Molecular Antioxidant Functions are Enhanced in Atlantic Bluefin Tuna (Thunnus Thynnus, L.) Larvae Fed Selenium-Enriched Rotifers Brachionus Rotundiformis
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethical Statement
2.2. Atlantic Bluefin Tuna Larvae Rearing Conditions
2.3. Dietary Treatments
2.4. Sample Collection of Rotifers and ABT Larvae: Sampling for Growth Performance, Biochemical and Molecular Analysis
2.5. Larvae Biometry and Survival
2.6. Biochemical Analysis
2.6.1. Selenium Analysis
2.6.2. Total Lipid, Fatty Acid and TBARS Analysis
2.7. Molecular Analysis
2.7.1. Tissue RNA Extraction and cDNA Synthesis
2.7.2. Primer Preparation and qPCR
2.8. Statistical Analysis
3. Results
3.1. Performance of ABT Larvae during the Feeding Trial
3.2. Whole Body Se Content of ABT Larvae
3.3. Total Lipid Fatty Acid Composition and TBARS Content of ABT Larvae
3.4. Gene Expression
3.4.1. Expression of Selenoproteins in ABT Larvae
3.4.2. Expression of Other Antioxidant Defence Genes in ABT Larvae
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Van Beijnen, J. The Closed Cycle Aquaculture of Atlantic Bluefin Tuna in Europe: Current Status, Market Perceptions and Future Perspectives. Academia 2017. [Google Scholar] [CrossRef]
- de la Gándara, F.; Ortega, A.; Buentello, A. Chapter 6—Tuna Aquaculture in Europe. In Advances in Tuna Aquaculture; Benetti, D.D., Partridge, G.J., Buentello, A., Eds.; Academic Press: San Diego, CA, USA, 2016; pp. 115–157. ISBN 978-0-12-411459-3. [Google Scholar]
- Sawada, Y.; Okada, T.; Miyashita, S.; Murata, O.; Kumai, H. Completion of the Pacific Bluefin Tuna Thunnus Orientalis (Temminck et Schlegel) Life Cycle. Aquac. Res. 2005, 36, 413–421. [Google Scholar] [CrossRef] [Scilit]
- Woolley, L.D.; Qin, J.G. Swimbladder Inflation and Its Implication to the Culture of Marine Finfish Larvae. Rev. Aquac. 2010, 2, 181–190. [Google Scholar] [CrossRef] [Scilit]
- Betancor, M.B.; Ortega, A.; de la Gándara, F.; Tocher, D.R.; Mourente, G. Molecular Aspects of Lipid Metabolism, Digestibility and Antioxidant Status of Atlantic Bluefin Tuna (T. Thynnus L.) Larvae during First Feeding. Aquaculture 2017, 479, 357–369. [Google Scholar] [CrossRef] [Scilit]
- Betancor, M.B.; Ortega, A.; de la Gándara, F.; Tocher, D.R.; Mourente, G. Lipid Metabolism-Related Gene Expression Pattern of Atlantic Bluefin Tuna (Thunnus Thynnus L.) Larvae Fed on Live Prey. Fish Physiol. Biochem. 2017, 43, 493–516. [Google Scholar] [CrossRef] [Scilit]
- Koven, W.; Nixon, O.; Allon, G.; Gaon, A.; El Sadin, S.; Falcon, J.; Besseau, L.; Escande, M.; Vassallo Agius, R.; Gordin, H.; et al. The Effect of Dietary DHA and Taurine on Rotifer Capture Success, Growth, Survival and Vision in the Larvae of Atlantic Bluefin Tuna (Thunnus Thynnus). Aquaculture 2018, 482, 137–145. [Google Scholar] [CrossRef] [Scilit]
