The Protective Effect of Mulberry Leaf Flavonoids on High-Carbohydrate-Induced Liver Oxidative Stress, Inflammatory Response and Intestinal Microbiota Disturbance in Monopterus albus
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals, Experimental Design, Diet Preparation and Culture Conditions
2.2. Sample Collection
2.3. Chemical Analysis
2.4. Serum Biochemical Indices Analysis
2.5. Liver Glucose Metabolism and Antioxidant Indices Analysis
2.6. Total RNA Extraction, Reverse Transcription and Real-Time PCR
2.7. Intestinal Microbiota Analysis
2.8. Statistical Analysis
3. Results
3.1. Growth and Morphology Parameters
3.2. Serum Biochemical Indices
3.3. Carbohydrate Metabolism Enzyme Activity
3.4. Genes Expression of Carbohydrate Metabolism
3.5. Antioxidant Indices in the Liver
3.6. Genes Expression of Liver Antioxidant
3.7. Gene Expression Related to the Liver Damage
3.8. Intestinal Microbiota Analysis
3.8.1. Diversity Analysis
3.8.2. Microbial Composition
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
References
- FAO. The State of World Fisheries and Aquaculture (SOFIA); Food and Agriculture Organization of the United Nations: Rome, Italy, 2018. [Google Scholar]
- Hatlen, B.; Grisdale-Helland, B.; Helland, S.J. Growth, feed utilization and body composition in two size groups of Atlantic halibut (Hippoglossus hippoglossus) fed diets differing in protein and carbohydrate content. Aquaculture 2005, 249, 401–408. [Google Scholar] [CrossRef] [Scilit]
- Asaduzzaman, M.; Wahab, M.; Verdegem, M.; Adhikary, R.; Rahman, S.; Azim, M.; Verreth, J.A.J. Effects of carbohydrate source for maintaining a high C: N ratio and fish driven re-suspension on pond ecology and production in periphyton-based freshwater prawn culture systems. Aquaculture 2010, 301, 37–46. [Google Scholar] [CrossRef] [Scilit]
- Stone, D.A.J. Dietary carbohydrate utilization by fish. Rev. Fish. Sci. 2003, 11, 337–369. [Google Scholar] [CrossRef] [Scilit]
- Kamalam, B.S.; Medale, F.; Panserat, S. Utilisation of dietary carbohydrates in farmed fishe: New insights on influencing factors, biological limitations and future strategies. Aquaculture 2017, 467, 3–27. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Q.; Chen, Y.; Xu, W.; Zhang, Y. Effects of dietary carbohydrate level on growth performance, innate immunity, antioxidant ability and hypoxia resistant of brook trout Salvelinus fontinalis. Aquac. Nutr. 2021, 27, 297–311. [Google Scholar] [CrossRef] [Scilit]
- Ren, M.; Ai, Q.; Mai, K.; Ma, H.; Wang, X. Effect of dietary carbohydrate level on growth performance, body composition, apparent digestibility coefficient and digestive enzyme activities of juvenile cobia, Rachycentron canadum L. Aquacult. Res. 2011, 42, 1467–1475. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.; Xie, S.; Wei, H.; Zheng, L.; Liu, Z.; Fang, H.; Xie, J.; Liao, S.; Tian, L.; Liu, H.; et al. High dietary starch impaired growth performance, liver histology and hepatic glucose metabolism of juvenile largemouth bass, Micropterus salmoides. Aquac. Nutr. 2020, 26, 1083–1095. [Google Scholar] [CrossRef] [Scilit]
- Liu, D.; Zhang, Y.; Pan, M.; Yang, M.; Li, X.; Fu, Y.; Gao, W.; Zhang, W.; Mai, K. Interactive effects of dietary biotin and carbohydrate on growth performance and glucose metabolism in juvenile turbot Scophthalmus maximus L. Aquaculture 2021, 540, 736752. [Google Scholar] [CrossRef] [Scilit]
