Pomegranate Extract (POMx) Induces Mitochondrial Dysfunction and Apoptosis of Oral Cancer Cells
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture and Drug Source
2.2. Determination of Main Components of POMx by HPLC
2.3. Cell Viability and Morphology
2.4. Cell Cycle Analysis
2.5. Annexin V/7AAD for Apoptosis Analysis
2.6. Acridine Orange (AO) Staining for Autophagy Analysis
2.7. Mitochondrial Membrane Potential (MitoMP)
2.8. Mitochondrial Superoxide (MitoSOX) Generation
2.9. Quantitative RT-PCR (qRT-PCR) Analysis: Antioxidant- and Mitochondrial Biogenesis-Related Genes
2.10. Mitochondrial Mass
2.11. Quantitative PCR (qPCR): mtDNA Copy Number
2.12. Semi-Long Run Quantitative PCR (SLR-qPCR): mtDNA Damage
2.13. DNA Damage: γH2AX
2.14. Western Blotting Analysis for Apoptosis, Antioxidant Signaling, Mitochondrial Resident Proteins, and Mitochondrial Biogenesis
2.15. Statistics
3. Results
3.1. HPLC profile of POMx and Three Main Bioactive Components
3.2. Antiproliferation of Oral Cancer Cells Following POMx Incubation
3.3. Cell Cycle Change of Oral Cancer Cells Following POMx Incubation
3.4. Apoptosis and Autophagy Changes of Oral Cancer Cells Following POMx Incubation
3.5. MitoMP of Oral Cancer Cells Following POMx Incubation
3.6. MitoSOX Generation of Oral Cancer Cells Following POMx Incubation
3.7. Antioxidant Gene Expression of Oral Cancer Cells Following POMx Incubation
3.8. Mitochondrial Mass of Oral Cancer Cells Following POMx Incubation
3.9. Mitochondrial DNA Copy Number, Lesion and Biogenesis of Oral Cancer Cells Following POMx Incubation
3.10. γH2AX-Detected DNA Damage of Oral Cancer Cells Following POMx Incubation
4. Discussion
4.1. POMx Has a Selective Antiproliferation Function towards Cancer Cells with Safety to Normal Cells
4.2. POMx Inhibits Antioxidant Signaling to Generate Oxidative Stress
4.3. POMx Induces Mitochondrial Impairment in Oral Cancer Cells
4.4. POMx Induces Apoptosis but Inhibits Autophagy in Oral Cancer Cells
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Gene Accession Numbers
| Gene | Accession number | |
| RNA | NFE2L2 | NM_006164.5 |
| GCLC | NM_001498.4 | |
| TXN | NM_003329.4 | |
| CAT | NM_001752.4 | |
| SOD1 | NM_000454.4 | |
| HMOX1 | NM_002133.3 | |
| NQO1 | NM_000903.3 | |
| TFB2M | NM_022366.3 | |
| TFAM | NM_003201.3 | |
| POLRMT | NM_005035.4 | |
| TUFM | NM_003321.5 | |
| GAPDH | NM_002046.7 | |
| Gene | Accession number | |
| DNA | ND1 | NC_012920.1 |
| ND1-L | ||
| ND5 | ||
| ND5-L | ||
| GAPDH | NG_007073.2 |
References
- Ahmadiankia, N. Molecular targets of pomegranate (Punica granatum) in preventing cancer metastasis. Iran J. Basic Med. Sci. 2019, 22, 977–988. [Google Scholar]
- Sharma, P.; McClees, S.F.; Afaq, F. Pomegranate for prevention and treatment of cancer: An update. Molecules 2017, 22, 177. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mandal, A.; Bhatia, D.; Bishayee, A. Anti-inflammatory mechanism involved in pomegranate-mediated prevention of breast cancer: The role of NF-kappaB and Nrf2 signaling pathways. Nutrients 2017, 9, 436. [Google Scholar] [CrossRef] [Scilit]
