Effect of a Carotenoid Extract from Citrus reticulata By-Products on the Immune-Oxidative Status of Broilers
Abstract
:1. Introduction
2. Materials and Methods
2.1. Solvents and Standards
2.2. Carotenoids Supplement
2.2.1. Cold Pressure Essential Oil (CPEO) Extraction of Citrus reticulata
Separation of the CPEO Non-Volatile Fraction
Content of CPEO’s Non-Volatile Fraction
Preparation of Citrus reticulata-Based Feed Additive
2.2.2. Carotenoid Characterization
Saponification
Preparation of Standard Stock Solutions
Liquid Chromatography-Mass Spectrometry (LC/MS-MS)
2.3. Antimicrobial Potential of Carotenoids Feed Additive
2.3.1. Preparation of Extract
2.3.2. Microbial Strains
2.3.3. Measurement of Viable Bacteria Using MTT Viability Assay
2.4. Broilers’ Trial
2.4.1. Diets’ Formulation
2.4.2. Determination of Performance Parameters
2.4.3. Sample Collection
2.4.4. Physical and Color Traits
2.4.5. Molecular Analysis
RNA Isolation and cDNA Synthesis
Primers’ Design
Real-Time Quantitative PCR
2.4.6. Biochemical Analyses
Hematological and Biochemical Parameters in Blood
Antioxidant Enzymes Activities and Oxidative Status Indicators in Blood Plasma
Breast Muscle Antioxidant Status
Breast Muscle Fatty Acid Profile
2.5. Statistical Analysis
3. Results
3.1. Carotenoid’s Composition in Feed Additive
3.2. In Vitro Antimicrobial Potential of Citrus reticulata Feed Additive
3.3. Broilers Measurement
3.3.1. Growth Performance
3.3.2. Breast Meat Traits and Fatty Acid Profile
3.3.3. Breast Muscle Total Antioxidant Capacity and Lipid Peroxidation
3.4. Haematological and Biochemical Parameters in Blood
3.5. Antioxidant Status
3.5.1. Relative Transcript Levels of Genes Involved in Oxidative Status in the Liver
3.5.2. Antioxidant Enzymes Activities, Total Antioxidant Capacity, and Oxidative Status in Blood Plasma
3.6. Transcriptional Profiling of Immune-Related Genes
3.6.1. Relative Transcript Levels of Genes Regulating the Immune System in Liver
3.6.2. Relative Transcript Levels of Genes Regulating the Immune System in the Spleen
3.6.3. Relative Transcript Levels of Genes Regulating the Immune System in the Bursa of Fabricius
4. Discussion
4.1. b-Cryptoxanthin: An Antioxidant Ally from Citrus reticulata
4.2. Although Broilers Performance and Carcass Traits Were Not Substantially Affected, Meat Oxidative Stability Was Slightly Improved
4.3. Citrus Extract Modified Liver and Blood Oxidative Balance
4.4. The Pro-Inflammatory Mediators Were Downregulated at Transcriptional Level
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Aminov, R.I. A Brief History of the Antibiotic Era: Lessons Learned and Challenges for the Future. Front. Microbiol. 2010, 1, 134. [Google Scholar] [CrossRef] [Green Version]
- Zhai, H.; Liu, H.; Wang, S.; Wu, J.; Kluenter, A.-M. Potential of essential oils for poultry and pigs. Anim. Nutr. 2018, 4, 179–186. [Google Scholar] [CrossRef]
- Lillehoj, H.; Liu, Y.; Calsamiglia, S.; Fernandez-Miyakawa, M.E.; Chi, F.; Cravens, R.L.; Oh, S.; Gay, C.G. Phytochemicals as antibiotic alternatives to promote growth and enhance host health. Vet. Res. 2018, 49, 1–18. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mavrommatis, A.; Giamouri, E.; Myrtsi, E.D.; Evergetis, E.; Filippi, K.; Papapostolou, H.; Koulocheri, S.D.; Zoidis, E.; Pappas, A.C.; Koutinas, A.; et al. Antioxidant Status of Broiler Chickens Fed Diets Supple-mented with Vinification By-Products: A Valorization Approach. Antioxidants 2021, 10, 1250. [Google Scholar] [CrossRef] [PubMed]
