Polyphenol Rich Forsythia suspensa Extract Alleviates DSS-Induced Ulcerative Colitis in Mice through the Nrf2-NLRP3 Pathway
Abstract
1. Introduction
2. Materials and Methods
2.1. Drugs
2.2. Experimental Animals
2.3. Experimental Design
2.4. LC–MS Analysis
2.5. Measurement of Superoxide Dismutase (SOD), Malondialdehyde (MDA) and Myeloperoxidase (MPO) Levels
2.6. Cell Culture and Viability Assay
2.7. Flow Cytometry
2.8. RNA Extraction and Quantitative Real-Time PCR (qRT-PCR)
2.9. Western Blot Analysis
2.10. Isolation of Nuclear Proteins
2.11. Lactate Dehydrogenase (LDH) Activity Assay
2.12. Sample Preparation and Metabolite Detection
2.13. Metabolite Data Processing and Analysis
2.14. Histological Analysis
2.15. Statistical Analysis
3. Results
3.1. Identification of the Chemical Constituents of Forsythia suspensa Extract
3.2. Forsythia suspensa Extract Alleviates DSS-Induced Colitis
3.3. Effects of Forsythia suspensa Extract on Oxidative Stress and MPO Levels in Mice
3.4. Antioxidant Effect of Forsythia suspensa Extract
3.5. Forsythia suspensa Extract Inhibits the Occurrence of Pyroptosis
3.6. Effect of Forsythia suspensa Extract on Cell Viability
3.7. The effect of Forsythia suspensa Extract on a Pyroptosis Model In Vitro
3.8. Forsythia suspensa Extract Inhibits the Oxidative Stress Response
3.9. Forsythia suspensa Extract Reduces ROS Levels in J774A.1 Cells
3.10. Forsythia suspensa Extract Inhibits Pyroptosis via Activation of the NLRP3 Inflammasome
3.11. The Nrf2 Signalling Pathway Plays a Role in the Process by Which Forsythia suspensa Extract Inhibits Pyroptosis
3.12. Multivariate Statistical Analysis of Metabolites
3.13. Metabolite Identification
3.14. Analysis of Potential Metabolic Pathways
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Ungaro, R.; Mehandru, S.; Allen, P.B.; Peyrin-Biroulet, L.; Colombel, J.F. Ulcerative colitis. Lancet 2017, 389, 1756–1770. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Z.; Shen, P.; Xie, W.; Cao, H.; Liu, J.; Cao, Y.; Zhang, N. Pingwei San ameliorates dextran sulfate sodium-induced chronic colitis in mice. J. Ethnopharmacol. 2019, 236, 91–99. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, X.; Fan, F.; Cao, Q. Modified Pulsatilla decoction attenuates oxazolone-induced colitis in mice through suppression of inflammation and epithelial barrier disruption. Mol. Med. Rep. 2016, 14, 1173–1179. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- de Souza, H. Etiopathogenesis of inflammatory bowel disease: Today and tomorrow. Curr. Opin. Gastroenterol. 2017, 33, 222–229. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Abderrazak, A.; Syrovets, T.; Couchie, D.; El, H.K.; Friguet, B.; Simmet, T.; Rouis, M. NLRP3 inflammasome: From a danger signal sensor to a regulatory node of oxidative stress and inflammatory diseases. Redox Biol. 2015, 4, 296–307. [Google Scholar] [CrossRef] [Scilit]
- Xiong, Y.; Lou, Y.; Su, H.; Fu, Y.; Kong, J. Cholecalciterol cholesterol emulsion ameliorates experimental colitis via down-regulating the pyroptosis signaling pathway. Exp. Mol. Pathol. 2016, 100, 386–392. [Google Scholar] [CrossRef] [Scilit]