- Morais, S.; Mourente, G.; Ortega, A.; Tocher, J.A.; Tocher, D.R. Expression of Fatty Acyl Desaturase and Elongase Genes, and Evolution of DHA:EPA Ratio during Development of Unfed Larvae of Atlantic Bluefin Tuna (Thunnus Thynnus L.). Aquaculture 2011, 313, 129–139. [Google Scholar] [CrossRef] [Scilit]
- Khan, K.U.; Zuberi, A.; Fernandes, J.B.K.; Ullah, I.; Sarwar, H. An Overview of the Ongoing Insights in Selenium Research and Its Role in Fish Nutrition and Fish Health. Fish Physiol. Biochem. 2017, 43, 1689–1705. [Google Scholar] [CrossRef] [Scilit]
- Kljaković-Gašpić, Z.; Tičina, V. Mercury and Selenium Levels in Archive Samples of Wild Atlantic Bluefin Tuna from the Mediterranean Sea. Chemosphere 2021, 284, 131402. [Google Scholar] [CrossRef] [Scilit]
- Prabhu, P.A.J.; Schrama, J.W.; Kaushik, S.J. Mineral Requirements of Fish: A Systematic Review. Rev. Aquac. 2016, 8, 172–219. [Google Scholar] [CrossRef] [Scilit]
- Hamre, K.; Srivastava, A.; RØnnestad, I.; Mangor-Jensen, A.; Stoss, J. Several Micronutrients in the Rotifer Brachionus Sp. May Not Fulfil the Nutritional Requirements of Marine Fish Larvae. Aquac. Nutr. 2008, 14, 51–60. [Google Scholar] [CrossRef] [Scilit]
- Dawood, M.A.O.; Koshio, S.; Zaineldin, A.I.; Van Doan, H.; Moustafa, E.M.; Abdel-Daim, M.M.; Angeles Esteban, M.; Hassaan, M.S. Dietary Supplementation of Selenium Nanoparticles Modulated Systemic and Mucosal Immune Status and Stress Resistance of Red Sea Bream (Pagrus Major). Fish Physiol. Biochem. 2019, 45, 219–230. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Küçükbay, F.Z.; Yazlak, H.; Karaca, I.; Sahin, N.; Tuzcu, M.; Cakmak, M.N.; Sahin, K. The Effects of Dietary Organic or Inorganic Selenium in Rainbow Trout (Oncorhynchus Mykiss) under Crowding Conditions. Aquac. Nutr. 2009, 15, 569–576. [Google Scholar] [CrossRef] [Scilit]
- Rider, S.A.; Davies, S.J.; Jha, A.N.; Fisher, A.A.; Knight, J.; Sweetman, J.W. Supra-Nutritional Dietary Intake of Selenite and Selenium Yeast in Normal and Stressed Rainbow Trout (Oncorhynchus Mykiss): Implications on Selenium Status and Health Responses. Aquaculture 2009, 295, 282–291. [Google Scholar] [CrossRef] [Scilit]
- Filho, D.W. Reactive Oxygen Species, Antioxidants and Fish Mitochondria. Front. Biosci. 2007, 12, 1229. [Google Scholar] [CrossRef] [Scilit]
- Sies, H. Oxidative Stress: Concept and Some Practical Aspects. Antioxidants 2020, 9, 852. [Google Scholar] [CrossRef] [Scilit]
- Chowdhury, S.; Saikia, S.K. Oxidative Stress in Fish: A Review. J. Sci. Res. 2020, 12, 145–160. [Google Scholar] [CrossRef] [Scilit]
- Mariotti, M.; Ridge, P.G.; Zhang, Y.; Lobanov, A.V.; Pringle, T.H.; Guigo, R.; Hatfield, D.L.; Gladyshev, V.N. Composition and Evolution of the Vertebrate and Mammalian Selenoproteomes. PLoS ONE 2012, 7, e33066. [Google Scholar] [CrossRef] [Scilit]
- Labunskyy, V.M.; Hatfield, D.L.; Gladyshev, V.N. Selenoproteins: Molecular Pathways and Physiological Roles. Physiol. Rev. 2014, 94, 739–777. [Google Scholar] [CrossRef] [Scilit]
