Exogenous Betaine Enhances the Protrusion Vigor of Rice Seeds under Heat Stress by Regulating Plant Hormone Signal Transduction and Its Interaction Network
Abstract
:1. Introduction
2. Materials and Methods
2.1. Test Materials
2.2. Experimental Design
2.3. Determination of Physiological Indexes
2.4. Determination of Endogenous Hormones
2.5. RNA-Seq Analysis
2.6. Quantitative Real-Time PCR
2.7. Data Processing and Analysis
3. Results
3.1. Betaine Soaking Treatment Can Promote the Germination of Rice Seeds under Heat Stress
3.2. Betaine Increased the Antioxidant Enzyme Activity and Soluble Protein Content of Rice Seeds under Heat Stress
3.3. Hormone Content during Seed Germination
3.4. Transcriptome Analysis of the Effect of Betaine Treatment on Rice Seed Germination under Heat Stress
3.5. Comparative Analysis of Differential Genes
3.6. GO Pathway Analysis
3.7. KEGG Pathway Analysis
3.8. Differential Genes Related to Reactive Oxygen Species in MAPK Plant Signaling Pathway
3.9. Differential Genes Related to Hormone Signaling Pathway
3.10. Validation of DEGs by qRT-PCR
4. Discussion
4.1. Seed Germination
4.2. Physiological Changes of Rice under Heat Stress
4.3. Synthesis and Metabolism of IAA, GAs and ABA under Heat Stress
4.4. Expression and Crosstalk of IAA, GA and ABA Signals
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Khush, G. What it will take to Feed 5.0 Billion Rice consumers in 2030. Plant Mol. Biol. 2005, 59, 1–6. [Google Scholar] [CrossRef] [PubMed]
- IPCC (Intergovernmental Panel on Climate Change). Climate Change: The Physical Science Basis. In Contribution of Working Group I to the Fourth Assessment Report of the Intergovernmental Panel on Climate Change; Solomon, S., Qin, D., Manning, M., Chen, Z., Marquis, M., Averyt, K.B., Tignor, M., Miller, H.L., Eds.; Cambridge University Press: New York, NY, USA, 2007; p. 996. [Google Scholar]
- Peng, S.B.; Huang, J.L.; Sheehy, J.E.; Laza, R.C.; Visperas, R.M.; Zhong, X.H.; Centeno, G.S.; Khush, G.S.; Cassman, K.G. Rice yields decline with higher night temperature from global warming. Proc. Natl. Acad. Sci. USA 2004, 101, 9971–9975. [Google Scholar] [CrossRef] [PubMed]
- Ceccarelli, S.; Grando, S.; Maatougui, M.; Michael, M.; Slash, M.; Haghparast, R.; Rahmanian, M.; Taheri, A.; Al-Yassin, A.; Benbelkacem, A.; et al. Plant breeding and climate changes. J. Agric. Sci. 2010, 148, 627–637. [Google Scholar] [CrossRef]
- Feng, B.; Zhang, C.; Chen, T.; Zhang, X.; Tao, L.; Fu, G. Salicylic acid reverses pollen abortion of rice caused by heat stress. BMC Plant Biol. 2018, 18, 245. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Wang, L.; Zhou, J.; Hu, S.; Chen, H.; Xiang, J.; Zhang, Y.; Zeng, Y.; Shi, Q.; Zhu, D.; et al. Research Progress on Heat Stress of Rice at Flowering Stage. Rice Sci. 2019, 26, 1–10. [Google Scholar] [CrossRef]
- Coast, O.; Murdoch, A.J.; Ellis, R.H.; Hay, F.R.; Jagadish, K.S. Resilience of rice (Oryza spp.) pollen germination and tube growth to temperature stress. Plant Cell Environ. 2016, 39, 26–37. [Google Scholar] [CrossRef]
