An ACE2-Alamandine Axis Modulates the Cardiac Performance of the Goldfish Carassius auratus via the NOS/NO System
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals
2.2. Hypoxia Exposure
2.3. In Silico Analyses
2.3.1. Protein Sequence Alignment
2.3.2. Protein-Protein Interaction Network
2.4. Alamandine Detection in Plasma
2.5. Isolated and In Vitro Perfused Working Heart
2.6. Experimental Protocols
2.6.1. Basal Conditions
2.6.2. Drug Application
2.6.3. Drugs and Chemicals
2.7. RNA Extraction
2.8. Primer Design and Real-Time PCR
2.9. Western Blot and Densitometric Analysis
2.10. Statistics and Calculations
3. Results
3.1. Identification of ACE2 and Alamandine
3.2. Effects of Alamandine on the Basal Cardiac Performance
3.3. Receptors
3.4. Role of the NOS/NO System in the Alamandine-Induced Enhanced Contractility
3.5. Activation of the ACE2/Alamandine Axis under Hypoxia
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Nishimura, H. Renin-angiotensin system in vertebrates: Phylogenetic view of structure and function. Anat. Sci. Int. 2017, 92, 215–247. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kobayashi, H.; Takei, Y. The Renin-Angiotensin System: Comparative Aspects. In Zoophysiology; Springer: Berlin, Germany, 1996; Volume 35, pp. 1–245. [Google Scholar]
- Takei, Y. Comparative physiology of body fluid regulation in vertebrates with special reference to thirst regulation. Jpn. J. Physiol. 2000, 50, 171–186. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tipnis, S.R.; Hooper, N.M.; Hyde, R.; Karran, E.; Christie, G.; Turner, A.J. A human homolog of angiotensin-converting enzyme. Cloning and functional expression as a captopril-insensitive carboxypeptidase. J. Biol. Chem. 2000, 275, 33238–33243. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Donoghue, M.; Hsieh, F.; Baronas, E.; Godbout, K.; Gosselin, M.; Stagliano, N.; Donovan, M.; Woolf, B.; Robison, K.; Jeyaseelan, R.; et al. A novel angiotensin-converting enzyme-related carboxypeptidase (ACE2) converts angiotensin I to angiotensin 1-9. Circ. Res. 2000, 87, E1–E9. [Google Scholar] [CrossRef] [Scilit]
- Santos, R.A.; Brosnihan, K.B.; Chappell, M.C.; Pesquero, J.; Chernicky, C.L.; Greene, L.J.; Ferrario, C.M. Converting enzyme activity and angiotensin metabolism in the dog brainstem. Hypertension 1988, 11, I153–I157. [Google Scholar] [CrossRef] [Scilit]
- Santos, R.A.; Simoes e Silva, A.C.; Maric, C.; Silva, D.M.; Machado, R.P.; de Buhr, I.; Heringer-Walther, S.; Pinheiro, S.V.; Lopes, M.T.; Bader, M.; et al. Angiotensin-(1-7) is an endogenous ligand for the G protein-coupled receptor Mas. Proc. Natl. Acad. Sci. USA 2003, 100, 8258–8263. [Google Scholar] [CrossRef] [Scilit]
- Santos, R.A.S.; Sampaio, W.O.; Alzamora, A.C.; Motta-Santos, D.; Alenina, N.; Bader, M.; Campagnole-Santos, M.J. The ACE2/Angiotensin-(1-7)/MAS Axis of the Renin-Angiotensin System: Focus on Angiotensin-(1-7). Physiol. Rev. 2018, 98, 505–553. [Google Scholar] [CrossRef] [Scilit]
- Lautner, R.Q.; Villela, D.C.; Fraga-Silva, R.A.; Silva, N.; Verano-Braga, T.; Costa-Fraga, F.; Jankowski, J.; Jankowski, V.; Sousa, F.; Alzamora, A.; et al. Discovery and characterization of alamandine: A novel component of the renin-angiotensin system. Circ. Res. 2013, 112, 1104–1111. [Google Scholar] [CrossRef] [Scilit]