- Singh, B.; Singh, J.P.; Kaur, A.; Singh, N. Phenolic compounds as beneficial phytochemicals in pomegranate (Punica granatum L.) peel: A review. Food Chem. 2018, 261, 75–86. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Russo, M.; Cacciola, F.; Arena, K.; Mangraviti, D.; de Gara, L.; Dugo, P.; Mondello, L. Characterization of the polyphenolic fraction of pomegranate samples by comprehensive two-dimensional liquid chromatography coupled to mass spectrometry detection. Nat. Prod. Res. 2020, 34, 39–45. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wong, T.L.; Strandberg, K.R.; Croley, C.R.; Fraser, S.E.; Venkata, K.C.N.; Fimognari, C.; Sethi, G.; Bishayee, A. Pomegranate bioactive constituents target multiple oncogenic and oncosuppressive signaling for cancer prevention and intervention. Semin Cancer Biol. 2021. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kandylis, P.; Kokkinomagoulos, E. Food applications and potential health benefits of pomegranate and its derivatives. Foods 2020, 9, 122. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.; Zhang, H.; Liang, H.; Yuan, Q. Purification, antioxidant activity and protein-precipitating capacity of punicalin from pomegranate husk. Food Chem. 2013, 138, 437–443. [Google Scholar] [CrossRef] [Scilit]
- Rasheed, Z.; Akhtar, N.; Anbazhagan, A.N.; Ramamurthy, S.; Shukla, M.; Haqqi, T.M. Polyphenol-rich pomegranate fruit extract (POMx) suppresses PMACI-induced expression of pro-inflammatory cytokines by inhibiting the activation of MAP Kinases and NF-kappaB in human KU812 cells. J. Inflamm. 2009, 6, 1. [Google Scholar] [CrossRef] [Scilit]
- Koyama, S.; Cobb, L.J.; Mehta, H.H.; Seeram, N.P.; Heber, D.; Pantuck, A.J.; Cohen, P. Pomegranate extract induces apoptosis in human prostate cancer cells by modulation of the IGF-IGFBP axis. Growth Horm. IGF Res. 2010, 20, 55–62. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.; Zhang, S.; Iqbal, S.; Chen, Z.; Wang, X.; Wang, Y.A.; Liu, D.; Bai, K.; Ritenour, C.; Kucuk, O.; et al. Pomegranate extract inhibits the bone metastatic growth of human prostate cancer cells and enhances the in vivo efficacy of docetaxel chemotherapy. Prostate 2014, 74, 497–508. [Google Scholar] [CrossRef] [Scilit]
- Hamoud, S.; Hayek, T.; Volkova, N.; Attias, J.; Moscoviz, D.; Rosenblat, M.; Aviram, M. Pomegranate extract (POMx) decreases the atherogenicity of serum and of human monocyte-derived macrophages (HMDM) in simvastatin-treated hypercholesterolemic patients: A double-blinded, placebo-controlled, randomized, prospective pilot study. Atherosclerosis 2014, 232, 204–210. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nallanthighal, S.; Elmaliki, K.M.; Reliene, R. Pomegranate extract alters breast cancer stem cell properties in association with inhibition of epithelial-to-mesenchymal transition. Nutr. Cancer 2017, 69, 1088–1098. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bouayed, J.; Bohn, T. Exogenous antioxidants—Double-edged swords in cellular redox state: Health beneficial effects at physiologic doses versus deleterious effects at high doses. Oxid. Med. Cell Longev. 2010, 3, 228–237. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Khan, N.; Hadi, N.; Afaq, F.; Syed, D.N.; Kweon, M.H.; Mukhtar, H. Pomegranate fruit extract inhibits prosurvival pathways in human A549 lung carcinoma cells and tumor growth in athymic nude mice. Carcinogenesis 2007, 28, 163–173. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Asmaa, M.J.; Ali, A.J.; Farid, J.M.; Azman, S. Growth inhibitory effects of crude pomegranate peel extract on chronic myeloid leukemia, K562 cells. Int. J. Appl. Basic Med. Res. 2015, 5, 100–105. [Google Scholar]
- Sineh Sepehr, K.; Baradaran, B.; Mazandarani, M.; Yousefi, B.; Abdollahpour Alitappeh, M.; Khori, V. Growth-inhibitory and apoptosis-inducing effects of Punica granatum L. var. spinosa (apple punice) on fibrosarcoma cell lines. Adv. Pharm. Bull. 2014, 4, 583–590. [Google Scholar] [PubMed]
- Peng, S.Y.; Hsiao, C.C.; Lan, T.H.; Yen, C.Y.; Farooqi, A.A.; Cheng, C.M.; Tang, J.Y.; Yu, T.J.; Yeh, Y.C.; Chuang, Y.T.; et al. Pomegranate extract inhibits migration and invasion of oral cancer cells by downregulating matrix metalloproteinase-2/9 and epithelial-mesenchymal transition. Environ. Toxicol. 2020, 35, 673–682. [Google Scholar] [CrossRef] [Scilit]
- Jezek, J.; Cooper, K.F.; Strich, R. Reactive oxygen species and mitochondrial dynamics: The yin and yang of mitochondrial dysfunction and cancer progression. Antioxidants 2018, 7, 13. [Google Scholar] [CrossRef] [Scilit]
- Sung, Y.J.; Kao, T.Y.; Kuo, C.L.; Fan, C.C.; Cheng, A.N.; Fang, W.C.; Chou, H.Y.; Lo, Y.K.; Chen, C.H.; Jiang, S.S.; et al. Mitochondrial Lon sequesters and stabilizes p53 in the matrix to restrain apoptosis under oxidative stress via its chaperone activity. Cell Death Dis. 2018, 9, 697. [Google Scholar] [CrossRef] [Scilit]
- Li, Y.; Yang, F.; Zheng, W.; Hu, M.; Wang, J.; Ma, S.; Deng, Y.; Luo, Y.; Ye, T.; Yin, W. Punica granatum (pomegranate) leaves extract induces apoptosis through mitochondrial intrinsic pathway and inhibits migration and invasion in non-small cell lung cancer in vitro. Biomed. Pharm. 2016, 80, 227–235. [Google Scholar] [CrossRef] [Scilit]
- Lee, S.T.; Lu, M.H.; Chien, L.H.; Wu, T.F.; Huang, L.C.; Liao, G.I. Suppression of urinary bladder urothelial carcinoma cell by the ethanol extract of pomegranate fruit through cell cycle arrest and apoptosis. BMC Complement. Altern. Med. 2013, 13, 364. [Google Scholar] [CrossRef] [Scilit]
- Wong, D.Y.; Chang, K.W.; Chen, C.F.; Chang, R.C. Characterization of two new cell lines derived from oral cavity human squamous cell carcinomas—OC1 and OC2. J. Oral Maxillofac. Surg. 1990, 48, 385–390. [Google Scholar] [CrossRef] [Scilit]
- Vlachojannis, C.; Zimmermann, B.F.; Chrubasik-Hausmann, S. Efficacy and safety of pomegranate medicinal products for cancer. Evid. Based Complement. Altern. Med. 2015, 2015, 258598. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, C.Y.; Yen, C.Y.; Wang, H.R.; Yang, H.P.; Tang, J.Y.; Huang, H.W.; Hsu, S.H.; Chang, H.W. Tenuifolide B from Cinnamomum tenuifolium stem selectively inhibits proliferation of oral cancer cells via apoptosis, ROS generation, mitochondrial depolarization, and DNA damage. Toxins 2016, 8, 319. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yen, C.Y.; Chiu, C.C.; Chang, F.R.; Chen, J.Y.; Hwang, C.C.; Hseu, Y.C.; Yang, H.L.; Lee, A.Y.; Tsai, M.T.; Guo, Z.L.; et al. 4beta-Hydroxywithanolide E from Physalis peruviana (golden berry) inhibits growth of human lung cancer cells through DNA damage, apoptosis and G2/M arrest. BMC Cancer 2010, 10, 46. [Google Scholar] [CrossRef] [Scilit]