- Zeng, C.Y.; Li, C.G.; Shu, J.X.; Xu, L.H.; Ouyang, D.Y.; Mai, F.Y.; Zeng, Q.Z.; Zhang, C.C.; Li, R.M.; He, X.H. ATP induces caspase-3/gasdermin E-mediated pyroptosis in NLRP3 pathway-blocked murine macrophages. Apoptosis 2019, 24, 703–717. [Google Scholar] [CrossRef] [Scilit]
- Wang, Z.; Xia, Q.; Liu, X.; Liu, W.; Huang, W.; Mei, X.; Luo, J.; Shan, M.; Lin, R.; Zou, D.; et al. Phytochemistry, pharmacology, quality control and future research of Forsythia suspensa (Thunb.) Vahl: A review. J. Ethnopharmacol. 2018, 210, 318–339. [Google Scholar] [CrossRef] [Scilit]
- Hwang, Y.H.; Kim, D.G.; Li, W.; Yang, H.J.; Yim, N.H.; Ma, J.Y. Anti-inflammatory effects of Forsythia suspensa in dextran sulfate sodium-induced colitis. J. Ethnopharmacol. 2017, 206, 73–77. [Google Scholar] [CrossRef] [Scilit]
- Lu, T.; Piao, X.L.; Zhang, Q.; Wang, D.; Piao, X.S.; Kim, S.W. Protective effects of Forsythia suspensa extract against oxidative stress induced by diquat in rats. Food Chem. Toxicol. 2010, 48, 764–770. [Google Scholar] [CrossRef] [Scilit]
- Cheng, L.; Li, F.; Ma, R.; Hu, X. Forsythiaside inhibits cigarette smoke-induced lung inflammation by activation of Nrf2 and inhibition of NF-kappaB. Int. Immunopharmacol. 2015, 28, 494–499. [Google Scholar] [CrossRef] [Scilit]
- Zhao, P.; Piao, X.; Pan, L.; Zeng, Z.; Li, Q.; Xu, X.; Wang, H. Forsythia suspensa extract attenuates lipopolysaccharide-induced inflammatory liver injury in rats via promoting antioxidant defense mechanisms. Anim. Sci. J. 2017, 88, 873–881. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, J.J.; Kim, K.H.; Kim, E.J.; Choi, J.Y.; Kim, S.J.; Jeong, S.I.; Kim, J.I.; Joo, M. Anti-inflammatory activity of the decoction of Forsythia suspensa (Thunb.) Vahl is related to Nrf2 and A20. J. Ethnopharmacol. 2018, 227, 97–104. [Google Scholar] [CrossRef] [Scilit]
- Sridhar, A.; Ponnuchamy, M.; Kumar, P.S.; Kapoor, A.; Vo, D.N.; Prabhakar, S. Techniques and modeling of polyphenol extraction from food: A review. Environ. Chem. Lett. 2021, 19, 3409–3443. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kiani, R.; Arzani, A.; Mirmohammady, M.S. Polyphenols, Flavonoids, and Antioxidant Activity Involved in Salt Tolerance in Wheat, Aegilops cylindrica and Their Amphidiploids. Front. Plant Sci. 2021, 12, 646221. [Google Scholar] [CrossRef] [Scilit]
- Rojas-Garbanzo, C.; Rodriguez, L.; Perez, A.M.; Mayorga-Gross, A.L.; Vasquez-Chaves, V.; Fuentes, E.; Palomo, I. Anti-platelet activity and chemical characterization by UPLC-DAD-ESI-QTOF-MS of the main polyphenols in extracts from Psidium leaves and fruits. Food Res. Int. 2021, 141, 110070. [Google Scholar] [CrossRef] [Scilit]
- Rahman, M.M.; Shahab, N.B.; Miah, P.; Rahaman, M.M.; Kabir, A.U.; Subhan, N.; Khan, A.A.; Afroze, M.; Khan, M.; Ahmed, K.S.; et al. Polyphenol-rich leaf of Aphanamixis polystachya averts liver inflammation, fibrogenesis and oxidative stress in ovariectomized Long-Evans rats. Biomed. Pharmacother. 2021, 138, 111530. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Macias-Ceja, D.C.; Cosin-Roger, J.; Ortiz-Masia, D.; Salvador, P.; Hernandez, C.; Esplugues, J.V.; Calatayud, S.; Barrachina, M.D. Stimulation of autophagy prevents intestinal mucosal inflammation and ameliorates murine colitis. Br. J. Pharmacol. 2017, 174, 2501–2511. [Google Scholar] [CrossRef] [Scilit]