- Park, B.M.; Phuong, H.T.A.; Yu, L.; Kim, S.H. Alamandine Protects the Heart Against Reperfusion Injury via the MrgD Receptor. Circ. J. 2018, 82, 2584–2593. [Google Scholar] [CrossRef] [Scilit]
- Jesus, I.C.G.; Scalzo, S.; Alves, F.; Marques, K.; Rocha-Resende, C.; Bader, M.; Santos, R.A.S.; Guatimosim, S. Alamandine acts via MrgD to induce AMPK/NO activation against ANG II hypertrophy in cardiomyocytes. Am. J. Physiol. Cell Physiol. 2018, 314, C702–C711. [Google Scholar] [CrossRef] [Scilit]
- Imbrogno, S.; Filice, M.; Cerra, M.C. Exploring cardiac plasticity in teleost: The role of humoral modulation. Gen. Comp. Endocrinol. 2019, 283, 113236. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Oudit, G.Y.; Butler, D.G. Angiotensin II and cardiovascular regulation in a freshwater teleost, Anguilla rostrata LeSueur. Am. J. Physiol. 1995, 269, R726–R735. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bernier, N.J.; Kaiya, H.; Takei, Y.; Perry, S.F. Mediation of humoral catecholamine secretion by the renin-angiotensin system in hypotensive rainbow trout (Oncorhynchus mykiss). J. Endocrinol. 1999, 160, 351–363. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Imbrogno, S.; Cerra, M.C.; Tota, B. Angiotensin II-induced inotropism requires an endocardial endothelium-nitric oxide mechanism in the in-vitro heart of Anguilla anguilla. J. Exp. Biol. 2003, 206, 2675–2684. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Imbrogno, S.; Garofalo, F.; Amelio, D.; Capria, C.; Cerra, M.C. Humoral control of cardiac remodeling in fish: Role of Angiotensin II. Gen. Comp. Endocrinol. 2013, 194, 189–197. [Google Scholar] [CrossRef] [Scilit]
- Filice, M.; Amelio, D.; Garofalo, F.; David, S.; Fucarino, A.; Jensen, F.B.; Imbrogno, S.; Cerra, M.C. Angiotensin II dependent cardiac remodeling in the eel Anguilla anguilla involves the NOS/NO system. Nitric Oxide 2017, 65, 50–59. [Google Scholar] [CrossRef] [Scilit]
- Filice, M.; Barca, A.; Amelio, D.; Leo, S.; Mazzei, A.; Del Vecchio, G.; Verri, T.; Cerra, M.C.; Imbrogno, S. Morpho-functional remodelling of the adult zebrafish (Danio rerio) heart in response to waterborne angiotensin II exposure. Gen. Comp. Endocrinol. 2021, 301, 113663. [Google Scholar] [CrossRef] [Scilit]
- Olson, K.R.; Conklin, D.J.; Farrell, A.P.; Keen, J.E.; Takei, Y.; Weaver, L., Jr.; Smith, M.P.; Zhang, Y. Effects of natriuretic peptides and nitroprusside on venous function in trout. Am. J. Physiol. 1997, 273, R527–R539. [Google Scholar] [CrossRef] [Scilit]
- Masini, M.A.; Sturla, M.; Uva, B. Key enzymes of the kallikrein-kinin system in Antarctic teleosts. Polar Biol. 1997, 17, 358–362. [Google Scholar] [CrossRef] [Scilit]
- Cobb, C.S.; Anne Brown, J. Angiotensin II binding to tissues of the rainbow trout, Oncorhynchus mykiss, studied by autoradiography. J. Comp. Physiol. B 1992, 162, 197–202. [Google Scholar] [CrossRef] [Scilit]
- Conlon, J.M.; Yano, K.; Olson, K.R. Production of [Asn1, Val5] angiotensin II and [Asp1, Val5] angiotensin II in kallikrein-treated trout plasma (T60K). Peptides 1996, 17, 527–530. [Google Scholar] [CrossRef] [Scilit]