- Chang, H.W.; Li, R.N.; Wang, H.R.; Liu, J.R.; Tang, J.Y.; Huang, H.W.; Chan, Y.H.; Yen, C.Y. Withaferin A induces oxidative stress-mediated apoptosis and DNA damage in oral cancer cells. Front. Physiol. 2017, 8, 634. [Google Scholar] [CrossRef] [Scilit]
- Wang, H.R.; Tang, J.Y.; Wang, Y.Y.; Farooqi, A.A.; Yen, C.Y.; Yuan, S.F.; Huang, H.W.; Chang, H.W. Manoalide preferentially provides antiproliferation of oral cancer cells by oxidative stress-mediated apoptosis and DNA damage. Cancers 2019, 11, 1303. [Google Scholar] [CrossRef] [Scilit]
- Wang, S.H.; Shih, Y.L.; Kuo, T.C.; Ko, W.C.; Shih, C.M. Cadmium toxicity toward autophagy through ROS-activated GSK-3beta in mesangial cells. Toxicol. Sci. 2009, 108, 124–131. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chou, H.L.; Lin, Y.H.; Liu, W.; Wu, C.Y.; Li, R.N.; Huang, H.W.; Chou, C.H.; Chiou, S.J.; Chiu, C.C. Combination therapy of chloroquine and C(2)-ceramide enhances cytotoxicity in lung cancer H460 and H1299 cells. Cancers 2019, 11, 370. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chiu, C.C.; Huang, J.W.; Chang, F.R.; Huang, K.J.; Huang, H.M.; Huang, H.W.; Chou, C.K.; Wu, Y.C.; Chang, H.W. Golden berry-derived 4beta-hydroxywithanolide E for selectively killing oral cancer cells by generating ROS, DNA damage, and apoptotic pathways. PLoS ONE 2013, 8, e64739. [Google Scholar] [CrossRef] [Scilit]
- Chang, Y.T.; Huang, C.Y.; Tang, J.Y.; Liaw, C.C.; Li, R.N.; Liu, J.R.; Sheu, J.H.; Chang, H.W. Reactive oxygen species mediate soft corals-derived sinuleptolide-induced antiproliferation and DNA damage in oral cancer cells. Oncol. Targets Ther. 2017, 10, 3289–3297. [Google Scholar] [CrossRef] [Scilit]
- Chang, H.W.; Yen, C.Y.; Chen, C.H.; Tsai, J.H.; Tang, J.Y.; Chang, Y.T.; Kao, Y.H.; Wang, Y.Y.; Yuan, S.F.; Lee, S.Y. Evaluation of the mRNA expression levels of integrins alpha3, alpha5, beta1 and beta6 as tumor biomarkers of oral squamous cell carcinoma. Oncol. Lett. 2018, 16, 4773–4781. [Google Scholar]
- Yen, C.Y.; Huang, C.Y.; Hou, M.F.; Yang, Y.H.; Chang, C.H.; Huang, H.W.; Chen, C.H.; Chang, H.W. Evaluating the performance of fibronectin 1 (FN1), integrin alpha4beta1 (ITGA4), syndecan-2 (SDC2), and glycoprotein CD44 as the potential biomarkers of oral squamous cell carcinoma (OSCC). Biomarkers 2013, 18, 63–72. [Google Scholar] [CrossRef] [Scilit]
- Stagos, D.; Balabanos, D.; Savva, S.; Skaperda, Z.; Priftis, A.; Kerasioti, E.; Mikropoulou, E.V.; Vougogiannopoulou, K.; Mitakou, S.; Halabalaki, M.; et al. Extracts from the mediterranean food plants Carthamus lanatus, Cichorium intybus, and Cichorium spinosum enhanced GSH levels and increased Nrf2 expression in human endothelial cells. Oxid. Med. Cell Longev. 2018, 2018, 6594101. [Google Scholar] [CrossRef] [Scilit]