- Oikeh, E.I.; Omoregie, E.S.; Oviasogie, F.E.; Oriakhi, K. Phytochemical, antimicrobial, and antioxidant activities of different citrus juice concentrates. Food Sci. Nutr. 2016, 4, 103–109. [Google Scholar] [CrossRef] [PubMed]
- Nieto, G.; Fernández-lópez, J.; Pérez-álvarez, J.A.; Peñalver, R.; Ros, G.; Viuda-martos, M. Valorization of citrus co-products: Recovery of bioactive compounds and application in meat and meat products. Plants 2021, 10, 69. [Google Scholar] [CrossRef] [PubMed]
- Raimondo, M.; Caracciolo, F.; Cembalo, L.; Chinnici, G.; Pecorino, B.; D’Amico, M. Making Virtue Out of Necessity: Managing the Citrus Waste Supply Chain for Bioeconomy Applications. Sustainability 2018, 10, 4821. [Google Scholar] [CrossRef] [Green Version]
- Nabi, F.; Arain, M.A.; Rajput, N.; Alagawany, M.; Soomro, J.; Umer, M.; Soomro, F.; Wang, Z.; Ye, R.; Liu, J. Health benefits of carotenoids and potential application in poultry industry: A review. J. Anim. Physiol. Anim. Nutr. 2020, 104, 1809–1818. [Google Scholar] [CrossRef]
- Righi, F.; Pitino, R.; Manuelian, C.L.; Simoni, M.; Quarantelli, A.; De Marchi, M.; Tsiplakou, E. Plant Feed Additives as Natural Alternatives to the Use of Synthetic Antioxidant Vitamins on Poultry Performances, Health, and Oxidative Status: A Review of the Literature in the Last 20 Years. Antioxidants 2021, 10, 659. [Google Scholar] [CrossRef]
- Faruk, M.U.; Roos, F.F.; Cisneros-Gonzalez, F. A meta-analysis on the effect of canthaxanthin on egg production in brown egg layers. Poult. Sci. 2018, 97, 84–87. [Google Scholar] [CrossRef]
- Wan, Y.; Ma, R.; Qi, R.; Li, Y.; Liu, W.; Li, J.; Liu, L.; Zheng, J.; Yue, J.; Zhan, K. Dietary fresh lemon improves the albumen quality, immune status and lipid metabolism of Jingfen laying hens during the late laying period. Ital. J. Anim. Sci. 2021, 20, 834–841. [Google Scholar] [CrossRef]
- Sahin, N.; Orhan, C.; Tuzcu, M.; Sahin, K.; Kucuk, O. The effects of tomato powder supplementation on performance and lipid Scientific Opinion of the Panel on Additives and Products or Substances used in Animal Feed (FEEDAP) on a request from the European Commission on the consequences for the consumer of the use of vitamin A in animal nutriperoxidation in quail. Poult. Sci. 2008, 87, 276–283. [Google Scholar] [CrossRef]
- Sahin, K.; Orhan, C.; Akdemir, F.; Tuzcu, M.; Ali, S.; Sahin, N. Tomato powder supplementation activates Nrf-2 via ERK/Akt signaling pathway and attenuates heat stress-related responses in quails. Anim. Feed Sci. Technol. 2011, 165, 230–237. [Google Scholar] [CrossRef]
- Rosa, A.P.; Bonilla, C.E.V.; Londero, A.; Giacomini, C.B.S.; Orso, C.; Fernandes, M.O.; Moura, J.S.; Hermes, R. Effect of broiler breeders fed with corn or sorghum and canthaxanthin on lipid peroxidation, fatty acid profile of hatching eggs, and offspring performance. Poult. Sci. 2017, 96, 647–658. [Google Scholar] [CrossRef] [PubMed]
- Ren, Z.Z.; Zeng, Q.F.; Wang, J.P.; Ding, X.M.; Bai, S.P.; Su, Z.W.; Xuan, Y.; Zhang, K.Y. Effects of maternal dietary canthaxanthin and 25-hydroxycholecalciferol supplementation on antioxidant status and calcium-phosphate metabolism of progeny ducks. Poult. Sci. 2018, 97, 1361–1367. [Google Scholar] [CrossRef]
- Englmaierovà, M.; Bubancovà, I.; Vít, T.; Skøivan, M. The effect of lycopene and vitamin E on growth performance, quality and oxidative stability of chicken leg meat. Czech J. Anim. Sci. 2011, 56, 536–543. [Google Scholar] [CrossRef] [Green Version]
- Hosseini-Vashan, S.J.; Golian, A.; Yaghobfar, A. Growth, immune, antioxidant, and bone responses of heat stress-exposed broilers fed diets supplemented with tomato pomace. Int. J. Biometeorol. 2016, 60, 1183–1192. [Google Scholar] [CrossRef]