- Ingold, I.; Conrad, M. Oxidative Stress, Selenium Redox Systems Including GPX/TXNRD Families. In Selenium; Michalke, B., Ed.; Molecular and Integrative Toxicology; Springer International Publishing: Cham, Switzerland, 2018; pp. 111–135. ISBN 978-3-319-95390-8. [Google Scholar]
- dos Santos, S.L.; Petropoulos, I.; Friguet, B. The Oxidized Protein Repair Enzymes Methionine Sulfoxide Reductases and Their Roles in Protecting against Oxidative Stress, in Ageing and in Regulating Protein Function. Antioxidants 2018, 7, 191. [Google Scholar] [CrossRef] [Scilit]
- Lu, J.; Holmgren, A. The Thioredoxin Antioxidant System. Free Radic. Biol. Med. 2014, 66, 75–87. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Saito, Y. Selenium Transport Mechanism via Selenoprotein P—Its Physiological Role and Related Diseases. Font. Nutr. 2021, 8, 685517. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, Y.; Roh, Y.J.; Han, S.-J.; Park, I.; Lee, H.M.; Ok, Y.S.; Lee, B.C.; Lee, S.-R. Role of Selenoproteins in Redox Regulation of Signaling and the Antioxidant System: A Review. Antioxidants 2020, 9, 383. [Google Scholar] [CrossRef] [Scilit]
- García, A.O. Cultivo Integral de dos Especies de Escómbridos: Atún Rojo del Atlántico (Thunnus thynnus, L. 1758) y Bonito Atlántico (Sarda sarda, Bloch 1793). Ph.D. Thesis, Murcia University, Murcia, Spain, 2015; 224p. [Google Scholar]
- Folch, J.; Lees, M.; Sloane Stanley, G.H. A Simple Method for the Isolation and Purification of Total Lipids from Animal Tissues. J. Biol. Chem. 1957, 226, 497–509. [Google Scholar] [CrossRef] [Scilit]
- Christie, W.W.; Han, X. Chapter 9—Isolation of Fatty Acids and Identification by Spectroscopic and Related Techniques. In Lipid Analysis, 4th ed.; Christie, W.W., Han, X., Eds.; Oily Press Lipid Library Series; Woodhead Publishing: Sawston, UK, 2012; pp. 181–211. ISBN 978-0-9552512-4-5. [Google Scholar]
- Christie, W.W. Lipid Analysis. Trends Food Sci. Technol. 1996, 11, 145. [Google Scholar] [CrossRef] [Scilit]
- Pfaffl, M.W.; Horgan, G.W.; Dempfle, L. Relative Expression Software Tool (REST©) for Group-Wise Comparison and Statistical Analysis of Relative Expression Results in Real-Time PCR. Nucleic. Acids Res. 2002, 30, e36. [Google Scholar] [CrossRef] [Scilit]
- Ribeiro, A.R.A.; Ribeiro, L.; Sæle, Ø.; Hamre, K.; Dinis, M.T.; Moren, M. Selenium Supplementation Changes Glutathione Peroxidase Activity and Thyroid Hormone Production in Senegalese Sole (Solea Senegalensis) Larvae. Aquac. Nutr. 2012, 18, 559–567. [Google Scholar] [CrossRef] [Scilit]
- Hamre, K.; Mollan, T.A.; Øystein, S.; Erstad, B. Rotifers Enriched with Iodine and Selenium Increase Survival in Atlantic Cod (Gadus Morhua) Larvae. Aquaculture 2008, 284, 190–195. [Google Scholar] [CrossRef] [Scilit]
- Kim, H.-J.; Sakakura, Y.; Maruyama, I.; Nakamura, T.; Takiyama, K.; Fujiki, H.; Hagiwara, A. Feeding Effect of Selenium Enriched Rotifers on Larval Growth and Development in Red Sea Bream Pagrus Major. Aquaculture 2014, 432, 273–277. [Google Scholar] [CrossRef] [Scilit]