- Liu, Y.; Liu, N.; Wang, A.; Chen, N.; Li, S. Resveratrol inclusion alleviated high-dietary-carbohydrate-induced glycogen deposition and immune response of largemouth bass, Micropterus salmoides. Br. J. Nutr. 2022, 127, 165–176. [Google Scholar] [CrossRef] [Scilit]
- Ma, H.J.; Mou, M.M.; Pu, D.C.; Lin, S.M.; Chen, Y.J.; Luo, L. Effect of dietary starch level on growth, metabolism enzyme and oxidative status of juvenile largemouth bass, Micropterus salmoides. Aquaculture 2019, 498, 482–487. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.; Liang, X.F.; He, S.; Chen, X.; Wang, J.; Li, J.; Zhu, Q.; Zhang, Z.; Li, L.; Alam, M.S. Effects of high carbohydrate diet-modulated microbiota on gut health in Chinese Perch. Front. Microbiol. 2020, 11, 575102. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lim, S.H.; Choi, C.I. Pharmacological properties of Morusnigra L. (Black Mulberry) as a promising nutraceutical resource. Nutrients 2019, 11, 437. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wen, P.; Hu, T.; Linhardt, R.J.; Liao, S.; Wu, H.; Zou, Y. Mulberry: A review of bioactive compounds and advanced processing technology. Trends. Food. Sci. Technol. 2019, 83, 138–158. [Google Scholar] [CrossRef] [Scilit]
- Sarkhel, S. Nutrition importance and health benefits of mulberry leaf extract: A review. J. Pharmacog. Phytochem. 2020, 9, 689–695. [Google Scholar]
- Peng, C.H.; Lin, H.T.; Chung, D.J.; Huang, C.N.; Wang, C.J. Mulberry Leaf extracts prevent obesity-induced NAFLD with regulating adipocytokines, inflammation and oxidative stress. J. Food Drug Anal. 2018, 26, 778–787. [Google Scholar] [CrossRef] [Scilit]
- Zhao, X.; Li, L.; Luo, Q.; Ye, M.; Luo, G.; Kuang, Z. Effects of mulberry (Morusalba L.) leaf polysaccharides on growth performance, diarrhea, blood parameters, and gut microbiota of early-weanling pigs. Livest. Sci. 2015, 177, 88–94. [Google Scholar] [CrossRef] [Scilit]
- Fan, L.; Peng, Y.; Wu, D.; Hu, J.; Shi, X.; Yang, G.; Li, X. Dietary supplementation of Morus nigra L. leaves decrease fat mass partially through elevating leptin-stimulated lipolysis in pig model. J. Ethnopharmacol. 2020, 249, 112416. [Google Scholar] [CrossRef] [Scilit]
- Simol, C.F.; Tuen, A.A.; Khan, H.H.A.; Chubo, J.K.; King, P.J.H.; Ong, K.H. Performance of chicken broilers fed with diets substituted with mulberry leaf powder. Afr. J. Biotechnol. 2012, 11, 16106–16111. [Google Scholar]
- Zhu, W.; Xiao, S.; Chen, S.; Xu, Q.; Yang, Z.; Liu, J.; Lan, S. Effects of fermented mulberry leaves on growth, serum antioxidant capacity, digestive enzyme activities and microbial compositions of the intestine in crucian (Carassius carassius). Aquac. Res. 2021, 52, 6356–6366. [Google Scholar] [CrossRef] [Scilit]
- Xv, Z.C.; He, G.L.; Wang, X.; Shun, H.; Chen, Y.J.; Lin, S.M. Mulberry leaf powder ameliorate high starch-induced hepatic oxidative stress and inflammation in fish model. Anim. Feed Sci. Technol. 2021, 278, 115012. [Google Scholar] [CrossRef] [Scilit]