- Fu, G.; Feng, B.; Zhang, C.; Yang, Y.; Yang, X.; Chen, T.; Zhao, X.; Zhang, X.; Jin, Q.; Tao, L. Heat Stress Is More Damaging to Superior Spikelets than Inferiors of Rice (Oryza sativa L.) due to Their Different Organ Temperatures. Front. Plant Sci. 2016, 7, 1637. [Google Scholar] [CrossRef]
- Duan, Y.; Yang, J.C. Research advances in the effect of high temperature on rice and its mechanism. Chinese J. Rice Sci. 2012, 26, 393–400. [Google Scholar] [CrossRef]
- Asada, K. Production and scavenging of reactive oxygen species in chloroplasts and their functions. Plant Physiol. 2006, 141, 391–396. [Google Scholar] [CrossRef]
- Gill, S.S.; Anjum, N.A.; Hasanuzzaman, M.; Gill, R.; Trivedi, D.K.; Ahmad, I.; Pereira, E.; Tuteja, N. Gluta-thione and glutathione reductase: A boon in disguise for plant abiotic stress defense operations. Plant Physiol. Biochem. 2013, 70, 204–212. [Google Scholar] [CrossRef]
- Tian, X.J.; Lu, H.X. Effects of heat stress on seed vigor and antioxidant enzyme activity of rape seedlings. Jiangsu Agri-Cult. Sci. 2011, 4, 2. [Google Scholar] [CrossRef]
- Sheng, W.; Wang, Y.F.; Yu, X.; Chen, Z.J.; Lu, J.W.; Cao, Z.F.; Wang, Q. Effects of priming treatment on the characteristics of germination and physiological and biochemical of lettuce seed under high temperature stress. Seed 2016, 35, 4. [Google Scholar]
- Razem, F.A.; Baron, K.; Hill, R.D. Turning on gibberellin and abscisic acid signaling. Curr. Opin. Plant Biol. 2006, 9, 454–459. [Google Scholar] [CrossRef] [PubMed]
- Zhou, F. Hormone signal interaction in seed germination. North. Hortic. 2017, 6, 4. [Google Scholar]
- Iqbal, N.; Sehar, Z.; Fatma, M.; Umar, S.; Sofo, A.; Khan, N.A. Nitric Oxide and Abscisic Acid Mediate Heat Stress Tolerance through Regulation of Osmolytes and Antioxidants to Protect Photosynthesis and Growth in Wheat Plants. Antioxidants 2022, 11, 372. [Google Scholar] [CrossRef]
- Li, G.; Zhang, C.; Zhang, G.; Fu, W.; Feng, B.; Chen, T.; Peng, S.; Tao, L.; Fu, G. Abscisic Acid Negatively Modulates Heat Tolerance in Rolled Leaf Rice by Increasing Leaf Temperature and Regulating Energy Homeostasis. Rice 2020, 13, 18. [Google Scholar] [CrossRef]
- Shuai, H.W.; Meng, Y.J.; Luo, X.F.; Chen, F.; Qi, Y.; Yang, W.Y.; Shu, K. The roles of auxin in seed dormancy and germination. Hereditas 2016, 38, 314–322. [Google Scholar] [CrossRef]
- Sharma, E.; Borah, P.; Kaur, A.; Bhatnagar, A.; Mohapatra, T.; Kapoor, S.; Khurana, J.P. A comprehensive tran-scriptome analysis of contrasting rice cultivars highlights the role of auxin and ABA responsive genes in heat stress re-sponse. Genomics 2021, 113, 1247–1261. [Google Scholar] [CrossRef]
- Gray, W.M.; Östin, A.; Sandberg, G.; Romano, C.P.; Estelle, M. High temperature promotes auxin-mediated hypocotyl elongation in Arabidopsis. Proc. Natl. Acad. Sci. USA 1998, 95, 7197–7202. [Google Scholar] [CrossRef]
- Li, Q.L.; Yang, H.; Gao, X.R.; Liu, D.W.; An, L.J. Molecular biology and genetic engineering of betaine synthase in plants. China Biotechnol. 2002, 22, 84–86. [Google Scholar] [CrossRef]
- Li, S.; Li, F.; Wang, J.; Zhang, W.; Meng, Q.; Chen, T.H.; Murata, N.; Yang, X. Glycinebetaine enhances the tolerance of tomato plants to high temperature during germination of seeds and growth of seedlings. Plant Cell Environ. 2011, 34, 1931–1943. [Google Scholar] [CrossRef] [PubMed]
