Cardiac NF-κB Acetylation Increases While Nrf2-Related Gene Expression and Mitochondrial Activity Are Impaired during the Progression of Diabetes in UCD-T2DM Rats
Abstract
1. Introduction
2. Methods
2.1. Animals
2.2. Western Blot Analyses
2.3. Real-Time Quantitative PCR Analyses
2.4. Biochemical Analyses
2.5. Statistics
3. Results
3.1. Body Mass, Glucose, and Insulin Measurements
3.2. Cardiac NF-κB Signaling Is Increased in UCD-T2DM Rats as Diabetes Progresses
3.3. NF-κB Associated Inflammatory Genes Increase as T2DM Progresses
3.4. Nrf2 Signaling Is Impaired or Unresponsive in UCD-T2DM Hearts
3.5. Nrf2 Related Genes Are Unaltered or Reduced as T2DM Progresses
3.6. UCD-T2DM Rats Have Mitochondrial Dysfunction and Increased Mitochondrial Damage Consistent with T2DM Pathology
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Ethics Approval and Consent to Participate
References
- Laakso, M. Cardiovascular disease in type 2 diabetes from population to man to Mechanisms. Diabetes Care 2010, 33, 442–449. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Velmurugan, G.V.; Sundaresan, N.R.; Gupta, M.P.; White, C. Defective Nrf2-dependent redox signalling contributes to microvascular dysfunction in type 2 diabetes. Cardiovasc. Res. 2013, 100, 143–150. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cheng, X.; Siow, R.C.; Mann, G.E. Impaired redox signaling and antioxidant gene expression in endothelial cells in diabetes: A role for mitochondria and the nuclear factor-E2-related factor 2-kelch-like ECH-associated protein 1 defense pathway. Antioxid. Redox Signal. 2011, 14, 469–487. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hotamisligil, G.S.; Shargill, N.S.; Spiegelman, B.M. Adipose expression of tumor necrosis factor-alpha: Direct role in obesity-linked insulin resistance. Science 1993, 259, 87–91. [Google Scholar] [CrossRef] [Scilit]
- Hayden, M.S.; Ghosh, S. NF-κB, the first quarter-century: Remarkable progress and outstanding questions. Genes Dev. 2012, 26, 203–234. [Google Scholar] [CrossRef] [Scilit]
- Jaramillo, M.C.; Zhang, D.D. The emerging role of the Nrf2–Keap1 signaling pathway in cancer. Genes Dev. 2013, 27, 2179–2191. [Google Scholar] [CrossRef] [Scilit]
- Wardyn, J.D.; Ponsford, A.H.; Sanderson, C.M. Dissecting molecular cross-talk between Nrf2 and NF-κB response pathways. Biochem. Soc. Trans. 2015, 43, 621–626. [Google Scholar] [CrossRef] [Scilit]
- Soares, M.P.; Seldon, M.P.; Gregoire, I.P.; Vassilevskaia, T.; Berberat, P.O.; Yu, J.; Tsui, T.-Y.; Bach, F.H. Heme oxygenase-1 modulates the expression of adhesion molecules associated with endothelial cell activation. J. Immunol. 2004, 172, 3553–3563. [Google Scholar] [CrossRef] [Scilit]
- Brown, K.; Gerstberger, S.; Carlson, L.; Franzoso, G.; Siebenlist, U. Control of I kappa B-alpha proteolysis by site-specific, signal-induced phosphorylation. Science 1995, 267, 1485–1488. [Google Scholar] [CrossRef] [Scilit]