- Lancien, F.; Wong, M.; Arab, A.A.; Mimassi, N.; Takei, Y.; Le Mevel, J.C. Central ventilatory and cardiovascular actions of angiotensin peptides in trout. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2012, 303, R311–R320. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wong, M.K.; Takei, Y. Changes in plasma angiotensin subtypes in Japanese eel acclimated to various salinities from deionized water to double-strength seawater. Gen. Comp. Endocrinol. 2012, 178, 250–258. [Google Scholar] [CrossRef] [Scilit]
- Imbrogno, S.; Capria, C.; Tota, B.; Jensen, F.B. Nitric oxide improves the hemodynamic performance of the hypoxic goldfish (Carassius auratus) heart. Nitric Oxide 2014, 42, 24–31. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative C(T) method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mazza, R.; Gattuso, A.; Imbrogno, S.; Boukhzar, L.; Leo, S.; Mallouki, B.Y.; Filice, M.; Rocca, C.; Angelone, T.; Anouar, Y.; et al. Selenoprotein T as a new positive inotrope in the goldfish, Carassius auratus. J. Exp. Biol. 2019, 222, jeb201202. [Google Scholar] [CrossRef] [Scilit]
- Imbrogno, S.; Filice, M.; Cerra, M.C.; Gattuso, A. NO, CO and H2 S: What about gasotransmitters in fish and amphibian heart? Acta. Physiol. (Oxf) 2018, 223, e13035. [Google Scholar] [CrossRef] [Scilit]
- Jesus, I.C.G.; Mesquita, T.R.R.; Monteiro, A.L.L.; Parreira, A.B.; Santos, A.K.; Coelho, E.L.X.; Silva, M.M.; Souza, L.A.C.; Campagnole-Santos, M.J.; Santos, R.S.; et al. Alamandine enhances cardiomyocyte contractility in hypertensive rats through a nitric oxide-dependent activation of CaMKII. Am. J. Physiol. Cell Physiol. 2020, 318, C740–C750. [Google Scholar] [CrossRef] [Scilit]
- Dimmeler, S.; Fleming, I.; Fisslthaler, B.; Hermann, C.; Busse, R.; Zeiher, A.M. Activation of nitric oxide synthase in endothelial cells by Akt-dependent phosphorylation. Nature 1999, 399, 601–605. [Google Scholar] [CrossRef] [Scilit]
- Sessa, W.C. eNOS at a glance. J. Cell Sci. 2004, 117, 2427–2429. [Google Scholar] [CrossRef] [Scilit]
- Chou, C.F.; Loh, C.B.; Foo, Y.K.; Shen, S.; Fielding, B.C.; Tan, T.H.; Khan, S.; Wang, Y.; Lim, S.G.; Hong, W.; et al. ACE2 orthologues in non-mammalian vertebrates (Danio, Gallus, Fugu, Tetraodon and Xenopus). Gene 2006, 377, 46–55. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, D.; Liu, Y.; Yang, H.; Liu, L.; Huang, W.; Zhao, Y. SARS-CoV-2 is less likely to infect aquatic food animals: Sequence and phylogeny analysis of ACE2 in mammals and fish. Mol. Biomed. 2020, 1, 13. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hamming, I.; Timens, W.; Bulthuis, M.L.; Lely, A.T.; Navis, G.; van Goor, H. Tissue distribution of ACE2 protein, the functional receptor for SARS coronavirus. A first step in understanding SARS pathogenesis. J. Pathol. 2004, 203, 631–637. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fagerberg, L.; Hallstrom, B.M.; Oksvold, P.; Kampf, C.; Djureinovic, D.; Odeberg, J.; Habuka, M.; Tahmasebpoor, S.; Danielsson, A.; Edlund, K.; et al. Analysis of the human tissue-specific expression by genome-wide integration of transcriptomics and antibody-based proteomics. Mol. Cell. Proteom. 2014, 13, 397–406. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, H.; Zhong, L.; Deng, J.; Peng, J.; Dan, H.; Zeng, X.; Li, T.; Chen, Q. High expression of ACE2 receptor of 2019-nCoV on the epithelial cells of oral mucosa. Int. J. Oral Sci. 2020, 12, 8. [Google Scholar] [CrossRef] [Scilit]