- Hayashi, H.; Sakamoto, A.; Murata, N. Enhancement of the tolerance of Arabidopsis to high temperatures by genetic engineering of the synthesis of glycinebetaine. Plant J. 1998, 16, 155161. [Google Scholar] [CrossRef] [PubMed]
- Sorwong, A.; Sakhonwasee, S. Foliar Application of Glycine Betaine Mitigates the Effect of Heat Stress in Three Marigold (Tagetes erecta) Cultivars. J. Jpn. Soc. Hortic. Sci. 2015, 84, 161–171. [Google Scholar] [CrossRef]
- Lu, J.; Xing, X.J.; Zhu, L.Q.; Wang, Y.; Yan, H.; Yuan, J.J. Effects of exogenous glycine betaine and CaCl2 on physiological response of tobacco plants under stresses of heat and drought. J. Plant Nutr. Fertil. 2011, 17, 1437–1443. [Google Scholar] [CrossRef]
- Chen, J.; Ren, B.; Zhao, B.; Liu, P.; Zhang, J. Regulation of leaf-spraying glycine betaine on yield formation and antioxidation of summer maize sowed in different dates. Acta Agron. Sin. 2022, 48, 1502–1515. [Google Scholar] [CrossRef]
- Ishitani, M.; Arakawa, K.; Mizuno, K.; Kishitani, S.; Takabe, T. Betaine Aldehyde Dehydrogenase in the Gramineae: Levels in Leaves Both Betaine-Accumulating and Nonaccumulating Cereal Plants. Plant Cell Physiol. 1992, 34, 493–495. [Google Scholar] [CrossRef]
- Kishitani, S.; Takanami, T.; Suzuki, M.; Oikawa, M.; Yokoi, S.; Ishitani, M.; Alvarez-Nakase, A.M. Compatibility of gly-cinebetaine in rice plants: Evaluation using transgenic rice plants with a gene for peroxisomal betaine aldehyde dehy-drogenase from barley. Plant Cell Environ. 2000, 23, 107–114. [Google Scholar] [CrossRef]
- Zulfiqar, F.; Ashraf, M.; Siddique, K.H.M. Role of Glycine Betaine in the Thermotolerance of Plants. Agronomy 2022, 12, 276. [Google Scholar] [CrossRef]
- Hafez, E.M.; Gowayed, S.M.; Nehela, Y.; Sakran, R.M.; Rady, A.M.S.; Awadalla, A.; Omara, A.E.; Alowaiesh, B.F. Incorporated Biochar-Based Soil Amendment and Exogenous Glycine Betaine Foliar Application Ameliorate Rice (Oryza sativa L.) Tolerance and Resilience to Osmotic Stress. Plants 2021, 10, 1930. [Google Scholar] [CrossRef]
- Tisarum, R.; Theerawitaya, C.; Samphumphung, T.; Takabe, T.; Cha-um, S. Exogenous Foliar Application of Glycine Betaine to Alleviate Water Deficit Tolerance in Two Indica Rice Genotypes under Greenhouse Conditions. Agronomy. 2019, 9, 138. [Google Scholar] [CrossRef]
- Yu, Y.; Deng, L.; Zhou, L.; Chen, G.; Wang, Y. Exogenous Melatonin Activates Antioxidant Systems to Increase the Ability of Rice Seeds to Germinate under High Temperature Conditions. Plants 2022, 11, 886. [Google Scholar] [CrossRef] [PubMed]
- Dhindsa, R.S.; Pamela, P.D.; Thorpe, T.A. Leaf Senescence: Correlated with Increased Levels of Membrane Permeability and Lipid Peroxidation, and Decreased Levels of Superoxide Dismutase and Catalase. J. Exp. Bot. 1981, 1, 93–101. [Google Scholar] [CrossRef]
- Kar, R.K.; Choudhuri, M.A. Possible mechanisms of light-induced chlorophyll degradation in senescing leaves of Hydrilla verticillata. Physiol. Plant 1987, 70, 729–734. [Google Scholar] [CrossRef]
- Aebi, H. Catalase in vitro. Methods Enzymol. 1984, 105, 121. [Google Scholar] [CrossRef]