- Kapsaski-Kanelli, V.N.; Evergetis, E.; Michaelakis, A.; Papachristos, D.; Myrtsi, E.D.; Koulocheri, S.D.; Haroutounian, S.A. “Gold” Pressed Essential Oil: An Essay on the Volatile Fragment from Citrus Juice Industry By-Products Chemistry and Bioactivity. BioMed Res. Int. 2017, 2017, 2761461. [Google Scholar] [CrossRef] [Green Version]
- Myrtsi, E.D.; Angelis, A.; Koulocheri, S.D.; Mitakou, S.; Haroutounian, S.A. Retrieval of High Added Value Natural Bioactive coumarins from Mandarin Juice-making Industrial By-product. Molecules 2021, 26, 7527. [Google Scholar] [CrossRef] [PubMed]
- Hart, D.J.; Scott, K.J. Development and evaluation of an HPLC method for the analysis of carotenoids in foods, and the measurement of the carotenoid content of vegetables and fruits commonly consumed in the UK. Food Chem. 1995, 54, 101–111. [Google Scholar] [CrossRef]
- Takehara, M.; Nishimura, M.; Kuwa, T.; Inoue, Y.; Kitamura, C.; Kumagai, T.; Honda, M. Characterization and Thermal Isomerization of (all-E)-Lycopene. J. Agric. Food Chem. 2014, 62, 264–269. [Google Scholar] [CrossRef]
- Benov, L. Effect of growth media on the MTT colorimetric assay in bacteria. PLoS ONE 2019, 14, e0219713. [Google Scholar] [CrossRef]
- European Food Safety Authority (EFSA). Scientific Opinion of the Panel on Additives and Products or Substances used in Animal Feed (FEEDAP) on a request from the European Commission on the consequences for the consumer of the use of vitamin A in animal nutrition. EFSA J. 2008, 873, 1–81. [Google Scholar]
- EFSA FEEDAP Panel (EFSA Panel on Additives and Products or Substances used in Animal Feed). Scientific opinion on the safety and efficacy of canthaxanthin as a feed additive for poultry and for ornamental birds and ornamental fish. EFSA J. 2014, 12, 3527. [Google Scholar] [CrossRef]
- Commission Internationale de l’Éclairage (CIE). Calculation and Measurement of Luminance and Illuminance in Road Lighting, CIE 030:1976; Commision Internanionale de l’Eclairage: Vienna, Austria, 1976; ISBN 978-9-290340-30-0. [Google Scholar]
- Cason, J.A.; Lyon, C.E.; Papa, C.M. Effect of Muscle Opposition during Rigor on Development of Broiler Breast Meat Tenderness. Poult. Sci. 1997, 76, 785–787. [Google Scholar] [CrossRef]
- Mavrommatis, A.; Simitzis, P.E.; Kyriakaki, P.; Giamouri, E.; Myrtsi, E.D.; Evergetis, E.; Filippi, K.; Papapostolou, H.; Koulocheri, S.D.; Pappas, A.C.; et al. Immune-related gene expression profiling of broiler chickens fed diets supplemented with vinification byproducts: A valorization approach ii. Animals 2021, 11, 38. [Google Scholar] [CrossRef] [PubMed]
- Mavrommatis, A.; Mitsiopoulou, C.; Christodoulou, C.; Karabinas, D.; Nenov, V.; Zervas, G.; Tsiplakou, E. Dietary supplementation of a live yeast product on dairy sheep milk performance, oxidative and immune status in peripartum period. J. Fungi 2020, 6, 334. [Google Scholar] [CrossRef]
- Tsiplakou, E.; Mitsiopoulou, C.; Mavrommatis, A.; Karaiskou, C.; Chronopoulou, E.G.; Mavridis, G.; Sotirakoglou, K.; Labrou, N.E.; Zervas, G. Effect of under- and overfeeding on sheep and goat milk and plasma enzymes activities related to oxidation. J. Anim. Physiol. Anim. Nutr. 2018, 102, 288–298. [Google Scholar] [CrossRef] [PubMed]
- Park, J.H.; Kang, S.N.; Shin, D.; Shim, K.S. Antioxidant enzyme activity and meat quality of meat type ducks fed with dried oregano (Origanum vulgare L.) powder. Asian-Australas. J. Anim. Sci. 2015, 28, 79–85. [Google Scholar] [CrossRef] [PubMed]