- Juhász, P.; Lengyel, S.; Udvari, Z.; Sándor, A.N.; Stündl, L. Optimised Selenium Enrichment of Artemia Sp. Feed to Improve Red Drum (Sciaenops Ocellatus) Larvae Rearing. Acta Biol. Hung. 2017, 68, 255–266. [Google Scholar] [CrossRef] [Scilit]
- Ribeiro, A.R.A.; Ribeiro, L.; Sæle, Ø.; Dinis, M.T.; Moren, M. Iodine and Selenium Supplementation Increased Survival and Changed Thyroid Hormone Status in Senegalese Sole (Solea Senegalensis) Larvae Reared in a Recirculation System. Fish Physiol. Biochem. 2012, 38, 725–734. [Google Scholar] [CrossRef] [Scilit]
- Sunde, R.A. Selenoproteins: Hierarchy, Requirements, and Biomarkers. In Selenium: Its Molecular Biology and Role in Human Health; Hatfield, D.L., Berry, M.J., Gladyshev, V.N., Eds.; Springer: New York, NY, USA, 2012; pp. 137–152. ISBN 978-1-4614-1025-6. [Google Scholar]
- Penglase, S.; Nordgreen, A.; van der Meeren, T.; Olsvik, P.A.; Sæle, Ø.; Sweetman, J.W.; Baeverfjord, G.; Helland, S.; Hamre, K. Increasing the Level of Selenium in Rotifers (Brachionus Plicatilis ‘Cayman’) Enhances the MRNA Expression and Activity of Glutathione Peroxidase in Cod (Gadus Morhua L.) Larvae. Aquaculture 2010, 306, 259–269. [Google Scholar] [CrossRef] [Scilit]
- Brigelius-Flohé, R.; Flohé, L. Regulatory Phenomena in the Glutathione Peroxidase Superfamily. Antioxid. Redox Signal. 2020, 33, 498–516. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schomburg, L.; Köhrle, J. On the Importance of Selenium and Iodine Metabolism for Thyroid Hormone Biosynthesis and Human Health. Mol. Nutr. Food Res. 2008, 52, 1235–1246. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wischhusen, P.; Parailloux, M.; Geraert, P.A.; Briens, M.; Bueno, M.; Mounicou, S.; Bouyssiere, B.; Prabhu, P.A.J.; Kaushik, S.J.; Fauconneau, B.; et al. Effect of parental selenium in rainbow trout (Oncorhynchus mykiss) broodstock on antioxidant status, its parental transfer and oxidative status in the progeny. Aquaculture 2019, 507, 126–138. [Google Scholar] [CrossRef] [Scilit]
- Yamashita, Y.; Yamashita, M. Identification of a Novel Selenium-Containing Compound, Selenoneine, as the Predominant Chemical Form of Organic Selenium in the Blood of Bluefin Tuna. J. Biol. Chem. 2010, 285, 18134–18138. [Google Scholar] [CrossRef] [Scilit]
- Achouba, A.; Dumas, P.; Ouellet, N.; Little, M.; Lemire, M.; Ayotte, P. Selenoneine Is a Major Selenium Species in Beluga Skin and Red Blood Cells of Inuit from Nunavik. Chemosphere 2019, 229, 549–558. [Google Scholar] [CrossRef] [Scilit]
- Pluskal, T.; Ueno, M.; Yanagida, M. Genetic and Metabolomic Dissection of the Ergothioneine and Selenoneine Biosynthetic Pathway in the Fission Yeast, S. Pombe, and Construction of an Overproduction System. PLoS ONE 2014, 9, e97774. [Google Scholar] [CrossRef] [Scilit]
- Cavrois-Rogacki, T.; Rolland, A.; Migaud, H.; Davie, A.; Monroig, O. Enriching Artemia Nauplii with Selenium from Different Sources and Interactions with Essential Fatty Acid Incorporation. Aquaculture 2020, 520, 734677. [Google Scholar] [CrossRef] [Scilit]