- Li, R.L.; Xie, Y.D.; Tang, Y. Effect of Application Accumulator Plant Straw on the Osmotic Adjustment Substances and Malondialdehyde Content of Lettuce. IOP Conf. Ser. Earth Environ. Sci. 2019, 233, 042025. [Google Scholar] [CrossRef]
- Zou, Q. Plant Physiology Experiment Guide; China Agriculture Press: Beijing, China, 2000; pp. 125–130. (In Chinese) [Google Scholar]
- Kanehisa, M.; Araki, M.; Goto, S.; Hattori, M.; Hirakawa, M.; Itoh, M.; Katayama, T.; Kawashima, S.; Okuda, S.; Tokimatsu, T.; et al. KEGG for linking genomes to life and the environment. Nucleic Acids Res. 2008, 36, 480–484. [Google Scholar] [CrossRef]
- Zhang, H.; Wang, Z. Seed Science, 3rd ed.; Science Press: Beijing, China, 2021; pp. 172–173. [Google Scholar]
- Wang, Z.; Fang, B.; Chen, J.; Zhang, X.; Luo, Z.; Huang, L.; Chen, X.; Li, Y. De novo assembly and characterization of root transcriptome using illumina paired-end sequencing and development of cSSR Markers in sweetpotato (Ipomoea Batatas). BMC Genom. 2010, 11, 726. [Google Scholar] [CrossRef]
- Gene Ontology Consortium. The gene ontology (GO) database and informatics resource. Nucleic Acids Res. 2004, 32, 258–261. [Google Scholar] [CrossRef]
- Liu, F.; Yang, W.; Sun, Q. Transcriptome sequencing data analysis and high-throughput GO annotation. J. Anhui Agric. Sci. 2018, 46, 88–91. [Google Scholar] [CrossRef]
- Liu, Y.; He, C. A review of redox signaling and the control of MAP kinase pathway in plants. Redox Biol. 2017, 11, 192–204. [Google Scholar] [CrossRef]
- Pitzschke, A.; Hirt, H. Disentangling the complexity of mitogen-activated protein kinases and reactive oxygen species signaling. Plant Physiol. 2009, 149, 606–615. [Google Scholar] [CrossRef] [PubMed]
- Asai, S.; Ohta, K.; Yoshioka, H. MAPK signaling regulates nitric oxide and NADPH oxidase-dependent oxidative bursts in Nicotiana benthamiana. Plant Cell 2008, 20, 1390–1406. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Takahashi, F.; Mizoguchi, T.; Yoshida, R.; Ichimura, K.; Shinozaki, K. Calmodulin-dependent activation of MAP kinase for ROS homeostasis in Arabidopsis. Mol. Cell 2011, 4, 649–660. [Google Scholar] [CrossRef]
- Xing, Y.; Jia, W.; Zhang, J. AtMKK1 mediates ABA-induced CAT1 expression and H2O2 production via AtMPK6-coupled signaling in Arabidopsis. Plant J. 2008, 54, 440–451. [Google Scholar] [CrossRef] [PubMed]
- Lo, S.; Yang, S.; Chen, K.; Hsing, Y.; Zeevaart, J.; Chen, L.; Yu, S. A novel class of gibberellin 2-oxidases control sem-idwarfism, tillering, and root development in rice. Plant Cell 2008, 20, 2603–2618. [Google Scholar] [CrossRef] [PubMed]
- Ito, T.; Okada, K.; Fukazawa, J.; Takahashi, Y. DELLA-dependent and -independent gibberellin signaling. Plant Signal Behav. 2018, 13, e1445933. [Google Scholar] [CrossRef] [PubMed]
- Chen, K.; Li, G.J.; Bressan, R.A.; Song, C.P.; Zhu, J.K.; Zhao, Y. Abscisic acid dynamics, signaling, and functions in plants. J. Integr. Plant Biol. 2020, 62, 25–54. [Google Scholar] [CrossRef] [PubMed]
- Nambara, E.; Marion-Poll, A. Abscisic acid biosynthesis and catabolism. Annu. Rev. Plant Biol. 2005, 56, 165–185. [Google Scholar] [CrossRef]
- Ren, H.; Gray, W.M. SAUR Proteins as Effectors of Hormonal and Environmental Signals in Plant Growth. Mol. Plant 2015, 8, 1153–1164. [Google Scholar] [CrossRef]