- Shen, P.; Zhang, Z.; Zhu, K.; Cao, H.; Liu, J.; Lu, X.; Li, Y.; Jing, Y.; Yuan, X.; Fu, Y.; et al. Evodiamine prevents dextran sulfate sodium-induced murine experimental colitis via the regulation of NF-kappaB and NLRP3 inflammasome. Biomed. Pharmacother. 2019, 110, 786–795. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, C.; Zhou, H.; Zhu, H. Effect of forsythia polyphenols extractant on antioxidant property of pumpkin seed oil. Sci. Technol. Cereals Oils Foods 2013, 21, 42–46. [Google Scholar] [CrossRef]
- Ouyang, Y.; Wu, D.; Li, Y. Comparison of the Total Polyphenol Content and Antioxidant Activation for Several Kinds of Medicinal Plants. Chin. Wild Plant Resour. 2012, 31, 20–23. [Google Scholar]
- Qu, H.; Zhang, Y.; Chai, X.; Sun, W. Isoforsythiaside, an antioxidant and antibacterial phenylethanoid glycoside isolated from Forsythia suspensa. Bioorg. Chem. 2012, 40, 87–91. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gao, X.J.; Tang, B.; Liang, H.H.; Yi, L.; Wei, Z.G. The protective effect of nigeglanine on dextran sulfate sodium-induced experimental colitis in mice and Caco-2 cells. J. Cell Physiol. 2019, 234, 23398–23408. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bulek, K.; Zhao, J.; Liao, Y.; Rana, N.; Corridoni, D.; Antanaviciute, A.; Chen, X.; Wang, H.; Qian, W.; Miller-Little, W.A.; et al. Epithelial-derived gasdermin D mediates nonlytic IL-1beta release during experimental colitis. J. Clin. Investig. 2020, 130, 4218–4234. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Teng, J.F.; Mei, Q.B.; Zhou, X.G.; Tang, Y.; Xiong, R.; Qiu, W.Q.; Pan, R.; Law, B.Y.; Wong, V.K.; Yu, C.L.; et al. Polyphyllin VI Induces Caspase-1-Mediated Pyroptosis via the Induction of ROS/NF-kappaB/NLRP3/GSDMD Signal Axis in Non-Small Cell Lung Cancer. Cancers 2020, 12, 193. [Google Scholar] [CrossRef] [Scilit]
- Bramhall, M.; Florez-Vargas, O.; Stevens, R.; Brass, A.; Cruickshank, S. Quality of methods reporting in animal models of colitis. Inflamm. Bowel Dis. 2015, 21, 1248–1259. [Google Scholar] [CrossRef] [Scilit]
- Li, H.; Fan, C.; Feng, C.; Wu, Y.; Lu, H.; He, P.; Yang, X.; Zhu, F.; Qi, Q.; Gao, Y.; et al. Inhibition of phosphodiesterase-4 attenuates murine ulcerative colitis through interference with mucosal immunity. Br. J. Pharmacol. 2019, 176, 2209–2226. [Google Scholar] [CrossRef] [Scilit]
- Montrose, D.C.; Horelik, N.A.; Madigan, J.P.; Stoner, G.D.; Wang, L.S.; Bruno, R.S.; Park, H.J.; Giardina, C.; Rosenberg, D.W. Anti-inflammatory effects of freeze-dried black raspberry powder in ulcerative colitis. Carcinogenesis 2011, 32, 343–350. [Google Scholar] [CrossRef] [Scilit]
- Luan, L.; Wang, G.L.; Lin, R.C. Studies on the chemical constituents of extract with water from Forsythia suspensa. J. Chin. Med. Mater. 2010, 33, 220–221. [Google Scholar]
- Hu, N.; Guo, C.; Dai, X.; Wang, C.; Gong, L.; Yu, L.; Peng, C.; Li, Y. Forsythiae Fructuse water extract attenuates liver fibrosis via TLR4/MyD88/NF-kappaB and TGF-beta/smads signaling pathways. J. Ethnopharmacol. 2020, 262, 113275. [Google Scholar] [CrossRef] [Scilit]