- Martínez, J.; Nieto, G.; Ros, G. Total antioxidant capacity of meat and meat products consumed in a reference “Spanish standard diet”. Int. J. Food Sci. Technol. 2014, 49, 2610–2618. [Google Scholar] [CrossRef]
- O’Fallon, J.V.; Busboom, J.R.; Nelson, M.L.; Gaskins, C.T. A direct method for fatty acid methyl ester synthesis: Application to wet meat tissues, oils, and feedstuffs. J. Anim. Sci. 2007, 85, 1511–1521. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Alquézar, B.; Rodrigo, M.; Zacarías, L. Carotenoid biosynthesis and their regulation in citrus fruits. Tree For. Sci. Biotechnol. 2008, 2, 23–37. [Google Scholar]
- Burri, B.J.; La Frano, M.R.; Zhu, C. Absorption, metabolism, and functions of β-cryptoxanthin. Nutr. Rev. 2016, 74, 69–82. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mohamed, M.N.; Shuaib, Y.A.; Suliman, S.E.; Abdalla, A.M.A. Common Pathogenic Bacteria Isolated from Broiler Chicken Farms in Khartoum State. J. Sci. Technol. 2013, 14, 14–18. [Google Scholar]
- Rouger, A.; Tresse, O.; Zagorec, M. Bacterial Contaminants of Poultry Meat: Sources, Species, and Dynamics. Microorganisms 2017, 5, 50. [Google Scholar] [CrossRef] [PubMed]
- Franklin-Alming, F.V.; Kaspersen, H.; Hetland, M.A.K.; Bakksjø, R.J.; Nesse, L.L.; Leangapichart, T.; Löhr, I.H.; Telke, A.A.; Sunde, M. Exploring Klebsiella pneumoniae in Healthy Poultry Reveals High Genetic Diversity, Good Biofilm-Forming Abilities and Higher Prevalence in Turkeys Than Broilers. Front. Microbiol. 2021, 12, 2609. [Google Scholar] [CrossRef]
- Karpiński, T.M.; Adamczak, A. Fucoxanthin—An antibacterial carotenoid. Antioxidants 2019, 8, 239. [Google Scholar] [CrossRef] [Green Version]
- Liu, Z.; Sun, X.; Sun, X.; Wang, S.; Xu, Y. Fucoxanthin Isolated from Undaria pinnatifida Can Interact with Escherichia coli and lactobacilli in the Intestine and Inhibit the Growth of Pathogenic Bacteria. J. Ocean Univ. China 2019, 18, 926–932. [Google Scholar] [CrossRef]
- Lu, T.; Harper, A.F.; Dibner, J.J.; Scheffler, J.M.; Corl, B.A.; Estienne, M.J.; Zhao, J.; Dalloul, R.A. Supplementing antioxidants to pigs fed diets high in oxidants: II. Effects on carcass characteristics, meat quality, and fatty acid profile. J. Anim. Sci. 2014, 92, 5464–5475. [Google Scholar] [CrossRef]
- Surai, P.F.; Speake, B.K.; Sparks, N.H.C. Carotenoids in Avian Nutrition and Embryonic Development. 2. Antioxidant Properties and Discrimination in Embryonic Tissues. J. Poult. Sci. 2001, 38, 117–145. [Google Scholar] [CrossRef] [Green Version]
- Inoue, H.; Shimamoto, S.; Takahashi, H.; Kawashima, Y.; Wataru, S.; Ijiri, D.; Ohtsuka, A. Effects of astaxanthin-rich dried cell powder from Paracoccus carotinifaciens on carotenoid composition and lipid peroxidation in skeletal muscle of broiler chickens under thermo-neutral or realistic high temperature conditions. Anim. Sci. J. 2019, 90, 229–236. [Google Scholar] [CrossRef] [Green Version]
- Vlaicu, P.A.; Untea, A.E.; Panaite, T.D.; Turcu, R.P. Effect of dietary orange and grapefruit peel on growth performance, health status, meat quality and intestinal microflora of broiler chickens. Ital. J. Anim. Sci. 2020, 19, 1394–1405. [Google Scholar] [CrossRef]
- Yarmohammadi, S.; Hosseini-Ghatar, R.; Foshati, S.; Moradi, M.; Hemati, N.; Moradi, S.; Kermani, M.A.H.; Farzaei, M.H.; Khan, H. Effect of Chlorella vulgaris on Liver Function Biomarkers: A Systematic Review and Meta-Analysis. Clin. Nutr. Res. 2021, 10, 83. [Google Scholar] [CrossRef] [PubMed]