- Jain, M.; Kaur, N.; Tyagi, A.K.; Khurana, J.P. The auxin-responsive GH3 gene family in rice (Oryza sativa). Funct Integr Genom. 2006, 6, 36–46. [Google Scholar] [CrossRef]
- Zhang, S.W.; Li, C.H.; Cao, J.; Zhang, Y.C.; Zhang, S.Q.; Xia, Y.F.; Sun, D.Y.; Sun, Y. Altered architecture and enhanced drought tolerance in rice via the down-regulation of indole-3-acetic acid by TLD1/OsGH3.13 activation. Plant Physiol. 2009, 151, 1889–1901. [Google Scholar] [CrossRef] [PubMed]
- Zhu, Y.B.; Kong, Y.Y.; Wang, J.H. Research advances in auxin-responsive SAUR genes . Chin. Bull. Life Sci. 2014, 26, 407–413. [Google Scholar] [CrossRef]
- Wei, S.; Yang, X.; Hou, G.; Ge, G.; Liu, H.; Luo, L.; Hu, J.; Huang, D.; Long, P. Distinct metabolome changes during seed germination of lettuce (Lactuca sativa L.) in response to thermal stress as revealed by untargeted metabolomics analysis. Int. J. Mol. Sci. 2020, 21, 1481. [Google Scholar] [CrossRef] [PubMed]
- Pamplona, J.; Souza, M.; Sousa, D.; Mesquita, H.; Freitas, C.; Lins, H.; Torres, S.; Silv, D. Seed germination of Bidens subalternans DC. exposed to different environmental factors. PLoS ONE 2020, 15, e0233228. [Google Scholar] [CrossRef]
- Huang, Y.; Wu, W.; Zhao, T.; Lu, M.; Wu, H.; Cao, D. Drying temperature regulates seed vigor of high moisture rice seeds via involvement in phytohormone, ROS and relevant gene expression. J. Sci. Food Agric. 2020, 101, 2143–2155. [Google Scholar] [CrossRef]
- Wahid, A.; Gelani, S.; Ashraf, M.; Foolad, M. Heat tolerance in plants: An overview. Environ. Exp. Bot. 2007, 61, 199–223. [Google Scholar] [CrossRef]
- Suzuki, N.; Katano, K. Coordination Between ROS Regulatory Systems and Other Pathways Under Heat Stress and Pathogen Attack. Front. Plant Sci. 2018, 9, 490. [Google Scholar] [CrossRef]
- Wang, J.; He, X.; Zhou, J.; Guan, Z.; Zhang, F. Effects of exogenous glycine betaine on seed germination and seedling growth of alfalfa under drought stress. North. Hortic. 2022, 15, 51–57. [Google Scholar] [CrossRef]
- Tian, Y.; Gao, T.; Wang, X.; Luo, S.; Miao, Y. Effects of exogenous glycine betaine on seed germination of elymus nutans griseb under NaCl stress. J. Plateau Agric. 2022, 6, 1–10. [Google Scholar] [CrossRef]
- Li, T.B.; Yang, S.Q.; Ren, G.X.; Feng, Y.Z.; Zhang, Q.; Li, P. Comparison of physiological changes and cold resistance of different gramineous grasses under low temperature treatment. Acta Ecol. Sin. 2009, 29, 1341–1347. [Google Scholar] [CrossRef]
- Yang, Y.Y.; Chen, X.; Chen, Q.Z.; Lu, F.; Xu, C.; Yang, H.T.; Su, P.P.; Liu, X.L. Priming effects of abscisic acid on high temperature stress tolerance in rice at seed germination stage. Acta Agric. Boreali-Sin. 2021, 36, 185–194. [Google Scholar] [CrossRef]
- Teshome, S.; Kebede, M. Analysis of regulatory elements in GA2ox, GA3ox and GA20ox gene families in Arabidopsis thaliana: An important trait. Biotechnol. Biotec. Eq. 2021, 35, 1603–1612. [Google Scholar] [CrossRef]
- Qin, G.; Gu, H.; Zhao, Y.; Ma, Z.; Shi, G.; Yang, Y.; Pichersky, E.; Chen, H.; Liu, M.; Chen, Z.; et al. An indole-3-acetic acid carboxyl methyltransferase regulates Arabidopsis leaf development. Plant Cell 2005, 17, 2693–2704. [Google Scholar] [CrossRef] [PubMed]