- Mandlik, D.S.; Mandlik, S.K.; Patel, S. Protective effect of sarsasapogenin in TNBS induced ulcerative colitis in rats associated with downregulation of pro-inflammatory mediators and oxidative stress. Immunopharmacol. Immunotoxicol. 2021, 43, 571–583. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Oladele, J.O.; Anyim, J.C.; Oyeleke, O.M.; Olowookere, B.D.; Bamigboye, M.O.; Oladele, O.T.; Oladiji, A.T. Telfairia occidentalis mitigates dextran sodium sulfate-induced ulcerative colitis in rats via suppression of oxidative stress, lipid peroxidation, and inflammation. J. Food Biochem. 2021, 45, e13873. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, Y.; Zhao, H.; Lin, C.; Ren, J.; Zhang, S. Forsythiaside A Exhibits Anti-inflammatory Effects in LPS-Stimulated BV2 Microglia Cells Through Activation of Nrf2/HO-1 Signaling Pathway. Neurochem. Res. 2016, 41, 659–665. [Google Scholar] [CrossRef] [Scilit]
- Kim, T.W.; Shin, J.S.; Chung, K.S.; Lee, Y.G.; Baek, N.I.; Lee, K.T. Anti-Inflammatory Mechanisms of Koreanaside A, a Lignan Isolated from the Flower of Forsythia koreana, against LPS-Induced Macrophage Activation and DSS-Induced Colitis Mice: The Crucial Role of AP-1, NF-kappaB, and JAK/STAT Signaling. Cells 2019, 8, 1163. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, K.; Lv, Q.; Miao, Y.M.; Qiao, S.M.; Dai, Y.; Wei, Z.F. Cardamonin, a natural flavone, alleviates inflammatory bowel disease by the inhibition of NLRP3 inflammasome activation via an AhR/Nrf2/NQO1 pathway. Biochem. Pharmacol. 2018, 155, 494–509. [Google Scholar] [CrossRef] [Scilit]
- Huang, X.T.; Liu, W.; Zhou, Y.; Sun, M.; Yang, H.H.; Zhang, C.Y.; Tang, S.Y. Galectin-1 ameliorates lipopolysaccharide-induced acute lung injury via AMPK-Nrf2 pathway in mice. Free Radic. Biol. Med. 2020, 146, 222–233. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sun, H.; Zhang, S.; Zhang, A.; Yan, G.; Wu, X.; Han, Y.; Wang, X. Metabolomic analysis of diet-induced type 2 diabetes using UPLC/MS integrated with pattern recognition approach. PLoS ONE 2014, 9, e93384. [Google Scholar] [CrossRef] [Scilit]
- Oz, H.S.; Chen, T.S.; Nagasawa, H. Comparative efficacies of 2 cysteine prodrugs and a glutathione delivery agent in a colitis model. Transl. Res. 2007, 150, 122–129. [Google Scholar] [CrossRef] [Scilit]
- Gao, X.; Guo, R.; Li, Y.; Kang, G.; Wu, Y.; Cheng, J.; Jia, J.; Wang, W.; Li, Z.; Wang, A.; et al. Contribution of upregulated aminoacyl-tRNA biosynthesis to metabolic dysregulation in gastric cancer. J. Gastroenterol. Hepatol. 2021, 36, 3113–3126. [Google Scholar] [CrossRef] [Scilit]
- D’Argenio, G.; Calvani, M.; Casamassimi, A.; Petillo, O.; Margarucci, S.; Rienzo, M.; Peluso, I.; Calvani, R.; Ciccodicola, A.; Caporaso, N.; et al. Experimental colitis: Decreased Octn2 and Atb0+ expression in rat colonocytes induces carnitine depletion that is reversible by carnitine-loaded liposomes. FASEB J. 2006, 20, 2544–2546. [Google Scholar] [CrossRef] [Scilit]
- Newman, B.; Gu, X.; Wintle, R.; Cescon, D.; Yazdanpanah, M.; Liu, X.; Peltekova, V.; Van Oene, M.; Amos, C.I.; Siminovitch, K.A. A risk haplotype in the Solute Carrier Family 22A4/22A5 gene cluster influences phenotypic expression of Crohn’s disease. Gastroenterology 2005, 128, 260–269. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liao, Z.; Zhang, S.; Liu, W.; Zou, B.; Lin, L.; Chen, M.; Liu, D.; Wang, M.; Li, L.; Cai, Y.; et al. LC-MS-based metabolomics analysis of Berberine treatment in ulcerative colitis rats. J. Chromatogr. B Analyt. Technol. Biomed. Life Sci. 2019, 1133, 121848. [Google Scholar] [CrossRef] [Scilit] [PubMed]













