kopeć, P.; Śliżewska, K. The Effect of Probiotics on the Production of Short-Chain Fatty Acids by Human Intestinal Microbiome. Nutrients 2020, 12, 1107. [Google Scholar] [CrossRef]
- Poll, B.G.; Xu, J.; Jun, S.; Sanchez, J.; Zaidman, N.A.; He, X.; Lester, L.; Berkowitz, D.E.; Paolocci, N.; Gao, W.D.; et al. Acetate, a Short-Chain Fatty Acid, Acutely Lowers Heart Rate and Cardiac Contractility Along with Blood Pressure. J. Pharmacol. Exp. Ther. 2021, 377, 39–50. [Google Scholar] [CrossRef]
- Tain, Y.L.; Hou, C.Y.; Chang-Chien, G.P.; Lin, S.F.; Hsu, C.N. Perinatal Propionate Supplementation Protects Adult Male Offspring from Maternal Chronic Kidney Disease-Induced Hypertension. Nutrients 2022, 14, 3435. [Google Scholar] [CrossRef]
- Yu, H.; Guo, Z.; Shen, S.; Shan, W. Effects of taurine on gut microbiota and metabolism in mice. Amino Acids 2016, 48, 1601–1617. [Google Scholar] [CrossRef] [PubMed]
- Xie, D.; Zhang, M.; Wang, B.; Lin, H.; Wu, E.; Zhao, H.; Li, S. Differential Analysis of Hypertension-Associated Intestinal Microbiota. Int. J. Med. Sci. 2019, 16, 872–881. [Google Scholar]
- Smiljanec, K.; Lennon, S.L. Sodium, hypertension, and the gut: Does the gut microbiota go salty? Am. J. Physiol. Heart Circ. Physiol. 2019, 317, H1173–H1182. [Google Scholar] [CrossRef] [PubMed]
- Palmu, J.; Lahti, L.; Niiranen, T. Targeting Gut Microbiota to Treat Hypertension: A Systematic Review. Int. J. Environ. Res. Public Health 2021, 18, 1248. [Google Scholar] [CrossRef] [PubMed]
- Mukohda, M.; Yano, T.; Matsui, T.; Nakamura, S.; Miyamae, J.; Toyama, K.; Mitsui, R.; Mizuno, R.; Ozaki, H. Treatment with Ligilactobacillus murinus lowers blood pressure and intestinal permeability in spontaneously hypertensive rats. Sci. Rep. 2023, 13, 15197. [Google Scholar] [CrossRef] [PubMed]
- Just, S.; Mondot, S.; Ecker, J.; Wegner, K.; Rath, E.; Gau, L.; Streidl, T.; Hery-Arnaud, G.; Schmidt, S.; Lesker, T.R.; et al. The gut microbiota drives the impact of bile acids and fat source in diet on mouse metabolism. Microbiome 2018, 6, 134. [Google Scholar] [CrossRef] [PubMed]
- Ishimwe, J.A.; Dola, T.; Ertuglu, L.A.; Kirabo, A. Bile acids and salt-sensitive hypertension: A role of the gut-liver axis. Am. J. Physiol. Heart Circ. Physiol. 2022, 322, H636–H646. [Google Scholar] [CrossRef]
Gene | Gene Accession No | Forward | Reverse |
---|---|---|---|
Renin | J02941.1 | 5 aacattaccagggcaactttcact 3 | 5 acccccttcatggtgatctg 3 |
PRR | AB188298.1 | 5 gaggcagtgaccctcaacat 3 | 5 ccctcctcacacaacaaggt 3 |
AGT | XM_032887807.1 | 5 gcccaggtcgcgatgat 3 | 5 tgtacaagatgctgagtgaggcaa 3 |
ACE | U03734.1 | 5 caccggcaaggtctgctt 3 | 5 cttggcatagtttcgtgaggaa 3 |
AT1R | NM_030985.4 | 5 gctgggcaacgagtttgtct 3 | 5 cagtccttcagctggatcttca 3 |
CSE | NM_017074.2 | 5 cgcacaaattgtccacaaac 3 | 5 gctctgtccttctcaggcac 3 |
CBS | NM_012522.2 | 5 atgctgcagaaaggcttcat 3 | 5 gtggaaaccagtcggtgtct 3 |
DAO | NM_053626.1 | 5 ccctttctggaaaagcacag 3 | 5 ctcctctcaccacctcttcg 3 |
3MST | NM_138843.2 | 5 ggctcagtaaacatcccattc 3 | 5 tgtccttcacagggtcttcc 3 |
R18S | X01117 | 5 gccgcggtaattccagctcca 3 | 5 cccgcccgctcccaagatc 3 |
Groups | C | CKD | T | CKDT |
---|---|---|---|---|
Body weight, g | 280 ± 5 | 281 ± 9 | 308 ± 9 | 269 ± 9 *,# |
Left kidney weight, g | 1.27 ± 0.029 | 1.49 ± 0.057 * | 1.30 ± 0.032 # | 1.19 ± 0.034 *,# |
Left kidney weight/body weight | 0.046 ± 0.001 | 0.053 ± 0.001 * | 0.042 ± 0.001 # | 0.044 ± 0.002 # |
Creatinine, μM | 1.38 ± 0.51 | 1.29 ± 0.29 | 1.45 ± 0.52 | 1.37 ± 0.61 |
Systolic blood pressure, mmHg | 131 ± 1 | 148 ± 2 * | 131 ± 1 # | 132 ± 1 # |
Diastolic blood pressure, mmHg | 88 ± 1 | 101 ± 2 * | 86 ± 2 # | 91 ± 2 # |
Mean arterial pressure, mmHg | 102 ± 1 | 117 ± 2 * | 101 ± 2 # | 104 ± 2 # |
Groups | C | CKD | T | CKDT |
---|---|---|---|---|
L-citrulline, μM | 56.6 ± 4.1 | 50.9 ± 1.3 | 59.8 ± 2.4 | 58.5 ± 2.6 |
L-arginine, μM | 179.0 ± 6.3 | 161.6 ± 3.4 | 164.5 ± 9.1 | 166.3 ± 3.4 |
ADMA, μM | 1.71 ± 0.07 | 2.02 ± 0.09 | 1.85 ± 0.08 | 2.18 ± 0.06 |
SDMA, μM | 1.77 ± 0.07 | 1.62 ± 0.10 | 1.87 ± 0.04 | 2.03 ± 0.1 |
L-arginine to ADMA ratio, μM/μM | 113.7 ± 6.0 | 75.2 ± 4.1 | 95.6 ± 7.6 | 72.4 ± 1.8 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tain, Y.-L.; Hou, C.-Y.; Chang-Chien, G.-P.; Lin, S.; Hsu, C.-N. Protective Role of Taurine on Rat Offspring Hypertension in the Setting of Maternal Chronic Kidney Disease. Antioxidants 2023, 12, 2059. https://doi.org/10.3390/antiox12122059
Tain Y-L, Hou C-Y, Chang-Chien G-P, Lin S, Hsu C-N. Protective Role of Taurine on Rat Offspring Hypertension in the Setting of Maternal Chronic Kidney Disease. Antioxidants. 2023; 12(12):2059. https://doi.org/10.3390/antiox12122059
Chicago/Turabian StyleTain, You-Lin, Chih-Yao Hou, Guo-Ping Chang-Chien, Sufan Lin, and Chien-Ning Hsu. 2023. "Protective Role of Taurine on Rat Offspring Hypertension in the Setting of Maternal Chronic Kidney Disease" Antioxidants 12, no. 12: 2059. https://doi.org/10.3390/antiox12122059