- Meng, Q.; Qi, X.; Fu, Y.; Chen, Q.; Cheng, P.; Yu, X.; Sun, X.; Wu, J.; Li, W.; Zhang, Q.; et al. Flavonoids extracted from mulberry (Morus alba L.) leaf improve skeletal muscle mitochondrial function by activating AMPK in type 2 diabetes. J. Ethnopharmacol. 2020, 248, 112326. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, L.; Su, S.; Zhu, Y.; Guo, J.; Guo, S.; Qian, D.; Ouyuan, Z.; Duan, J. Mulberry leaf active components alleviate type 2 diabetes and its liver and kidney injury in db/db mice through insulin receptor and TGF-β/Smads signaling pathway. Biomed. Pharmacother. 2019, 112, 108675. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhong, Y.; Song, B.; Zheng, C.; Zhang, S.; Yan, Z.; Tang, Z.; Kang, X.; Duan, Y.; Li, F. Flavonoids from mulberry leaves alleviate lipid dysmetabolism in high fat diet-fed mice: Involvement of gut microbiota. Microorganisms 2020, 8, 860. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, J.; Chen, B.; Huang, Y.; Cao, J.; Wang, G.; Sun, Y.; Chen, X. Effects of dietary mulberry leaf flavonoids on growth performance, body composition, antioxidant indices and resistance to nitrite exposure of genetic improvement of farmed Tilapia (Oreochromis niloticus). Chin. J. Anim. Nutr. 2017, 29, 3403–3412. [Google Scholar]
- Wang, Y.; Chen, B.; Cao, J.; Huang, Y.; Wang, G.; Peng, K. Effects of mulberry leaf flavonoids on intestinal mucosal morphology and intestinal flora of Litopenaeus vannamei. Chin. J. Anim. Nutr. 2020, 32, 1817–1825. [Google Scholar]
- Yang, D.; Chen, F.; Li, D.; Liu, B. Requirements of nutrients and optimum energy protein ratio in the diet for Monoterus albus. J. Fish. China 2000, 3, 259–262. [Google Scholar]
- Shi, Y.; Zhong, L.; Ma, X.; Liu, Y.; Tang, T.; Hu, Y. Effect of replacing fishmeal with stickwater hydrolysate on the growth, serum biochemical indexes, immune indexes, intestinal histology and microbiota of rice field eel (Monopterus albus). Aquac. Rep. 2019, 15, 100223. [Google Scholar] [CrossRef] [Scilit]
- Shi, Y.; Zhong, L.; Zhong, H.; Zhang, J.; Che, C.; Fu, G.; Hu, Y.; Mai, K. Taurine supplements in high-fat diets improve survival of juvenile Monopterus albus by reducing lipid deposition and intestinal damage. Aquaculture 2022, 547, 737431. [Google Scholar] [CrossRef] [Scilit]
- Shi, Y.; Zhong, L.; Zhong, H.; Zhang, J.; Liu, X.; Peng, M.; Fu, G.; Hu, Y. Taurine supplements in high-carbohydrate diets increase growth performance of Monopterus albus by improving carbohydrate and lipid metabolism, reducing liver damage, and regulating intestinal microbiota. Aquaculture 2022, 554, 738150. [Google Scholar] [CrossRef] [Scilit]
- Shi, Y.; Zhong, L.; Liu, Y.L.; Zhang, J.Z.; Lv, Z.; Li, Y.; Hu, Y. Effects of dietary andrographolide levels on growth performance, antioxidant capacity, intestinal immune function and microbioma of rice field eel (Monopterus albus). Animals 2020, 10, 1744. [Google Scholar] [CrossRef] [Scilit]
- Livak, K.J.; Schmittgen, T.D. Schmittgen, Analysis of relative gene expression data using Real-Time Quantitative PCR and the 2−△△CT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hu, Q.; Guo, W.; Gao, Y.; Tang, R.; Li, D. Reference gene selection for real-time RT-PCR normalization in rice field eel (Monopterus albus) during gonad development. Fish Physiol. Biochem. 2014, 40, 1721–1730. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Callahan, B.J.; Mcmurdie, P.J.; Rosen, M.J.; Han, A.W.; Johnson, A.J.; Holmes, S.P. Dada2: High-resolution sample inference from illumina amplicon data. Nat. Methods 2016, 13, 581–583. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Susanto, A.; Hutabarat, J.; Anggoro, S. The effects of dietary carbohydrate level on the growth performance, body composition and feed utilization of juvenile kelabau (Osteochilus melanopleurus). Aquac. Aquar. Conserv. Legis. 2020, 13, 2061–2070. [Google Scholar]