- Elvira-Torales, L.I.; García-Alonso, J.; Periago-Castón, M.J. Nutritional importance of carotenoids and their effect on liver health: A review. Antioxidants 2019, 8, 229. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rajput, N.; Naeem, M.; Ali, S.; Zhang, J.F.; Zhang, L.; Wang, T. The effect of dietary supplementation with the natural carotenoids curcumin and lutein on broiler pigmentation and immunity. Poult. Sci. 2013, 92, 1177–1185. [Google Scholar] [CrossRef] [PubMed]
- Amengual, J.; Coronel, J.; Marques, C.; Aradillas-García, C.; Morales, J.M.V.; Andrade, F.C.D.; Erdman, J.W.; Teran-Garcia, M. β-Carotene oxygenase 1 activity modulates circulating cholesterol concentrations in mice and humans. J. Nutr. 2020, 150, 2023–2030. [Google Scholar] [CrossRef] [PubMed]
- Ighodaro, O.M.; Akinloye, O.A. First line defence antioxidants-superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GPX): Their fundamental role in the entire antioxidant defence grid. Alex. J. Med. 2018, 54, 287–293. [Google Scholar] [CrossRef] [Green Version]
- Islam, M.N.; Rauf, A.; Fahad, F.I.; Emran, T.B.; Mitra, S.; Olatunde, A.; Shariati, M.A.; Rebezov, M.; Rengasamy, K.R.R.; Mubarak, M.S. Superoxide dismutase: An updated review on its health benefits and industrial applications. Crit. Rev. Food Sci. Nutr. 2021, 1–19. [Google Scholar] [CrossRef] [PubMed]
- Bohn, T. Carotenoids and Markers of Oxidative Stress in Human Observational Studies and Intervention Trials: Implications for Chronic Diseases. Antioxidants 2019, 8, 179. [Google Scholar] [CrossRef] [Green Version]
- Zelinová, V.; Mistrík, I.; Pavlovkin, J.; Tamás, L. Glutathione peroxidase expression and activity in barley root tip after short-term treatment with cadmium, hydrogen peroxide and t-butyl hydroperoxide. Protoplasma 2013, 250, 1057–1065. [Google Scholar] [CrossRef]
- Pigeolet, E.; Corbisier, P.; Houbion, A.; Lambert, D.; Michiels, C.; Raes, M.; Zachary, M.D.; Remacle, J. Glutathione peroxidase, superoxide dismutase, and catalase inactivation by peroxides and oxygen derived free radicals. Mech. Ageing Dev. 1990, 51, 283–297. [Google Scholar] [CrossRef]
- Tripoli, E.; Giammanco, M.; Tabacchi, G.; Di Majo, D.; Giammanco, S.; La Guardia, M. The phenolic compounds of olive oil: Structure, biological activity and beneficial effects on human health. Nutr. Res. Rev. 2005, 18, 98–112. [Google Scholar] [CrossRef] [PubMed]
- Krych, J.; Gebicka, L. Catalase is inhibited by flavonoids. Int. J. Biol. Macromol. 2013, 58, 148–153. [Google Scholar] [CrossRef] [PubMed]
- Galvez, J.; De La Cruz, J.P.; Zarzuelo, A.; De La Cuesta, F.S. Flavonoid Inhibition of Enzymic and Nonenzymic Lipid Peroxidation in Rat Liver Differs from Its Influence on the Glutathione-Related Enzymes. Pharmacology 1995, 51, 127–133. [Google Scholar] [CrossRef]
- Castenmiller, J.J.M.; Lauridsen, S.T.; Dragsted, L.O.; Hof, K.H.V.H.; Linssen, J.P.H.; West, C.E. β-Carotene Does Not Change Markers of Enzymatic and Nonenzymatic Antioxidant Activity in Human Blood. J. Nutr. 1999, 129, 2162–2169. [Google Scholar] [CrossRef] [Green Version]
- Maraldi, T. Natural Compounds as Modulators of NADPH Oxidases. Oxidative Med. Cell. Longev. 2013, 2013, 1–10. [Google Scholar] [CrossRef] [Green Version]
- Steffen, Y.; Gruber, C.; Schewe, T.; Sies, H. Mono-O-methylated flavanols and other flavonoids as inhibitors of endothelial NADPH oxidase. Arch. Biochem. Biophys. 2007, 469, 209–219. [Google Scholar] [CrossRef]