- Manea, S.-A.; Constantin, A.; Manda, G.; Sasson, S.; Manea, A. Regulation of Nox enzymes expression in vascular pathophysiology: Focusing on transcription factors and epigenetic mechanisms. Redox Biol. 2015, 5, 358–366. [Google Scholar] [CrossRef] [Scilit]
- Manea, A.; Tanase, L.I.; Raicu, M.; Simionescu, M. Transcriptional regulation of NADPH oxidase isoforms, Nox1 and Nox4, by nuclear factor-κB in human aortic smooth muscle cells. Biochem. Biophys. Res. Commun. 2010, 396, 901–907. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kuroda, J.; Ago, T.; Matsushima, S.; Zhai, P.; Schneider, M.D.; Sadoshima, J. NADPH oxidase 4 (Nox4) is a major source of oxidative stress in the failing heart. Proc. Natl. Acad. Sci. USA 2010, 107, 15565–15570. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Itoh, K.; Ye, P.; Matsumiya, T.; Tanji, K.; Ozaki, T. Emerging functional cross-talk between the Keap1-Nrf2 system and mitochondria. J. Clin. Biochem. Nutr. 2015, 56, 91–97. [Google Scholar] [CrossRef] [Scilit]
- Sasaki, H.; Sato, H.; Kuriyama-Matsumura, K.; Sato, K.; Maebara, K.; Wang, H.; Tamba, M.; Itoh, K.; Yamamoto, M.; Bannai, S. Electrophile response element-mediated induction of the cystine/glutamate exchange transporter gene expression. J. Biol. Chem. 2002, 277, 44765–44771. [Google Scholar] [CrossRef] [Scilit]
- Kannan, M.B.; Solovieva, V.; Blank, V. The small MAF transcription factors MAFF, MAFG and MAFK: Current knowledge and perspectives. Biochim. Biophys. Acta 2012, 1823, 1841–1846. [Google Scholar] [CrossRef] [Scilit]
- Rada, P.; Rojo, A.I.; Chowdhry, S.; McMahon, M.; Hayes, J.D.; Cuadrado, A. SCF/β-TrCP promotes glycogen synthase kinase 3-dependent degradation of the Nrf2 transcription factor in a keap1-independent manner. Mol. Cell. Biol. 2011, 31, 1121–1133. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hayes, J.D.; Chowdhry, S.; Dinkova-Kostova, A.T.; Sutherland, C. Dual regulation of transcription factor Nrf2 by Keap1 and by the combined actions of β-TrCP and GSK-3. Biochem. Soc. Trans. 2015, 43, 611–620. [Google Scholar] [CrossRef] [Scilit]
- Chowdhry, S.; Zhang, Y.; McMahon, M.; Sutherland, C.; Cuadrado, A.; Hayes, J.D. Nrf2 is controlled by two distinct β-TrCP recognition motifs in its Neh6 domain, one of which can be modulated by GSK-3 activity. Oncogene 2012, 32, 3765–3781. [Google Scholar] [CrossRef] [Scilit]
- Van Remmen, H.; Richardson, A. Oxidative damage to mitochondria and aging. Exp. Gerontol. 2001, 36, 957–968. [Google Scholar] [CrossRef] [Scilit]
- Newsholme, P.; Haber, E.P.; Hirabara, S.M.; Rebelato, E.L.O.; Procopio, J.; Morgan, D.; Oliveira-Emilio, H.C.; Carpinelli, A.; Curi, R. Diabetes associated cell stress and dysfunction: Role of mitochondrial and non-mitochondrial ROS production and activity. J. Physiol. 2007, 583, 9–24. [Google Scholar] [CrossRef] [Scilit]
- Korshunov, S.S.; Skulachev, V.P.; Starkov, A.A. High protonic potential actuates a mechanism of production of reactive oxygen species in mitochondria. FEBS Lett. 1997, 416, 15–18. [Google Scholar] [CrossRef] [Scilit]