- Peng, K.; Wang, G.; Zhao, H.; Wang, Y.; Mo, W.; Wu, H.; Huang, Y. Effect of high level of carbohydrate and supplementation of condensed tannins on growth performance, serum metabolites, antioxidant and immune response, and hepatic glycometabolism gene expression of Lateolabrax japonicus. Aquac. Rep. 2020, 18, 100515. [Google Scholar] [CrossRef] [Scilit]
- Li, S.; Li, Z.; Zhang, J.; Sang, C.; Chen, N. The impacts of dietary carbohydrate levels on growth performance, feed utilization, glycogen accumulation and hepatic glucose metabolism in hybrid grouper (Epinephelus fuscoguttatus ♀ × E. lanceolatus ♂). Aquaculture 2019, 512, 734351. [Google Scholar] [CrossRef] [Scilit]
- Lin, S.M.; Shi, C.M.; Mu, M.M.; Chen, Y.J.; Luo, L. Effect of high dietary starch levels on growth, hepatic glucose metabolism, oxidative status and immune response of juvenile largemouth bass, Micropterus salmoides. Fish Shellfish Immunol. 2018, 78, 121–126. [Google Scholar] [CrossRef] [Scilit]
- Qi, S.; Wang, T.; Chen, R.; Wang, C.; Ao, C. Effects of flavonoids from Allium mongolicum Regel on growth performance and growthrelated hormones in meat sheep. Anim. Nutr. 2017, 3, 33–38. [Google Scholar]
- Li, M.; Zhu, X.; Tian, J.; Liu, M.; Wang, G. Dietary flavonoids from Allium mongolicum Regel promotes growth, improves immune, antioxidant status, immune-related signaling molecules and disease resistance in juvenile northern snakehead fish (Channa argus). Aquaculture 2019, 501, 473–481. [Google Scholar] [CrossRef] [Scilit]
- Xu, R.; Li, M.; Wang, T.; Zhao, Y.W.; Shan, C.J.; Qiao, F.; Chen, L.Q.; Zhang, W.B.; Du, Z.Y.; Zhang, M.L. Bacillus amyloliquefaciens ameliorates high-carbohydrate diet-induced metabolic phenotypes by restoration of intestinal acetate-producing bacteria in Nile Tilapia. Br. J. Nutr. 2022, 127, 653–665. [Google Scholar] [CrossRef] [Scilit]
- Enes, P.; Panserat, S.; Kaushik, S.; Oliva-Teles, A. Nutritional regulation of hepatic glucose metabolism in fish. Fish. Physiol. Biochem. 2009, 35, 519–539. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Han, M.; Cao, X.; Zhao, C.; Yang, L.; Yin, N.; Shen, P.; Zhang, J.; Gao, F.; Ren, Y.; Liang, D.; et al. Assessment of glycometabolism impairment and glucose variability using flash glucose monitoring system in patients with adrenal diseases. Front. Endocrinol. 2020, 11, 544752. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, J.Y.; Ok, H.M.; Kim, J.; Park, S.W.; Kwon, S.W.; Kwon, O. Mulberry leaf extract improves postprandial glucose response in prediabetic subjects: A randomized, double-blind placebo-controlled trial. J. Med. Food. 2015, 18, 306–313. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ren, C.; Zhang, Y.; Cui, W.; Lu, G.; Wang, Y.; Gao, H.; Huang, L.; Mu, Z. A polysaccharide extract of mulberry leaf ameliorates hepatic glucose metabolism and insulin signaling in rats with type 2 diabetes induced by high fat-diet and streptozotocin. Int. J. Biol. Macromol. 2015, 72, 951–959. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cross, D.A.; Alessi, D.R.; Cohen, P.; Andjelkovich, M.; Hemmings, B.A. Inhibition of glycogen synthase kinase-3 by insulin mediated by protein kinase B. Nature 1995, 378, 785–789. [Google Scholar] [CrossRef] [Scilit]