- Csernus, B.; Biró, S.; Babinszky, L.; Komlósi, I.; Jávor, A.; Stündl, L.; Remenyik, J.; Bai, P.; Oláh, J.; Pesti-Asbóth, G.; et al. Effect of Carotenoids, Oligosaccharides and Anthocyanins on Growth Performance, Immunological Parameters and Intestinal Morphology in Broiler Chickens Challenged with Escherichia coli Lipopolysaccharide. Animals 2020, 10, 347. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lee, S.J.; Bai, S.K.; Lee, K.S.; Namkoong, S.; Na, H.J.; Ha, K.S.; Han, J.A.; Yim, S.V.; Chang, K.; Kwon, Y.G.; et al. Astaxanthin inhibits nitric oxide production and inflammatory gene expression by suppressing IκB kinase-dependent NF-κB activation. Mol. Cells 2003, 16, 97–105. [Google Scholar]
- Gao, Y.Y.; Xie, Q.M.; Jin, L.; Sun, B.L.; Ji, J.; Chen, F.; Ma, J.Y.; Bi, Y.Z. Supplementation of xanthophylls decreased proinflammatory and increased anti-inflammatory cytokines in hens and chicks. Br. J. Nutr. 2012, 108, 1746–1755. [Google Scholar] [CrossRef]
- Kawata, A.; Murakami, Y.; Suzuki, S.; Fujisawa, S. Anti-inflammatory Activity of β-Carotene, Lycopene and Tri-n-butylborane, a Scavenger of Reactive Oxygen Species. In Vivo 2018, 32, 255–264. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, M.; Jiang, X.; Chen, A.; Chen, T.; Cheng, Y.; Wu, X. Transcriptome analysis reveals the potential mechanism of dietary carotenoids improving antioxidative capability and immunity of juvenile Chinese mitten crabs Eriocheir sinensis. Fish Shellfish Immunol. 2020, 104, 359–373. [Google Scholar] [CrossRef] [PubMed]
- Yang, D.; Elner, S.G.; Bian, Z.M.; Till, G.O.; Petty, H.R.; Elner, V.M. Pro-inflammatory cytokines increase reactive oxygen species through mitochondria and NADPH oxidase in cultured RPE cells. Exp. Eye Res. 2007, 85, 462–472. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kaur, J.; Dhaunsi, G.S.; Turner, R.B. Interleukin-1 and nitric oxide increase NADPH oxidase activity in human coronary artery smooth muscle cells. Med. Princ. Pract. 2004, 13, 26–29. [Google Scholar] [CrossRef]
- Kogut, M.H.; Genovese, K.J.; Swaggerty, C.L.; He, H.; Broom, L. Inflammatory phenotypes in the intestine of poultry: Not all inflammation is created equal. Poult. Sci. 2018, 97, 2339–2346. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.; Li, L.; Yuan, D.; Zhao, X.; Cui, S.; Hu, J.; Wang, J. Reduction of the allergenic protein in soybean meal by enzymatic hydrolysis. Food Agric. Immunol. 2014, 25, 301–310. [Google Scholar] [CrossRef]
Carotenoids | Equation | R2 | Retention Time (min) |
---|---|---|---|
Fucoxanthin | Y = −5095.71 + 64,509.9X | 0.9987 | 2.73 |
Astaxanthin | Y = −8606.49 + 44,409.2X | 0.9996 | 4.67 |
Lutein | Y = −8753.93 + 302,049X | 0.9996 | 5.66 |
Zeaxanthin | Y = −44,000.3 + 629,033X | 0.9995 | 6.40 |
Canthaxanthin | Y = −5054.97 + 13,102.6X | 1.0000 | 8.45 |
β-Cryptoxanthin | Y = −4777.46 + 33,248.5X | 0.9997 | 13.90 |
α-Carotene | Y = −182,698 + 9.24063e + 0.006X | 0.9997 | 22.59 |
β-Carotene | Y = 7951.8 + 2.9564e + 0.006X | 0.9993 | 25.64 |
Ingredients | Dietary Treatment | |||||
---|---|---|---|---|---|---|
CON | CCE | CON | CCE | CON | CE | |
Starter Period (Day 1–10) | Grower Period (Day 11–24) | Finisher Period (Day 25–42) | ||||
Composition % | ||||||
Maize | 50.52 | 50.42 | 53.90 | 53.80 | 59.35 | 59.25 |
Soyabean meal | 40.89 | 40.89 | 37.09 | 37.09 | 31.49 | 31.49 |
Soybean oil | 4.03 | 4.03 | 4.97 | 4.97 | 5.41 | 5.41 |
Vitamin and mineral premix 1 | 0.2 | 0.2 | 0.2 | 0.2 | 0.2 | 0.2 |
Limestone | 1.61 | 1.61 | 1.47 | 1.47 | 1.34 | 1.34 |
NaCl | 0.40 | 0.40 | 0.4 | 0.4 | 0.40 | 0.40 |
Monocalcium phosphate | 1.43 | 1.43 | 1.22 | 1.22 | 1.09 | 1.09 |
Methionine | 0.41 | 0.41 | 0.36 | 0.36 | 0.34 | 0.34 |