- Belosludtsev, K.N.; Belosludtseva, N.V.; Dubinin, M.V. Diabetes mellitus, mitochondrial dysfunction and Ca2+-dependent permeability transition pore. Int. J. Mol. Sci. 2020, 21, 6559. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shen, X.; Zheng, S.; Metreveli, N.S.; Epstein, P.N. Protection of cardiac mitochondria by overexpression of MnSOD reduces diabetic cardiomyopathy. Diabetes 2006, 55, 798–805. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Radi, R.; Turrens, J.; Chang, L.; Bush, K.; Crapo, J.; Freeman, B. Detection of catalase in rat heart mitochondria. J. Biol. Chem. 1991, 266, 22028–22034. [Google Scholar] [CrossRef] [Scilit]
- Marí, M.; De Gregorio, E.; De Dios, C.; Roca-Agujetas, V.; Cucarull, B.; Tutusaus, A.; Morales, A.; Colell, A. Mitochondrial glutathione: Recent insights and role in disease. Antioxidants 2020, 9, 909. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pickrell, A.M.; Youle, R.J. The roles of PINK1, parkin, and mitochondrial fidelity in parkinson’s disease. Neuron 2015, 85, 257–273. [Google Scholar] [CrossRef] [Scilit]
- Zheng, X.; Hunter, T. Parkin mitochondrial translocation is achieved through a novel catalytic activity coupled mechanism. Cell Res. 2013, 23, 886–897. [Google Scholar] [CrossRef] [Scilit]
- Li, W.; Khor, T.O.; Xu, C.; Shen, G.; Jeong, W.-S.; Yu, S.; Kong, A.-N. Activation of Nrf2-antioxidant signaling attenuates NFκB-inflammatory response and elicits apoptosis. Biochem. Pharmacol. 2008, 76, 1485–1489. [Google Scholar] [CrossRef] [Scilit]
- Chen, H.; Fang, Y.; Li, W.; Orlando, R.C.; Shaheen, N.; Chen, X.L. NFkB and Nrf2 in esophageal epithelial barrier function. Tissue Barriers 2013, 1, e27463. [Google Scholar] [CrossRef] [Scilit]
- Wakabayashi, N.; Slocum, S.L.; Skoko, J.J.; Shin, S.; Kensler, T.W. When NRF2 talks, who’s listening? Antioxid. Redox Signal. 2010, 13, 1649–1663. [Google Scholar] [CrossRef] [Scilit]
- Sivandzade, F.; Prasad, S.; Bhalerao, A.; Cucullo, L. NRF2 and NF-κB interplay in cerebrovascular and neurodegenerative disorders: Molecular mechanisms and possible therapeutic approaches. Redox Biol. 2019, 21, 101059. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Haghani, A.; Cacciottolo, M.; Doty, K.R.; D’Agostino, C.; Thorwald, M.; Safi, N.; Levine, M.E.; Sioutas, C.; Town, T.C.; Forman, H.J.; et al. Mouse brain transcriptome responses to inhaled nanoparticulate matter differed by sex and APOE in Nrf2-Nfkb interactions. eLife 2020, 9, e54822. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, G.-H.; Qu, J.; Shen, X. NF-κB/p65 antagonizes Nrf2-ARE pathway by depriving CBP from Nrf2 and facilitating recruitment of HDAC3 to MafK. Biochim. Biophys. Acta 2008, 1783, 713–727. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, H.; Zhou, L.; Yuen, J.; Birkner, N.; Leppert, V.; O’Day, P.A.; Forman, H.J. Delayed Nrf2-regulated antioxidant gene induction in response to silica nanoparticles. Free Radic. Biol. Med. 2017, 108, 311–319. [Google Scholar] [CrossRef] [Scilit]