| Gene | Gene Sequence | Accession Number | |
|---|---|---|---|
| β-actin | Forward primer | TGCTGTCCCTGTATGCCTCTG | NM_007393 |
| Reverse primer | CTGTAGCCACGCTCGGTCA | ||
| NLRP3 | Forward primer | TGAACAGAGCCCCTGTAGGTAG | XM_036156549 |
| Reverse primer | TTGTTCTTTATCCACTGCCGAG | ||
| GSDMD | Forward primer | GAAAGATTTTACAGGACCAGCC | XM_006521343 |
| Reverse primer | CTTGACAATAGGAACAGGGAGG | ||
| Keap1 | Forward primer | GCCCGGGAGTATATCTACATGC | NM_001110307 |
| Reverse primer | CATCCGCCACTCATTCCTCT | ||
| Caspase-1 | Forward primer | TTCAAAAATTGCATCCGTTAAG | NM_009807 |
| Reverse primer | TTGAAAGACAAGCCCAAGGTG | ||
| ASC | Forward primer | TCTTGTCTTGGCTGGTGGTCT | NM_023258 |
| Reverse primer | ATCTGGAGTCGTATGGCTTGG | ||
| Nrf2 | Forward primer | CTTCCATTTACGGAGACCCAC | NM_010902 |
| Reverse primer | CATTGGGATTCACGCATAGGA | ||
| HO-1 | Forward primer | GCTGGTGATGGCTTCCTTGT | NM_010442 |
| Reverse primer | GCATAGACTGGGTTCTGCTTGTT | ||
| NQO1 | Forward primer | AGGACGCCTGAGCCCAGATA | XM_036153810 |
| Reverse primer | CTGGAAAGGACCGTTGTCGTAC | ||
| IL-1β | Forward primer | AGGCAGGCAGTATCACTCATTG | XM_006498795 |
| Reverse primer | CGTCACACACCAGCAGGTTATC |
| Forecast Name | Formula | m/z | Retention Time | ppm | Sample 1 | Sample 2 | Sample 3 |
|---|---|---|---|---|---|---|---|
| Homovanillic acid | C9H10O4 | 183.07 | 168.23 | 2.53 | 52700113.89 | 54429312.49 | 59345516 |
| Hydroquinone | C6H6O2 | 110.02 | 764.41 | 0.05 | 1260209574 | 4236266335 | 5676053369 |
| Isoproterenol | C11H17NO3 | 194.11 | 755.64 | 19.29 | 35845622.15 | 39613804.54 | 35094556.51 |
| Norepinephrine | C8H11NO3 | 169.05 | 323.93 | 5.93 | 77926318 | 82202776.03 | 80226125.76 |
| p-Synephrine | C9H13NO2 | 150.09 | 319.16 | 27.67 | 52490375.21 | 58003743.35 | 57080320.62 |
| Sinapyl alcohol | C11H14O4 | 193.09 | 415.71 | 1.42 | 33910641 | 32486078.48 | 30376260.19 |
| Tyrosol | C8H10O2 | 139.07 | 327.78 | 2.85 | 1272156773 | 1285278177 | 1147555904 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chao, L.; Lin, J.; Zhou, J.; Du, H.; Chen, X.; Liu, M.; Qu, Q.; Lv, W.; Guo, S. Polyphenol Rich Forsythia suspensa Extract Alleviates DSS-Induced Ulcerative Colitis in Mice through the Nrf2-NLRP3 Pathway. Antioxidants 2022, 11, 475. https://doi.org/10.3390/antiox11030475
Chao L, Lin J, Zhou J, Du H, Chen X, Liu M, Qu Q, Lv W, Guo S. Polyphenol Rich Forsythia suspensa Extract Alleviates DSS-Induced Ulcerative Colitis in Mice through the Nrf2-NLRP3 Pathway. Antioxidants. 2022; 11(3):475. https://doi.org/10.3390/antiox11030475
Chicago/Turabian StyleChao, Limin, Jin Lin, Jing Zhou, Hongliang Du, Xiaoli Chen, Mengjie Liu, Qian Qu, Weijie Lv, and Shining Guo. 2022. "Polyphenol Rich Forsythia suspensa Extract Alleviates DSS-Induced Ulcerative Colitis in Mice through the Nrf2-NLRP3 Pathway" Antioxidants 11, no. 3: 475. https://doi.org/10.3390/antiox11030475
APA StyleChao, L., Lin, J., Zhou, J., Du, H., Chen, X., Liu, M., Qu, Q., Lv, W., & Guo, S. (2022). Polyphenol Rich Forsythia suspensa Extract Alleviates DSS-Induced Ulcerative Colitis in Mice through the Nrf2-NLRP3 Pathway. Antioxidants, 11(3), 475. https://doi.org/10.3390/antiox11030475