Lysine | 0.27 | 0.27 | 0.20 | 0.20 | 0.21 | 0.21 |
Threonine | 0.15 | 0.15 | 0.11 | 0.11 | 0.08 | 0.08 |
Choline | 0.09 | 0.09 | 0.08 | 0.08 | 0.09 | 0.09 |
Citrus carotenoid extract included in starch | - | 0.1 | - | 0.1 | - | 0.1 |
Chemical analysis % | ||||||
Dry matter % | 91.5 | 90.5 | 91.4 | 89.9 | 90.0 | 91.1 |
Ash % | 6.7 | 6.6 | 6.7 | 6.6 | 6.7 | 6.6 |
Crude protein % | 24 | 23.9 | 21.9 | 21.4 | 19.8 | 19.8 |
Ether exctract % | 5.7 | 5.6 | 6.6 | 6.4 | 7.3 | 7 |
Crude fiber % | 2.2 | 2.4 | 2.3 | 2.4 | 2.3 | 2.5 |
ME (MJ/kg) | 12.5 | 12.5 | 13 | 13 | 13.4 | 13.4 |
Sodium % | 0.16 | 0.16 | 0.16 | 0.16 | 0.16 | 0.16 |
Calcium % | 0.96 | 0.96 | 0.87 | 0.87 | 0.79 | 0.79 |
Phosphorus % | 0.48 | 0.48 | 0.43 | 0.43 | 0.4 | 0.4 |
Lysine % | 1.44 | 1.44 | 1.29 | 1.29 | 1.16 | 1.16 |
Methionine and cysteine | 1.08 | 1.08 | 0.99 | 0.99 | 0.91 | 0.91 |
Threonine % | 0.97 | 0.97 | 0.88 | 0.88 | 0.78 | 0.78 |
Gene | Sequence | Amplicon bp | Accession No. * | References |
---|---|---|---|---|
GAPDH | F: 5′- GCTGGCATTGCACTGAATGAC -3′ | 113 | NM_204305.1 | [4] |
R: 5′- CACTCCTTGGATGCCATGT -3′ | ||||
ACTB | F: 5′- AGCGAACGCCCCCAAAGTTCT -3′ | 139 | NM_205518.1 | [4] |
F: 5′- AGCTGGGCTGTTGCCTTCACA -3′ | ||||
CAT | R: 5′- TGGCGGTAGGAGTCTGGTCT -3′ | 112 | NM_001031215.1 | [4] |
R: 5′- GTCCCGTCCGTCAGCCATTT -3′ | ||||
GPX1 | F: 5′- AACCAATTCGGGCACCAG -3′ | 122 | NM_001277853.2 | [4] |
R: 5′- CCGTTCACCTCGCACTTCTC -3′ | ||||
GPX2 | F: 5′- GAGCCCAACTTCACCCTGTT -3′ | 75 | NM_001277854.2 | [4] |
R: 5′- CTTCAGGTAGGCGAAGACGG -3′ | ||||
SOD1 (CuZn) | F: 5′- CACTGCATCATTGGCCGTACCA -3′ | 224 | NM_205064.1 | [4] |
R: 5′- GCTTGCACACGGAAGAGCAAGT -3′ | ||||
GSTA2 | F: 5′- GCCTGACTTCAGTCCTTGGT -3′ | 138 | XM_015284825.3 | [4] |
R: 5′- CCACCGAATTGACTCCATCT -3′ | ||||
NOS2 | F: 5′- AAAGAAAGGGATCAAAGGTGGT -3′ | 296 | NM_204961.1 | [4] |
R: 5′- CAAGCATCCTCTTCAAAGTCTG -3′ | ||||
NOX1 | F: 5′- TCATCACTCTGGCGCTCATC -3′ | 171 | XM_040698828.1 | [4] |
R: 5′- CCTTCATGCTCTCCTCCGTC -3′ | ||||
NOX2 | F: 5′- TGGTGCGGTTTTGGAGATCA -3′ | 145 | XM_040698636.1 | [4] |
R: 5′- GACACTGCTGGGCATTTGAC -3′ | ||||
NOX3 | F: 5′- TTGGAATGGGAGAAGGCCAC-3′ | 92 | XM_040667279.1 | [4] |
R: 5′-AGCACCACAGGACTCACAAC-3′ | ||||
TLR4 | R: 5′- ACCCGAACTGCAGTTTCTGGAT -3′ | 120 | NM_001030693.1 | [27] |
R: 5′- AGGTGCTGGAGTGAATTGGC -3′ | ||||
MAPK | F: 5′- GAACGTGCGCTTCATCTACG -3′ | 137 | XM_040649449.1 | [27] |
R: 5′- CCACGGGCTTAAACGCTTTC -3′ | ||||
NFKB | F: 5′- GAAGGAATCGTACCGGGAACA -3′ | 131 | NM_205134 131 | [27] |
R: 5′- CTCAGAGGGCCTTGTGACAGTAA -3′ | ||||
TNF | F: 5′- CCCCTACCCTGTCCCACAA -3′ | 67 | NM204267 | [27] |
R: 5′- TGAGTACTGCGGAGGGTTCAT -3′ | ||||
INFA | F: 5′- ACTTCAGCTGCCTCCACACCTT -3′ | 92 | AM049251.1 | [27] |
R: 5′- CAGGAACCAGGCACGAGCTT -3′ | ||||
INFG | F: 5′- AACAACCTTCCTGATGGCGTGA -3′ | 89 | NM_205149.1 | [27] |
R: 5′- GCTTTGCGCTGGATTCTCAAGT -3′ | ||||
IL1B | F: 5′- TGCTTCGTGCTGGAGTCACCC -3′ | 98 | XM_015297469.1 | [27] |
R: 5′- GGCCGGTACAGCGCAATGTT -3′ | ||||
IL2 | F: 5′- CGTAAGTGGATGGTTTTCCTCT -3′ | 161 | NM204153 | [27] |
R: 5′- GGCTAAAGCTCACCTGGGTC -3′ | ||||
IL6 | F: 5′- AGCGAAAAGCAGAACGTCGAGTC -3′ | 107 | XM_015281283.2 | [27] |
R: 5′- GCCGAGTCTGGGATGACCACTTC -3′ | ||||
IL8 | F: 5′- CTGGCCCTCCTCCTGGTT-3′ | 105 | HM179639 | [27] |
R: 5′- GCAGCTCATTCCCCATCTTTAC -3′ | ||||
IL18 | F: 5′- GTTGTTCGATTTAGGGAAGGAG -3′ | 146 | NM204608.1 | [27] |
R: 5′- TCAAAGGCCAAGAACATTCC -3′ |
Carotenoids | Before Saponification (mg/g Non-Volatile Fraction) | After Saponification (mg/g Non-Volatile Fraction) | Total Carotenoids (mg/g Non-Volatile Fraction) | Total Carotenoids mg/100 g Starch Feed Additive, CCE) |