- Postlethwait, J.H.; Massaquoi, M.S.; Farnsworth, D.R.; Yan, Y.L.; Guillemin, K.; Miller, A.C. The SARS-CoV-2 receptor and other key components of the Renin-Angiotensin-Aldosterone System related to COVID-19 are expressed in enterocytes in larval zebrafish. Biol. Open 2021, 10, bio058172. [Google Scholar] [CrossRef] [Scilit]
- Butler, D.G.; Oudit, G.Y. Angiotensin-I- and -III-mediated cardiovascular responses in the freshwater North American eel, Anguilla rostrata: Effect of Phe8 deletion. Gen. Comp. Endocrinol. 1995, 97, 259–269. [Google Scholar] [CrossRef] [Scilit]
- Russell, M.J.; Klemmer, A.M.; Olson, K.R. Angiotensin signaling and receptor types in teleost fish. Comp. Biochem. Physiol. Part A: Mol. Integr. Physiol. 2001, 128, 41–51. [Google Scholar] [CrossRef] [Scilit]
- Silva, M.M.; de Souza-Neto, F.P.; Jesus, I.C.G.; Goncalves, G.K.; Santuchi, M.C.; Sanches, B.L.; de Alcantara-Leonidio, T.C.; Melo, M.B.; Vieira, M.A.R.; Guatimosim, S.; et al. Alamandine improves cardiac remodeling induced by transverse aortic constriction in mice. Am. J. Physiol. Heart Circ. Physiol. 2021, 320, H352–H363. [Google Scholar] [CrossRef] [Scilit]
- Etelvino, G.M.; Peluso, A.A.; Santos, R.A. New components of the renin-angiotensin system: Alamandine and the MAS-related G protein-coupled receptor D. Curr. Hypertens. Rep. 2014, 16, 433. [Google Scholar] [CrossRef] [Scilit]
- Schleifenbaum, J. Alamandine and Its Receptor MrgD Pair Up to Join the Protective Arm of the Renin-Angiotensin System. Front. Med. (Lausanne) 2019, 6, 107. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dong, X.; Han, S.-k.; Zylka, M.J.; Simon, M.I.; Anderson, D.J. A Diverse Family of GPCRs Expressed in Specific Subsets of Nociceptive Sensory Neurons. Cell 2001, 106, 619–632. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Oliveira, A.C.; Melo, M.B.; Motta-Santos, D.; Peluso, A.A.; Souza-Neto, F.; da Silva, R.F.; Almeida, J.F.Q.; Canta, G.; Reis, A.M.; Goncalves, G.; et al. Genetic deletion of the alamandine receptor MRGD leads to dilated cardiomyopathy in mice. Am. J. Physiol. Heart Circ. Physiol. 2019, 316, H123–H133. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fournier, D.; Luft, F.C.; Bader, M.; Ganten, D.; Andrade-Navarro, M.A. Emergence and evolution of the renin-angiotensin-aldosterone system. J. Mol. Med. (Berl.) 2012, 90, 495–508. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pasquier, J.; Cabau, C.; Nguyen, T.; Jouanno, E.; Severac, D.; Braasch, I.; Journot, L.; Pontarotti, P.; Klopp, C.; Postlethwait, J.H.; et al. Gene evolution and gene expression after whole genome duplication in fish: The PhyloFish database. BMC Genom. 2016, 17, 368. [Google Scholar] [CrossRef] [Scilit]