- Cummings, B.P.; Digitale, E.K.; Stanhope, K.L.; Graham, J.L.; Baskin, D.G.; Reed, B.J.; Sweet, I.R.; Griffen, S.C.; Havel, P.J. Development and characterization of a novel rat model of type 2 diabetes mellitus: The UC Davis type 2 diabetes mellitus UCD-T2DM rat. Am. J. Physiol. Integr. Comp. Physiol. 2008, 295, R1782–R1793. [Google Scholar] [CrossRef] [Scilit]
- Kleinert, M.; Clemmensen, C.; Hofmann, S.; Moore, M.C.; Renner, S.; Woods, S.C.; Huypens, P.; Beckers, J.; de Angelis, M.H.; Schürmann, A.; et al. Animal models of obesity and diabetes mellitus. Nat. Rev. Endocrinol. 2018, 14, 140–162. [Google Scholar] [CrossRef] [Scilit]
- Piccolo, B.D.; Graham, J.L.; Stanhope, K.L.; Fiehn, O.; Havel, P.J.; Adams, S.H. Plasma amino acid and metabolite signatures tracking diabetes progression in the UCD-T2DM rat model. Am. J. Physiol. Metab. 2016, 310, E958–E969. [Google Scholar] [CrossRef] [Scilit]
- Piccolo, B.D.; Graham, J.L.; Stanhope, K.L.; Nookaew, I.; Mercer, K.E.; Chintapalli, S.V.; Wankhade, U.D.; Shankar, K.; Havel, P.J.; Adams, S.H.; et al. Diabetes-associated alterations in the cecal microbiome and metabolome are independent of diet or environment in the UC davis type 2 diabetes mellitus rat model. Am. J. Physiol. Metab. 2018, 315, E961–E972. [Google Scholar] [CrossRef] [Scilit]
- Dimauro, I.; Pearson, T.; Caporossi, D.; Jackson, M.J. A simple protocol for the subcellular fractionation of skeletal muscle cells and tissue. BMC Res. Notes 2012, 5, 513. [Google Scholar] [CrossRef] [Scilit]
- Thorwald, M.; Rodriguez, R.; Lee, A.; Martinez, B.; Peti-Peterdi, J.; Nakano, D.; Nishiyama, A.; Ortiz, R.M. Angiotensin receptor blockade improves cardiac mitochondrial activity in response to an acute glucose load in obese insulin resistant rats. Redox Biol. 2018, 14, 371–378. [Google Scholar] [CrossRef] [Scilit]
- Thacker, J.S.; Yeung, D.H.; Staines, W.; Mielke, J.G. Total protein or high-abundance protein: Which offers the best loading control for Western blotting? Anal. Biochem. 2016, 496, 76–78. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kwak, S.K.; Kim, J.H. Statistical data preparation: Management of missing values and outliers. Korean J. Anesthesiol. 2017, 70, 407–411. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lanzillotta, A.; Sarnico, I.; Ingrassia, R.; Boroni, F.; Branca, C.; Benarese, M.; Faraco, G.; Blasi, F.; Chiarugi, A.; Spano, P.; et al. The acetylation of RelA in Lys310 dictates the NF-κB-dependent response in post-ischemic injury. Cell Death Dis. 2010, 1, e96. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Giridharan, S.; Srinivasan, M. Mechanisms of NF-ΚB P65 and strategies for therapeutic manipulation. J. Inflamm. Res. 2018, 11, 407–419. [Google Scholar] [CrossRef] [Scilit]
- Dong, J.; Jimi, E.; Zeiss, C.; Hayden, M.S.; Ghosh, S. Constitutively active NF-κB triggers systemic TNFα-dependent inflammation and localized TNFα-independent inflammatory disease. Genes Dev. 2010, 24, 1709–1717. [Google Scholar] [CrossRef] [Scilit]