- Glorieux, C.; Zamocky, M.; Sandoval, J.M.; Verrax, J.; Calderon, P.B. Regulation of Catalase Expression in Healthy and Cancerous Cells. Free Radic. Biol. Med. 2015, 87, 84–97. [Google Scholar] [CrossRef] [Scilit]
- Miao, L.; St. Clair, D.K. Regulation of Superoxide Dismutase Genes: Implications in Disease. Free Radic. Biol. Med. 2009, 47, 344–356. [Google Scholar] [CrossRef] [Scilit] [PubMed]



| Treatment | Supplementation Level [μg Se·L−1] | Analysed Level [μg Se·g−1 DM] |
|---|---|---|
| Se0 | 0 | 0.10 |
| Se3 | 3 | 4.42 |
| Se10 | 10 | 8.95 |
| Se30 | 30 | 12.49 |
| Se100 | 100 | 30.05 |
| Gene | Forward Primer | Reverse Primer | Amplification Size | Tm °C | Gene Accession Number |
|---|---|---|---|---|---|
| selenop | TTTCAGTAAAAGGATTGGGGCAGT | CCACCTCCCCTATCTTCCAGG | 159 | 60 | XM_042422385 |
| gpx1 | TGGAGAAAGTGGATGTGAACGG | GTGCTGTGGAAGCTGTATGATGG | 309 | 55 | XM_042407639 |
| gpx4 | TGGGGAATAGCATCAAGTGG | CGAGAAAGGAGGGAAACAGG | 206 | 55 | XM_042417456 |
| msrb1 | AAGTTCTTCGGGGGAGAGGT | CCGTACCTTGTATGCCCCAG | 192 | 60 | XM_042392867 |
| trxr2 | GCAACGAACACAAGGACACC | TTCCCCGTCTCGTTGTTGAG | 115 | 60 | XM_042421509 |
| selenoe | AAGAGGTCCCAGAAAGGGGA | GTCCTCAGAATGGTGCCTGG | 177 | 60 | XM_042422277 |
| selenom | GGATCGGATCGCCTTGTCTG | GTGGAGGGCTTGTACTCTGG | 168 | 60 | XM_042420960 |
| sep15 | TTGTCAGGAGTGACAAGCCG | TCGGCGATGTTCCCGTTATC | 106 | 60 | XM_042427572 |
| dio1 | TTGCACCTGACCACCGTTTA | CGGACAGCCTTTCCTCCAAA | 179 | 60 | XM_042417653 |
| dio2 | GAAAGTCGGGAGCACTCCAT | GTCACGAGCAGATCCATCCC | 167 | 60 | XM_042389463 |
| dio3 | CGCAGTCGCATCCTCGATTA | CGGTGCTTGGGAATCTGGTA | 218 | 60 | XM_042388824 |
| gr | TGTAGCTCATGTGAGGATCACC | AGAGGCAGGGAGCTCTAGTC | 200 | 60 | XM_042419753 |
| cat | ATGGTGTGGGACTTCTGGAG | ATGAAACGGTAGCCATCAGG | 95 | 60 | XM_042411457 |
| sod1 | TCCCAGATCACCTACATGCC | CTGCGGAGAGTTGCTTGATC | 182 | 59 | XM_042402399 |
| ef1a | CCCCTGGACACAGAGACTTC | GCCGTTCTTGGAGATACCAG | 119 | 60 | XM_042435016 |
| bactin | ACCCACACAGTGCCCATCTA | TCACGCACGATTTCCCTCT | 155 | 61 | XM_042393876 |
| Se0 | Se3 | Se10 | Se30 | Se100 | |
|---|---|---|---|---|---|
| Survival [%] | 6.5 ± 0.9 ab | 10.1 ± 1.5 a | 5.9 ± 1.1 b | 6.8 ± 0.5 ab | 7.5 ± 2.6 ab |
| T. length [mm] | 6.6 ± 0.6 b | 7.0 ± 0.6 a | 6.8 ± 0.7 ab | 7.0 ± 0.5 a | 6.7 ± 0.5 ab |
| Dry mass [mg] | 0.6 ± 0.1 b | 0.7 ± 0.1 ab | 0.7 ± 0.1 ab | 0.7 ± 0.1 a | 0.6 ± 0.1 ab |
| Flexion Index | 69 ± 5 c | 76 ± 14 b | 80 ± 8 a | 77 ± 6 a | 74 ± 3 b |
| Se0 | Se3 | Se10 | Se30 | Se100 | p-Value | |
|---|---|---|---|---|---|---|
| Total lipid | 12.1 ± 0.9 | 12.1 ± 0.3 | 11.4 ± 0.8 | 12.1 ± 0.6 | 12.3 ± 0.4 | 0.57 |
| Fatty acid | ||||||
| 16:0 | 23.56 ± 1.47 | 22.77 ± 0.73 | 22.2 ± 0.4 | 22.4 ± 0.2 | 22.8 ± 0.8 | 0.38 |
| 18:0 | 11.95 ± 0.95 | 12.0 ± 0.5 | 11.4 ± 0.4 | 11.6 ± 0.1 | 11.7 ± 0.2 | 0.64 |
| Total saturated § | 39.3 ± 2.4 | 38.5 ± 1.1 | 37.4 ± 0.8 | 37.8 ± 0.3 | 38.4 ± 1.2 | 0.51 |