- Tetzner, A.; Gebolys, K.; Meinert, C.; Klein, S.; Uhlich, A.; Trebicka, J.; Villacanas, O.; Walther, T. G-Protein-Coupled Receptor MrgD Is a Receptor for Angiotensin-(1-7) Involving Adenylyl Cyclase, cAMP, and Phosphokinase A. Hypertension 2016, 68, 185–194. [Google Scholar] [CrossRef] [Scilit]
- Qaradakhi, T.; Matsoukas, M.T.; Hayes, A.; Rybalka, E.; Caprnda, M.; Rimarova, K.; Sepsi, M.; Busselberg, D.; Kruzliak, P.; Matsoukas, J.; et al. Alamandine reverses hyperhomocysteinemia-induced vascular dysfunction via PKA-dependent mechanisms. Cardiovasc. Ther. 2017, 35, e12306. [Google Scholar] [CrossRef] [Scilit]
- Imbrogno, S.; Aiello, D.; Filice, M.; Leo, S.; Mazza, R.; Cerra, M.C.; Napoli, A. MS-based proteomic analysis of cardiac response to hypoxia in the goldfish (Carassius auratus). Sci. Rep. 2019, 9, 18953. [Google Scholar] [CrossRef] [Scilit]
- Filice, M.; Mazza, R.; Leo, S.; Gattuso, A.; Cerra, M.C.; Imbrogno, S. The Hypoxia Tolerance of the Goldfish (Carassius auratus) Heart: The NOS/NO System and Beyond. Antioxidants (Basel) 2020, 9, 555. [Google Scholar] [CrossRef] [Scilit]
- Imbrogno, S.; Tota, B.; Gattuso, A. The evolutionary functions of cardiac NOS/NO in vertebrates tracked by fish and amphibian paradigms. Nitric Oxide 2011, 25, 1–10. [Google Scholar] [CrossRef] [Scilit]
- Mount, P.F.; Kemp, B.E.; Power, D.A. Regulation of endothelial and myocardial NO synthesis by multi-site eNOS phosphorylation. J. Mol. Cell. Cardiol. 2007, 42, 271–279. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stecyk, J.A.; Stenslokken, K.O.; Farrell, A.P.; Nilsson, G.E. Maintained cardiac pumping in anoxic crucian carp. Science 2004, 306, 77. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Filice, M.; Cerra, M.C.; Imbrogno, S. The goldfish Carassius auratus: An emerging animal model for comparative cardiac research. J. Comp. Physiol. B 2021, 192, 27–48. [Google Scholar] [CrossRef] [Scilit]
- Mateo, J.; Garcia-Lecea, M.; Cadenas, S.; Hernandez, C.; Moncada, S. Regulation of hypoxia-inducible factor-1alpha by nitric oxide through mitochondria-dependent and -independent pathways. Biochem. J. 2003, 376, 537–544. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Metzen, E.; Zhou, J.; Jelkmann, W.; Fandrey, J.; Brune, B. Nitric oxide impairs normoxic degradation of HIF-1alpha by inhibition of prolyl hydroxylases. Mol. Biol. Cell 2003, 14, 3470–3481. [Google Scholar] [CrossRef] [Scilit]
- Olson, N.; van der Vliet, A. Interactions between nitric oxide and hypoxia-inducible factor signaling pathways in inflammatory disease. Nitric Oxide 2011, 25, 125–137. [Google Scholar] [CrossRef] [Scilit]
- Mandic, M.; Tzaneva, V.; Careau, V.; Perry, S.F. Hif-1alpha paralogs play a role in the hypoxic ventilatory response of larval and adult zebrafish (Danio rerio). J. Exp. Biol. 2019, 222, jeb195198. [Google Scholar] [CrossRef] [Scilit]
- Sollid, J.; Rissanen, E.; Tranberg, H.K.; Thorstensen, T.; Vuori, K.A.; Nikinmaa, M.; Nilsson, G.E. HIF-1alpha and iNOS levels in crucian carp gills during hypoxia-induced transformation. J. Comp. Physiol. B 2006, 176, 359–369. [Google Scholar] [CrossRef] [Scilit]