---|---|---|---|---|
Fucoxanthin | n.d. | n.d. | n.d. | n.d. |
Astaxanthin | tr | tr | tr | tr |
Lutein | tr | 0.033 ± 0.001 | 0.033 ± 0.001 | 0.082 ± 0.002 |
Zeaxanthin | tr | 0.10 ± 0.01 | 0.10 ± 0.01 | 0.250 ± 0.002 |
Canthaxanthin | n.d. | n.d. | n.d. | n.d. |
β-Cryptoxanthin | 1.62 ± 0.04 | 8.7 ± 0.7 | 10.3 ± 0.7 | 22 ± 2 |
α-Carotene | 0.011 ± 0.008 | tr | 0.011 ± 0.008 | tr |
β-Carotene | 0.143 ± 0.009 | 0.132 ± 0.002 | 0.143 ± 0.009 | 0.36 ± 0.02 |
Bacteria | Equation | R2 | IC50 mg/mL |
---|---|---|---|
Escherichia coli | y = −0.0268x + 0.7314 | 0.9537 | 8.63 |
Klebsiella oxytoca | y = −0.0256x + 1.038 | 0.9591 | 21.02 |
Salmonella typhimurium | y = −0.0141x + 0.6859 | 0.9803 | 13.18 |
Staphylococcus aureus | y = −0.0661x + 0.7787 | 0.8957 | 4.22 |
Dietary Treatment | ||||
---|---|---|---|---|
CON | CCE | SEM | Significance | |
Initial BW (g) | 44.08 | 44.09 | 0.54 | 0.980 |
Day 1–10 | ||||
BW (g) | 276.9 | 288.2 | 13.74 | 0.441 |
AFI (g) | 288.7 | 290.1 | 10.88 | 0.906 |
Day 11–24 | ||||
BW (g) | 1229 | 1261 | 34.79 | 0.386 |
AFI (g) | 1195 | 1215 | 29.28 | 0.525 |
Day 25–42 | ||||
BW (g) | 2976 | 3056 | 100.50 | 0.456 |
AFI (g) | 2722 | 2787 | 118.40 | 0.603 |
Day 1–42 | ||||
AFI (g) | 4205 | 4292 | 148.40 | 0.582 |
FCR | 1.43 | 1.41 | <0.001 | 0.450 |
Mortality (%) | 0 | 0 | - | - |
Carcass yield (%) | 75.81 | 76.47 | 0.655 | 0.093 |
Spleen (% of BW) | 0.094 | 0.083 | 0.011 | 0.241 |
Liver (% of BW) | 1.59 | 1.54 | 0.048 | 0.467 |
Bursa of Fabricius (% of BW) | 0.071 | 0.060 | 0.011 | 0.105 |
Dietary Treatment | ||||
---|---|---|---|---|
CON | CCE | SEM | Significance | |
Color traits | ||||
L* | 55.87 | 57.56 | 1.714 | 0.342 |
a* | 7.18 | 7.05 | 0.979 | 0.891 |
b* | 18.50 | 18.49 | 1.434 | 0.995 |
Physical traits | ||||
pH24 | 6.11 | 6.04 | 0.089 | 0.440 |
Cooking loss (%) | 11.83 | 15.39 | 1.612 | 0.044 |
Shear force (100 N/mm2) | 14.22 | 14.15 | 1.663 | 0.967 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mavrommatis, A.; Zografaki, M.-E.; Marka, S.; Myrtsi, E.D.; Giamouri, E.; Christodoulou, C.; Evergetis, E.; Iliopoulos, V.; Koulocheri, S.D.; Moschopoulou, G.; et al. Effect of a Carotenoid Extract from Citrus reticulata By-Products on the Immune-Oxidative Status of Broilers. Antioxidants 2022, 11, 144. https://doi.org/10.3390/antiox11010144
Mavrommatis A, Zografaki M-E, Marka S, Myrtsi ED, Giamouri E, Christodoulou C, Evergetis E, Iliopoulos V, Koulocheri SD, Moschopoulou G, et al. Effect of a Carotenoid Extract from Citrus reticulata By-Products on the Immune-Oxidative Status of Broilers. Antioxidants. 2022; 11(1):144. https://doi.org/10.3390/antiox11010144
Chicago/Turabian StyleMavrommatis, Alexandros, Maria-Eleftheria Zografaki, Sofia Marka, Eleni D. Myrtsi, Elisavet Giamouri, Christos Christodoulou, Epameinondas Evergetis, Vasilios Iliopoulos, Sofia D. Koulocheri, Georgia Moschopoulou, and et al. 2022. "Effect of a Carotenoid Extract from Citrus reticulata By-Products on the Immune-Oxidative Status of Broilers" Antioxidants 11, no. 1: 144. https://doi.org/10.3390/antiox11010144
APA StyleMavrommatis, A., Zografaki, M.-E., Marka, S., Myrtsi, E. D., Giamouri, E., Christodoulou, C., Evergetis, E., Iliopoulos, V., Koulocheri, S. D., Moschopoulou, G., Simitzis, P. E., Pappas, A. C., Flemetakis, E., Koutinas, A., Haroutounian, S. A., & Tsiplakou, E. (2022). Effect of a Carotenoid Extract from Citrus reticulata By-Products on the Immune-Oxidative Status of Broilers. Antioxidants, 11(1), 144. https://doi.org/10.3390/antiox11010144