- Zhou, C.P.; Ge, X.P.; Liu, B.; Xie, J.; Miao, L.H. Effect of high dietary carbohydrate on the growth performance and physiological responses of juvenile Wuchang bream, Megalobrama amblycephala. Asian Australas. J. Anim. Sci. 2013, 26, 1598–1608. [Google Scholar] [CrossRef] [Scilit]
- Xu, X.; Chen, N.; Liu, Z.; Gou, S.; Yin, J. Effects of dietary starch sources and levels on liver histology in largemouth bass, Micropterus salmoides. J. Shanghai Ocean Univ. 2016, 25, 61–70. [Google Scholar]
- Dinu, D.; Marinescu, D.; Munteanu, M.C.; Staicu, A.C.; Costache, M.; Dinischiotu, A. Modulatory effects of deltamethrin on antioxidant defense mechanisms and lipid peroxidation in Carassius auratus gibelio liver and intestine. Arch. Environ. Contam. Toxicol. 2010, 58, 757–764. [Google Scholar] [CrossRef] [Scilit]
- Ramalingam, M.; Kim, S.J. Reactive oxygen/nitrogen species and their functional correlations in neurodegenerative diseases. J. Neural Transm. 2012, 119, 891–910. [Google Scholar] [CrossRef] [Scilit]
- Sies, H. Oxidative stress: From basic research to clinical application. Am. J. Med. 1991, 91, 31–38. [Google Scholar] [CrossRef] [Scilit]
- Mehra, L.; Hasija, Y.; Mittal, G. Therapeutic potential of alpha-ketoglutarate against acetaminophen-induced hepatotoxicity in rats. J. Pharm. Bioallied Sci. 2016, 8, 296–299. [Google Scholar] [PubMed]
- Rymuszka, A.; Adaszek, Ł. Pro- and anti-inflammatory cytokine expression in carp blood and head kidney leukocytes exposed to cyanotoxin stress-an in vitro study. Fish Shellfish Immunol. 2012, 33, 382–388. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cao, G.; Sofic, E.; Prior, R.L. Antioxidant and prooxidant behavior of flavonoids: Structure-activity relationships. Free Radic. Biol. Med. 1997, 22, 749–760. [Google Scholar] [CrossRef] [Scilit]
- Liskova, A.; Samec, M.; Koklesova, L.; Samuel, S.M.; Zhai, K.; Al-Ishaq, R.K.; Abotaleb, M.; Nosal, V.; Kajo, K.; Ashrafizadeh, M.; et al. Flavonoids against the SARS-CoV-2 induced inflammatory storm. Biomed. Pharmacother. 2021, 138, 111430. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhao, L.; Yuan, B.D.; Zhao, J.L.; Jiang, N.; Zhang, A.Z.; Wang, G.Q.; Li, M.Y. Amelioration of hexavalent chromium-induced bioaccumulation, oxidative stress, tight junction proteins and immune-related signaling factors by Allium mongolicum Regel flavonoids in Ctenopharyngodon idella. Fish Shellfish Immunol. 2020, 106, 993–1003. [Google Scholar] [CrossRef] [Scilit]
- Li, M.Y.; Guo, W.Q.; Guo, G.L.; Zhu, X.M.; Niu, X.T.; Shan, X.F.; Tian, J.X.; Wang, G.Q.; Zhang, D.M. Effect of sub-chronic exposure to selenium and Allium mongolicum Regel flavonoids on Channa argus: Bioaccumulation, oxidative stress, immune responses and immune-related signaling molecules. Fish Shellfish Immunol. 2019, 91, 122–129. [Google Scholar] [CrossRef] [Scilit]
- Banjarnahor, S.D.S.; Artanti, N. Antioxidant properties of flavonoids. Med. J. Indones. 2015, 23, 239–244. [Google Scholar] [CrossRef] [Scilit]