- Chen, F.; Haigh, S.; Barman, S.A.; Fulton, D.J.R. From form to function: The role of Nox4 in the cardiovascular system. Front. Physiol. 2012, 3, 412. [Google Scholar] [CrossRef] [Scilit]
- Vázquez-Medina, J.P.; Popovich, I.; Thorwald, M.A.; Viscarra, J.A.; Rodriguez, R.; Sonanez-Organis, J.G.; Lam, L.; Peti-Peterdi, J.; Nakano, D.; Nishiyama, A.; et al. Angiotensin receptor-mediated oxidative stress is associated with impaired cardiac redox signaling and mitochondrial function in insulin-resistant rats. Am. J. Physiol. Circ. Physiol. 2013, 305, H599–H607. [Google Scholar] [CrossRef] [Scilit]
- Asmat, U.; Abad, K.; Ismail, K. Diabetes mellitus and oxidative stress—A concise review. Saudi Pharm. J. 2015, 24, 547–553. [Google Scholar] [CrossRef] [Scilit]
- Levy, S.; Forman, H.J. C-Myc is a Nrf2-interacting protein that negatively regulates phase II genes through their electrophile responsive elements. IUBMB Life 2010, 62, 237–246. [Google Scholar] [CrossRef] [Scilit]
- Zhang, H.; Liu, H.; Davies, K.J.; Sioutas, C.; Finch, C.E.; Morgan, T.E.; Forman, H.J. Nrf2-regulated phase II enzymes are induced by chronic ambient nanoparticle exposure in young mice with age-related impairments. Free Radic. Biol. Med. 2012, 52, 2038–2046. [Google Scholar] [CrossRef] [Scilit]
- Thorwald, M.A.; Godoy-Lugo, J.A.; Rodriguez, G.J.; Rodriguez, M.A.; Jamal, M.; Kinoshita, H.; Nakano, D.; Nishiyama, A.; Forman, H.J.; Ortiz, R.M. Nrf2-related gene expression is impaired during a glucose challenge in type II diabetic rat hearts. Free Radic. Biol. Med. 2019, 130, 306–317. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Franklin, C.C.; Backos, D.S.; Mohar, I.; White, C.C.; Forman, H.J.; Kavanagh, T.J. Structure, function, and post-translational regulation of the catalytic and modifier subunits of glutamate cysteine ligase. Mol. Asp. Med. 2009, 30, 86–98. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, M.-H.; Jang, J.-H.; Na, H.-K.; Cha, Y.-N.; Surh, Y.-J. Carbon monoxide produced by heme oxygenase-1 in response to nitrosative stress induces expression of glutamate-cysteine ligase in PC12 cells via activation of phosphatidylinositol 3-Kinase and Nrf2 signaling. J. Biol. Chem. 2007, 282, 28577–28586. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cherkas, A.; Holota, S.; Mdzinarashvili, T.; Gabbianelli, R.; Zarkovic, N. Glucose as a major antioxidant: When, what for and why it fails? Antioxidants 2020, 9, 140. [Google Scholar] [CrossRef] [Scilit]
- Brand, M.D.; Affourtit, C.; Esteves, T.C.; Green, K.; Lambert, A.J.; Miwa, S.; Pakay, J.L.; Parker, N. Mitochondrial superoxide: Production, biological effects, and activation of uncoupling proteins. Free Radic. Biol. Med. 2004, 37, 755–767. [Google Scholar] [CrossRef] [Scilit]





| SD | Pre | 2Wk | 3Mo | 6Mo | |
|---|---|---|---|---|---|
| Age (d) | 168 ± 1 | 170 ± 3 | 168 ± 3 | 160 ± 2 | 265 ± 5 |