- Imbrogno, S.; Mazza, R.; Pugliese, C.; Filice, M.; Angelone, T.; Loh, Y.P.; Tota, B.; Cerra, M.C. The Chromogranin A-derived sympathomimetic serpinin depresses myocardial performance in teleost and amphibian hearts. Gen. Comp. Endocrinol. 2017, 240, 1–9. [Google Scholar] [CrossRef] [Scilit]
- Amelio, D.; Garofalo, F.; Pellegrino, D.; Giordano, F.; Tota, B.; Cerra, M.C. Cardiac expression and distribution of nitric oxide synthases in the ventricle of the cold-adapted Antarctic teleosts, the hemoglobinless Chionodraco hamatus and the red-blooded Trematomus bernacchii. Nitric Oxide 2006, 15, 190–198. [Google Scholar] [CrossRef] [Scilit]
- Amelio, D.; Garofalo, F.; Brunelli, E.; Loong, A.M.; Wong, W.P.; Ip, Y.K.; Tota, B.; Cerra, M.C. Differential NOS expression in freshwater and aestivating Protopterus dolloi (lungfish): Heart vs. kidney readjustments. Nitric Oxide 2008, 18, 1–10. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Andreakis, N.; D’Aniello, S.; Albalat, R.; Patti, F.P.; Garcia-Fernandez, J.; Procaccini, G.; Sordino, P.; Palumbo, A. Evolution of the nitric oxide synthase family in metazoans. Mol. Biol. Evol. 2011, 28, 163–179. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Imbrogno, S.; Verri, T.; Filice, M.; Barca, A.; Schiavone, R.; Gattuso, A.; Cerra, M.C. Shaping the cardiac response to hypoxia: NO and its partners in teleost fish. Curr. Res. Physiol. 2022, 5, 193–202. [Google Scholar] [CrossRef] [Scilit]







| Gene | RefSeq mRNA | Sense Primer 5′-3′ (Tm) | Antisense Primer 5′-3′ (Tm) | PCR Size (bp) |
|---|---|---|---|---|
| ace2 | XM_026275528.1 | GAAATGAATTTCAAGCCAGAG (58 °C) | GACTGCGTCTGCTTTGGT (55 °C) | 121 |
| 28S RNA | EF417169.1 | GGTCTAAGTCCTTCTGAT (51 °C) | GGCTGCATTCCCAAACAAC (54 °C) | 112 |
| Heart Rate (bpm) | Cardiac Output (mL/min/Kg) | Stroke Volume (mL/Kg) | Stroke Work (mJ/g) |
|---|---|---|---|
| 75.50 ± 3.334 | 13.55 ± 0.673 | 0.18 ± 0.013 | 0.24 ± 0.022 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Filice, M.; Mazza, R.; Imbrogno, S.; Mileti, O.; Baldino, N.; Barca, A.; Del Vecchio, G.; Verri, T.; Gattuso, A.; Cerra, M.C. An ACE2-Alamandine Axis Modulates the Cardiac Performance of the Goldfish Carassius auratus via the NOS/NO System. Antioxidants 2022, 11, 764. https://doi.org/10.3390/antiox11040764
Filice M, Mazza R, Imbrogno S, Mileti O, Baldino N, Barca A, Del Vecchio G, Verri T, Gattuso A, Cerra MC. An ACE2-Alamandine Axis Modulates the Cardiac Performance of the Goldfish Carassius auratus via the NOS/NO System. Antioxidants. 2022; 11(4):764. https://doi.org/10.3390/antiox11040764
Chicago/Turabian StyleFilice, Mariacristina, Rosa Mazza, Sandra Imbrogno, Olga Mileti, Noemi Baldino, Amilcare Barca, Gianmarco Del Vecchio, Tiziano Verri, Alfonsina Gattuso, and Maria Carmela Cerra. 2022. "An ACE2-Alamandine Axis Modulates the Cardiac Performance of the Goldfish Carassius auratus via the NOS/NO System" Antioxidants 11, no. 4: 764. https://doi.org/10.3390/antiox11040764
APA StyleFilice, M., Mazza, R., Imbrogno, S., Mileti, O., Baldino, N., Barca, A., Del Vecchio, G., Verri, T., Gattuso, A., & Cerra, M. C. (2022). An ACE2-Alamandine Axis Modulates the Cardiac Performance of the Goldfish Carassius auratus via the NOS/NO System. Antioxidants, 11(4), 764. https://doi.org/10.3390/antiox11040764