- Shi, Y.; Hu, Y.; Wang, Z.; Zhou, J.; Zhang, J.; Zhong, H.; Fu, G.; Zhong, L. The protective effect of taurine on oxidized fish-oil-induced liver oxidative stress and intestinal barrier-function impairment in juvenile Ictalurus punctatus. Antioxidants 2021, 10, 1690. [Google Scholar] [CrossRef] [Scilit]
- Xu, C.; Liu, W.B.; Remø, S.C.; Wang, B.K.; Shi, H.J.; Zhang, L.; Liu, J.D.; Li, X.F. Feeding restriction alleviates high carbohydrate diet-induced oxidative stress and inflammation of Megalobrama amblycephala by activating the AMPK-SIRT1 pathway. Fish Shellfish Immunol. 2019, 92, 637–648. [Google Scholar] [CrossRef] [Scilit]
- Jung, K.A.; Kwak, M.K. The Nrf2 system as a potential target for the development of indirect antioxidants. Molecules 2010, 15, 7266–7291. [Google Scholar] [CrossRef] [Scilit]
- Baraka, S.M.; Saleh, D.O.; Ghaly, N.S.; Melek, F.R.; El Din, A.A.G.; Khalil, W.K.B.; Said, M.M.; Medhat, A.M. Flavonoids from Barnebydendron riedelii leaf extract mitigate thioacetamide-induced hepatic encephalopathy in rats: The interplay of NF-κB/IL-6 and Nrf2/HO-1 signaling pathways. Bioorg. Chem. 2020, 105, 104444. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Goya, L.; Sarriá, B.; Ramos, S.; Mateos, R.; Bravo, L. Effect of cocoa and its flavonoids on biomarkers of inflammation: Studies of cell culture, animals and humans. Nutrients 2016, 8, 212. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fan, Y.; Pedersen, O. Gut microbiota in human metabolic health and disease. Nat. Rev. Microbiol. 2021, 19, 55–71. [Google Scholar] [CrossRef] [Scilit]
- Wastyk, H.C.; Fragiadakis, G.K.; Perelman, D.; Dahan, D.; Merrill, B.D.; Yu, F.B.; Topf, M.; Gonzalez, C.G.; Treuren, W.V.; Han, S.; et al. Gut-microbiota-targeted diets modulate human immune status. Cell 2021, 184, 4137–4153. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hamer, H.M.; Jonkers, D.; Venema, K.; Vanhoutvin, S.; Troost, F.; Brummer, R. The role of butyrate on colonic function. Aliment. Pharmcol. Ther. 2008, 27, 104–119. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hong, J.; Jia, Y.; Pan, S.; Jia, L.; Li, H.; Han, Z.; Cai, D.; Zhan, R. Butyrate alleviates high fat diet-induced obesity through activation of adiponectin-mediated pathway and stimulation of mitochondrial function in the skeletal muscle of mice. Oncotarget 2016, 7, 56071–56082. [Google Scholar] [CrossRef] [Scilit]
- Aalamifar, H.; Soltanian, S.; Vazirzadeh, A.; Akhlaghi, M.; Morshedi, V.; Gholamhosseini, A.; Torfi Mozanzadeh, M. Dietary butyric acid improved growth, digestive enzyme activities and humoral immune parameters in Barramundi (Lates calcarifer). Aquac. Nutr. 2020, 26, 156–164. [Google Scholar] [CrossRef] [Scilit]
- Teuber, M. The genus Lactococcus. In The Genera of Lactic Acid Bacteria; Springer: Boston, MA, USA, 1995; Volume 2, pp. 173–234. [Google Scholar]
- Vendrell, D.; Balcázar, J.L.; Ruiz-Zarzuela, I.; de Blas, I.; Gironés, O.; Múzquiz, J.L. Lactococcus garvieae in fish: A review. Comp. Immunol. Microbiol. Infect. Dis. 2006, 29, 177–198. [Google Scholar] [CrossRef] [Scilit]
- Hage-Hülsmann, J.; Klaus, O.; Linke, K.; Troost, K.; Gora, L.; Hilgers, F.; Wirtz, A.; Santiago-Schübel, B.; Loeschcke, A.; Karl-Erich Jaeger, K.E.; et al. Production of C20, C30 and C40 terpenes in the engineered phototrophic bacterium Rhodobacter capsulatus. J. Biotechnol. 2021, 338, 20–30. [Google Scholar] [CrossRef] [Scilit]