| 18:1n − 9 | 4.45 ± 0.30 | 4.11 ± 0.51 | 3.77 ± 0.03 | 3.86 ± 0.16 | 4.86 ± 0.89 | 0.11 |
| Total monounsaturated # | 11.5 ± 0.6 | 11.1 ± 0.3 | 11.1 ± 0.0 | 11.0 ± 0.2 | 12.4 ± 1.6 | 0.24 |
| 18:2n − 6 | 9.91 ± 0.54 | 9.01 ± 0.57 | 9.32 ± 0.04 | 9.57 ± 0.40 | 10.1 ± 0.8 | 0.20 |
| 18:3n − 6 | 0.11 ± 0.00 b | 0.12 ± 0.01 ab | 0.12 ± 0.00 a | 0.11 ± 0.00 ab | 0.11 ± 0.00 b | 0.02 |
| 20:3n − 6 | 0.36 ± 0.01 ab | 0.34 ± 0.01 b | 0.38 ± 0.00 a | 0.37 ± 0.01 ab | 0.37 ± 0.01 ab | 0.02 |
| 20:4n − 6 | 2.22 ± 0.17 | 2.58 ± 0.2 | 2.53 ± 0.08 | 2.49 ± 0.13 | 2.34 ± 0.29 | 0.21 |
| 22:5n − 6 | 4.51 ± 0.21 | 5.3 ± 0.16 | 5.28 ± 0.12 | 5.02 ± 0.39 | 4.26 ± 0.95 | 0.09 |
| Total n − 6 PUFA + | 18.4 ± 0.5 | 18.5 ± 0.2 | 18.8 ± 0.2 | 18.8 ± 0.2 | 18.4 ± 0.4 | 0.36 |
| 18:3n − 3 | 1.61 ± 0.11 | 1.52 ± 0.16 | 1.61 ± 0.03 | 1.58 ± 0.05 | 1.77 ± 0.25 | 0.37 |
| 20:4n − 3 | 0.37 ± 0.01 c | 0.36 ± 0.02 bc | 0.41 ± 0.01 a | 0.38 ± 0.01 abc | 0.40 ± 0.01 ab | <0.01 |
| 20:5n − 3 | 3.2 ± 0.27 | 3.02 ± 0.2 | 3.25 ± 0.14 | 3.26 ± 0.13 | 3.36 ± 0.19 | 0.37 |
| 22:6n − 3 | 20.62 ± 1.3 | 22.1 ± 0.9 | 22.2 ± 0.5 | 22.0 ± 0.3 | 19.9 ± 2.3 | 0.19 |
| Total n − 3 PUFA & | 28.9 ± 2.0 | 29.9 ± 1.1 | 30.7 ± 0.8 | 30.4 ± 0.1 | 28.8 ± 1.8 | 0.35 |
| Total PUFA | 48.0 ± 2.4 | 49.0 ± 1.2 | 50.2 ± 0.7 | 49.9 ± 0.3 | 47.9 ± 2.1 | 0.33 |
| n − 3/n − 6 | 1.57 ± 0.07 | 1.61 ± 0.06 | 1.63 ± 0.05 | 1.62 ± 0.02 | 1.56 ± 0.07 | 0.52 |
| EPA ± DHA [g/100 g] | 1.16 ± 0.14 | 1.29 ± 0.09 | 1.30 ± 0.14 | 1.31 ± 0.09 | 1.24 ± 0.15 | 0.56 |
| TBARS | 996 ± 263 | 840 ± 161 | 1053 ± 190 | 1011 ± 250 | 957 ± 198 | 0.82 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wischhusen, P.; Betancor, M.B.; Sprague, M.; Ortega, A.; de la Gándara, F.; Tocher, D.R.; Mourente, G. Molecular Antioxidant Functions are Enhanced in Atlantic Bluefin Tuna (Thunnus Thynnus, L.) Larvae Fed Selenium-Enriched Rotifers Brachionus Rotundiformis. Antioxidants 2023, 12, 26. https://doi.org/10.3390/antiox12010026
Wischhusen P, Betancor MB, Sprague M, Ortega A, de la Gándara F, Tocher DR, Mourente G. Molecular Antioxidant Functions are Enhanced in Atlantic Bluefin Tuna (Thunnus Thynnus, L.) Larvae Fed Selenium-Enriched Rotifers Brachionus Rotundiformis. Antioxidants. 2023; 12(1):26. https://doi.org/10.3390/antiox12010026
Chicago/Turabian StyleWischhusen, Pauline, Mónica B. Betancor, Matthew Sprague, Aurelio Ortega, Fernando de la Gándara, Douglas R. Tocher, and Gabriel Mourente. 2023. "Molecular Antioxidant Functions are Enhanced in Atlantic Bluefin Tuna (Thunnus Thynnus, L.) Larvae Fed Selenium-Enriched Rotifers Brachionus Rotundiformis" Antioxidants 12, no. 1: 26. https://doi.org/10.3390/antiox12010026
APA StyleWischhusen, P., Betancor, M. B., Sprague, M., Ortega, A., de la Gándara, F., Tocher, D. R., & Mourente, G. (2023). Molecular Antioxidant Functions are Enhanced in Atlantic Bluefin Tuna (Thunnus Thynnus, L.) Larvae Fed Selenium-Enriched Rotifers Brachionus Rotundiformis. Antioxidants, 12(1), 26. https://doi.org/10.3390/antiox12010026