- Gazzarrini, S.; Tsai, A.Y. Hormone cross-talk during seed germination. Essays Biochem. 2015, 58, 151–164. [Google Scholar] [CrossRef]
- Achard, P.; Cheng, H.; De Grauwe, L.; Decat, J.; Schoutteten, H.; Moritz, T.; Van Der Straeten, D.; Peng, J.; Harberd, N.P. Integration of plant responses to environmentally activated phytohormonal signals. Science 2006, 311, 91–94. [Google Scholar] [CrossRef]
- Fu, X.D.; Harberd, N.P. Auxin promotes Arabidopsis root growth by modulating gibberellin response. Nature 2003, 421, 740–743. [Google Scholar] [CrossRef]









| Gene Name | Gene ID | Forward Primer | Reverse Primer |
|---|---|---|---|
| Os11g32520 | AP014967 | TCGTCCCCGTCATGAACAAG | GAAGTGGCGGCTCTTGTAGT |
| Os05g42150 | AK101932 | CCACCTACTTCAGCCCCAAG | GCCAAGCTATCACAGGTCGT |
| Os06g45950 | XM_015786598 | ATGAAGCGTCTCCTCAGGC | GAGGGAGGAGGAGGAGGAC |
| Os01g62460 | XM_015763808 | ATGGTCATGGATGCTGGGGT | CCGTCGCGAACCCATTGG |
| Os01g55240 | XM_015793860 | CGGGTTCTTCAAGGTCGTCA | ATGTCGCCATTGAACCCGAT |
| Os05g46040 | XM_015784016 | CATGTGGTGGTTGCCAACTG | TTCAATCCTTGCCCGCTCAT |
| Os03g44380 | XM_015776052 | GTGGTGCTCGACAAGGAGAA | CAGAGGTGGAAGCAGAAGCA |
| Os02g47470 | AB277270 | CCTCGCAACCAAGTACAGGT | ACTCCTGCTCGGTGTTCTTG |
| Os03g49630 | XM_015774845 | AGAAAGCGATGCCCTCCAAA | CCCTCGGCATGCACTATCAT |
| Sample | Total Raw Reads (Mil.) | Total Clean Reads (Mil.) | Total Clean Bases (Gb) | Clean Reads Q20 (%) | Clean Reads Q30 (%) | Clean Reads Ratio (%) |
|---|---|---|---|---|---|---|
| HT1 | 49.08 | 45.37 | 6.81 | 96.97 | 89.08 | 92.45 |
| HT2 | 49.08 | 45.2 | 6.78 | 97.14 | 89.56 | 92.10 |
| HT3 | 49.08 | 45.05 | 6.76 | 97.08 | 89.46 | 91.80 |
| HT + BT1 | 47.33 | 44.39 | 6.66 | 97.08 | 89.14 | 93.79 |
| HT + BT2 | 44.19 | 41.11 | 6.17 | 97.11 | 89.40 | 93.03 |
| HT + BT3 | 47.33 | 43.94 | 6.59 | 97.16 | 89.48 | 92.84 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mo, X.; Qian, J.; Liu, P.; Zeng, H.; Chen, G.; Wang, Y. Exogenous Betaine Enhances the Protrusion Vigor of Rice Seeds under Heat Stress by Regulating Plant Hormone Signal Transduction and Its Interaction Network. Antioxidants 2022, 11, 1792. https://doi.org/10.3390/antiox11091792
Mo X, Qian J, Liu P, Zeng H, Chen G, Wang Y. Exogenous Betaine Enhances the Protrusion Vigor of Rice Seeds under Heat Stress by Regulating Plant Hormone Signal Transduction and Its Interaction Network. Antioxidants. 2022; 11(9):1792. https://doi.org/10.3390/antiox11091792
Chicago/Turabian StyleMo, Xu, Jingya Qian, Peng Liu, Hongli Zeng, Guanghui Chen, and Yue Wang. 2022. "Exogenous Betaine Enhances the Protrusion Vigor of Rice Seeds under Heat Stress by Regulating Plant Hormone Signal Transduction and Its Interaction Network" Antioxidants 11, no. 9: 1792. https://doi.org/10.3390/antiox11091792
APA StyleMo, X., Qian, J., Liu, P., Zeng, H., Chen, G., & Wang, Y. (2022). Exogenous Betaine Enhances the Protrusion Vigor of Rice Seeds under Heat Stress by Regulating Plant Hormone Signal Transduction and Its Interaction Network. Antioxidants, 11(9), 1792. https://doi.org/10.3390/antiox11091792