- Murota, K.; Nakamura, Y.; Uehara, M. Flavonoid metabolism: The interaction of metabolites and gut microbiota. Biosci. Biotechnol. Biochem. 2018, 82, 600–610. [Google Scholar] [CrossRef] [Scilit]
- Song, D.; Ho, C.T.; Zhang, X.; Wu, Z.; Cao, J. Modulatory effect of Cyclocarya paliurus flavonoids on the intestinal microbiota and liver clock genes of circadian rhythm disorder mice model. Food Res. Int. 2020, 138, 109769. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bi, Y.; Yang, C.; Diao, Q.; Tu, Y. Effects of dietary supplementation with two alternatives to antibiotics on intestinal microbiota of preweaned calves challenged with Escherichia coli K99. Sci. Rep. 2017, 7, 5439. [Google Scholar] [CrossRef] [Scilit] [PubMed]








| Ingredients | CON | HC | HCF1 | HCF2 | HCF3 |
|---|---|---|---|---|---|
| Fish meal a | 40.00 | 40.00 | 40.00 | 40.00 | 40.00 |
| Wheat gluten a | 14.46 | 14.46 | 14.46 | 14.46 | 14.46 |
| Corn starch a | 20.00 | 40.00 | 40.00 | 40.00 | 40.00 |
| Microcrystalline cellulose a | 20.50 | 0.50 | 0.49 | 0.48 | 0.47 |
| Fish oil a | 2.00 | 2.00 | 2.00 | 2.00 | 2.00 |
| Choline a | 0.50 | 0.50 | 0.50 | 0.50 | 0.50 |
| Premix b | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 |
| Ca(H2PO4)2 a | 1.50 | 1.50 | 1.50 | 1.50 | 1.50 |
| Antioxidants a | 0.01 | 0.01 | 0.01 | 0.01 | 0.01 |
| Mold inhibitor a | 0.03 | 0.03 | 0.03 | 0.03 | 0.03 |
| Mulberry leaf flavonoids c | 0.00 | 0.00 | 0.01 | 0.02 | 0.03 |
| Proximate composition (%) | |||||
| Crude protein | 43.86 | 43.72 | 44.04 | 43.87 | 43.79 |
| Crude lipid | 5.86 | 5.93 | 5.82 | 5.79 | 5.87 |
| Ash | 10.85 | 11.03 | 10.94 | 10.72 | 10.83 |
| Gene | Forward Sequences (5′→3′) | Reverse Sequences (5′→3′) | Accession No. |
|---|---|---|---|
| gk | AAGCCATCGTATCCCACC | GGGTCCCAGTCCATAGTGT | XM_020620531.1 |
| pk | CCGCCAAGGGACTGTTT | CCACTGGTGGTAAGGACTATG | XM_020617665.1 |
| fpk | AGCATAGGAGCAGACACCG | CACAGAATCCACCCATAGTC | XM_020594803.1 |
| g6pd | CCACCCACTGTCTACCA | GGCTCTGCACCATTTCT | XM_020610610.1 |
| pepck | CTGTGACGGCTCTGACG | ATACATGGTGCGACCTTTC | XM_020621224.1 |
| g6pase | GGTATGAGGGTCTGTTTAGC | GACAGCCACCCAGATGA | XM_020616553.1 |
| fbpase | GCTGCGGTTGCTGTATG | TTCTTGGCGTGTTTATGG | XM_020585913.1 |
| gsk3β | GGTGTTGTCTACCAGGCTAA | CAATGGTCCAACTTCCTCA | XM_020609458.1 |
| gys | CGGCTGCCAGGTTTATT | GCCCAGGATGAGCGAGT | XM_020608327.1 |
| nrf2 | CTTCAGACAGCGGTGACAGG | GCCTCATTCAGTTGGTGCTT | XM_020596409.1 |
| keap1 | AGCCTGGGTGCGATACGA | CAAGAAATGACTTTGGTGGG | XM_020597068.1 |
| sod | AGCTGGCTAAGTTCTCATTCAC | GCAGTAACATTGCCCAAGTCT | XM_020598413.1 |
| cat | GTCCAAGTCTAAGGCATCTCC | CTCCTCTTCGTTCAGCACC | XM_020624985.1 |
| gpx1 | GTTCACCGCCAAACTCTT | TTCCCATTCACATCTACCTT | XM_020607739.1 |
| gpx8 | GTCCACTTACGGTGTTACCT | ATGGGCTCGTCAGTTCTC | XM_020593975.1 |
| il-1β | GAGATGTGGAGCCCAAACTT | CTGCCTCTGACCTTCTGGACTT | KM113037.1 |
| il-8 | TACTGGTTCTGCTTACTGTCGC | CAAATCTTTTGCCCATCCCT | XM_020597077.1 |
| il-12β | CAAGTCAGTTGCCAAAATCC | CCAAGCAGCTCAGGGTCT | XM_020594580.1 |
| il-10 | TTTGCCTGCCAAGTTATGAG | CATTTGGTGACATCGCTCTT | XM_020593225.1 |
| tgf-β1 | AACCCACTACCTCACTACCCG | GCCGAAGTTGGAAACCCT | XM_020605575.1 |
| nf-κb | ACCCTACCGTGACACTAACCT | TGCCGTCTATCTTGTGGAAT | XM_020616319.1 |