| Body Mass (g) | 404 ± 7 | 629 ± 5 * | 645 ± 18 * | 480 ± 13 *, †, ‡ | 474 ± 13 *, †, ‡ |
| Fasting Glucose (mg/dL) | 83 ± 1 | 96 ± 2 * | 98 ± 5 * | 189 ± 33 *, †, ‡ | 384 ± 30 *, †, ‡, § |
| Non-Fasting Glucose (mg/dL) | 112 ± 2 | 146 ± 8 * | 280 ± 30 *, † | 508 ± 12 *, †, ‡ | 592 ± 4 *, †, ‡, § |
| HbA1c (%) | 4.2 ± 0.2 | 4.1 ± 0.2 | 5.8 ± 0.4 *, † | 12.0 ± 0.7 *, †, ‡ | 13.6 ± 0.7 *, †, ‡ |
| Fasting Insulin (ng/mL) | 0.6 ± 0.1 | 1.9 ± 0.2 * | 2.4 ± 0.3 * | 0.9 ± 0.1 †, ‡ | 0.5 ± 0.1 †, ‡, § |
| Primer Name | Nucleotide Sequence (5′-3′) | GeneBank Number |
|---|---|---|
| Keap1-F | ATGTGATGAACGGGGCAGTC | NM_057152.2 |
| Keap1-R | AGAACTCCTCCTCCCCGAAG | |
| Gsk3β-F | CTGGCCACCATCCTTATCCC | NM_032080.1 |
| Gsk3β-R | GAAGCGGCGTTATTGGTCTG | |
| Nrf2-F | ATTTGTAGATGACCATGAGTCGC | NM_031789.2 |
| Nrf2-R | TGTCCTGCTGTATGCTGCTT | |
| Bach1-F | CACAAAGTGCAAAGACCCCG | NM_001107113.1 |
| Bach1-R | ATCGCCTGACTGCTCGTATG | |
| Gclm-F | GTTCATTGTAGGATCG | NM_017305.2 |
| Gclm-R | GGTGCCTATAGCAACAATCT | |
| Gclc-F | CTGGACTCATCCCCATTC | NM_012815.2 |
| Gclc-R | GTAGTCAGGATGGTTTGC | |
| Hmox1-F | GAGCGAAACAAGCAGAACCC | NM_012580.2 |
| Hmox1-R | ACCTCGTGGAGACGCTTTAC | |
| NF-κB-F | GAGCTGGTGGAGGCCCTG | NM_001276711.1 |
| NF-κB-R | GACAGCGGCGTGGAGAC | |
| IKBα-F | CTCAAGAAGGAGCGGTTGGT | NM_001105720.2 |
| IKBα-R | CCAAGTGCAGGAACGAGTCT | |
| Nox4-F | AGATGTTGGGCCTAGGATTGTG | NM_053524.1 |
| Nox4-R | TGTGATCCGCGAAGGTAAGC | |
| B2m-F | ATGGGAAGCCCAACTTCCTC | NM_012512.2 |
| B2m-R | ATACATCGGTCTCGGTGGGT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Thorwald, M.A.; Godoy-Lugo, J.A.; Rodriguez, R.; Stanhope, K.L.; Graham, J.L.; Havel, P.J.; Forman, H.J.; Ortiz, R.M. Cardiac NF-κB Acetylation Increases While Nrf2-Related Gene Expression and Mitochondrial Activity Are Impaired during the Progression of Diabetes in UCD-T2DM Rats. Antioxidants 2022, 11, 927. https://doi.org/10.3390/antiox11050927
Thorwald MA, Godoy-Lugo JA, Rodriguez R, Stanhope KL, Graham JL, Havel PJ, Forman HJ, Ortiz RM. Cardiac NF-κB Acetylation Increases While Nrf2-Related Gene Expression and Mitochondrial Activity Are Impaired during the Progression of Diabetes in UCD-T2DM Rats. Antioxidants. 2022; 11(5):927. https://doi.org/10.3390/antiox11050927
Chicago/Turabian StyleThorwald, Max A., Jose A. Godoy-Lugo, Ruben Rodriguez, Kimber L. Stanhope, James L. Graham, Peter J. Havel, Henry Jay Forman, and Rudy M. Ortiz. 2022. "Cardiac NF-κB Acetylation Increases While Nrf2-Related Gene Expression and Mitochondrial Activity Are Impaired during the Progression of Diabetes in UCD-T2DM Rats" Antioxidants 11, no. 5: 927. https://doi.org/10.3390/antiox11050927
APA StyleThorwald, M. A., Godoy-Lugo, J. A., Rodriguez, R., Stanhope, K. L., Graham, J. L., Havel, P. J., Forman, H. J., & Ortiz, R. M. (2022). Cardiac NF-κB Acetylation Increases While Nrf2-Related Gene Expression and Mitochondrial Activity Are Impaired during the Progression of Diabetes in UCD-T2DM Rats. Antioxidants, 11(5), 927. https://doi.org/10.3390/antiox11050927