| tlr-3 | TATTTAGAGCCATACAGGG | CACAATCAAGAACGCACA | XM_020614353.1 |
| tlr-7 | ATCCTCACGACTTCCCTC | TTTCTTTCATCACCCACT | XM_020596482.1 |
| rpl-17 | GTTGTAGCGACGGAAAGGGAC | GACTAAATCATGCAAGTCGAGGG | 109952565 |
| CON | HC | HCF1 | HCF2 | HCF3 | p-Value | |
|---|---|---|---|---|---|---|
| Initial weight (g) | 14.96 ± 0.12 | 14.97 ± 0.24 | 15.11 ± 0.12 | 14.96 ± 0.02 | 15.01 ± 0.03 | 0.919 |
| Final weight (g) | 36.56 ± 0.94 | 33.08 ± 1.02 | 34.96 ± 0.60 | 35.58 ± 1.50 | 37.13 ± 0.70 | 0.112 |
| WGR | 144.26 ± 4.47 a | 120.92 ± 3.27 b | 131.41 ± 3.57 ab | 137.82 ± 9.71 ab | 147.37 ± 4.24 a | 0.046 |
| SR | 91.11 ± 2.78 a | 77.78 ± 3.38 b | 77.22 ± 2.00 b | 81.66 ± 3.33 ab | 88.33 ± 2.89 a | 0.023 |
| FCR | 1.39 ± 0.06 | 1.67 ± 0.07 | 1.52 ± 0.04 | 1.47 ± 0.10 | 1.36 ± 0.04 | 0.051 |
| HSI | 3.44 ± 0.15 ab | 3.92 ± 0.07 a | 3.63 ± 0.08 ab | 3.49 ± 0.13 ab | 3.32 ± 0.24 b | 0.048 |
| VSI | 15.73 ± 0.71 | 17.22 ± 0.81 | 18.00 ± 1.28 | 15.65 ± 1.88 | 17.68 ± 1.07 | 0.533 |
| CF | 9.00 ± 0.32 | 10.20 ± 0.49 | 9.80 ± 0.66 | 10.00 ± 0.32 | 10.00 ± 0.55 | 0.465 |
| CON | HC | HCF1 | HCF2 | HCF3 | p-Value | |
|---|---|---|---|---|---|---|
| AST (U/L) | 3.45 ± 0.09 d | 7.86 ± 0.26 a | 3.68 ± 0.04 d | 5.47 ± 0.23 b | 4.90 ± 0.10 c | <0.001 |
| ALT (U/L) | 3.75 ± 0.07 c | 9.18 ± 0.41 a | 4.21 ± 0.28 bc | 4.44 ± 0.2 bc | 4.99 ± 0.31 b | <0.001 |
| GLU (mg/dL) | 38.72 ± 1.31 c | 51.96 ± 1.88 a | 42.11 ± 1.74 bc | 43.71 ± 0.91 b | 40.52 ± 0.80 bc | <0.001 |
| TG (mmol/L) | 0.40 ± 0.01 b | 0.56 ± 0.01 a | 0.40 ± 0.00 b | 0.39 ± 0.00 b | 0.41 ± 0.01 b | <0.001 |
| TC (mmol/L) | 2.72 ± 0.03 b | 3.16 ± 0.07 a | 2.34 ± 0.04 c | 2.44 ± 0.08 c | 2.36 ± 0.09 c | <0.001 |
| LDL-C (mmol/L) | 3.22 ± 0.03 b | 6.30 ± 0.42 a | 3.31 ± 0.27 b | 2.74 ± 0.27 b | 2.86 ± 0.16 b | <0.001 |
| HDL-C (mmol/L) | 3.00 ± 0.01 b | 3.08 ± 0.05 b | 3.40 ± 0.05 b | 4.49 ± 0.09 a | 4.28±0.31 a | <0.001 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Shi, Y.; Zhong, L.; Fan, Y.; Zhang, J.; Zhong, H.; Liu, X.; Shao, C.; Hu, Y. The Protective Effect of Mulberry Leaf Flavonoids on High-Carbohydrate-Induced Liver Oxidative Stress, Inflammatory Response and Intestinal Microbiota Disturbance in Monopterus albus. Antioxidants 2022, 11, 976. https://doi.org/10.3390/antiox11050976
Shi Y, Zhong L, Fan Y, Zhang J, Zhong H, Liu X, Shao C, Hu Y. The Protective Effect of Mulberry Leaf Flavonoids on High-Carbohydrate-Induced Liver Oxidative Stress, Inflammatory Response and Intestinal Microbiota Disturbance in Monopterus albus. Antioxidants. 2022; 11(5):976. https://doi.org/10.3390/antiox11050976
Chicago/Turabian StyleShi, Yong, Lei Zhong, Yuding Fan, Junzhi Zhang, Huan Zhong, Xiang Liu, Chuang Shao, and Yi Hu. 2022. "The Protective Effect of Mulberry Leaf Flavonoids on High-Carbohydrate-Induced Liver Oxidative Stress, Inflammatory Response and Intestinal Microbiota Disturbance in Monopterus albus" Antioxidants 11, no. 5: 976. https://doi.org/10.3390/antiox11050976
APA StyleShi, Y., Zhong, L., Fan, Y., Zhang, J., Zhong, H., Liu, X., Shao, C., & Hu, Y. (2022). The Protective Effect of Mulberry Leaf Flavonoids on High-Carbohydrate-Induced Liver Oxidative Stress, Inflammatory Response and Intestinal Microbiota Disturbance in Monopterus albus. Antioxidants, 11(5), 976. https://doi.org/10.3390/antiox11050976