- Yu, T.J.; Tang, J.Y.; Ou-Yang, F.; Wang, Y.Y.; Yuan, S.F.; Tseng, K.; Lin, L.C.; Chang, H.W. Low concentration of withaferin A inhibits oxidative stress-mediated migration and invasion in oral cancer cells. Biomolecules 2020, 10, 777. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nishio, S.; Teshima, Y.; Takahashi, N.; Thuc, L.C.; Saito, S.; Fukui, A.; Kume, O.; Fukunaga, N.; Hara, M.; Nakagawa, M.; et al. Activation of CaMKII as a key regulator of reactive oxygen species production in diabetic rat heart. J. Mol. Cell Cardiol. 2012, 52, 1103–1111. [Google Scholar] [CrossRef] [Scilit]
- Jeong, S.H.; Kim, H.K.; Song, I.S.; Noh, S.J.; Marquez, J.; Ko, K.S.; Rhee, B.D.; Kim, N.; Mishchenko, N.P.; Fedoreyev, S.A.; et al. Echinochrome a increases mitochondrial mass and function by modulating mitochondrial biogenesis regulatory genes. Mar. Drugs 2014, 12, 4602–4615. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shin, J.W.; Wu, Y.; Kang, Y.G.; Kim, J.K.; Choi, H.J.; Shin, J.W. The effects of epigallocatechin-3-gallate and mechanical stimulation on osteogenic differentiation of human mesenchymal stem cells: Individual or synergistic effects. Tissue Eng. Regen. Med. 2017, 14, 307–315. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fujii, Y.; Yoshihashi, K.; Suzuki, H.; Tsutsumi, S.; Mutoh, H.; Maeda, S.; Yamagata, Y.; Seto, Y.; Aburatani, H.; Hatakeyama, M. CDX1 confers intestinal phenotype on gastric epithelial cells via induction of stemness-associated reprogramming factors SALL4 and KLF5. Proc. Natl. Acad. Sci. USA 2012, 109, 20584–20589. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Laddha, N.C.; Dwivedi, M.; Mansuri, M.S.; Singh, M.; Patel, H.H.; Agarwal, N.; Shah, A.M.; Begum, R. Association of neuropeptide Y (NPY), interleukin-1B (IL1B) genetic variants and correlation of IL1B transcript levels with vitiligo susceptibility. PLoS ONE 2014, 9, e107020. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, S.C.; Wang, Y.Y.; Lin, L.C.; Chang, M.Y.; Yuan, S.F.; Tang, J.Y.; Chang, H.W. Combined treatment of sulfonyl chromen-4-ones (CHW09) and ultraviolet-C (UVC) enhances proliferation inhibition, apoptosis, oxidative stress, and DNA damage against oral cancer cells. Int. J. Mol. Sci. 2020, 21, 6443. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lin, S.D.; Huang, S.H.; Lin, Y.N.; Wu, S.H.; Chang, H.W.; Lin, T.M.; Chai, C.Y.; Lai, C.S. Engineering adipose tissue from uncultured human adipose stromal vascular fraction on collagen matrix and gelatin sponge scaffolds. Tissue Eng. Part A 2011, 17, 1489–1498. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bijak, M.; Synowiec, E.; Sitarek, P.; Sliwinski, T.; Saluk-Bijak, J. Evaluation of the cytotoxicity and genotoxicity of flavonolignans in different cellular models. Nutrients 2017, 9, 1356. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rothfuss, O.; Gasser, T.; Patenge, N. Analysis of differential DNA damage in the mitochondrial genome employing a semi-long run real-time PCR approach. Nucleic Acids Res. 2010, 38, e24. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tang, J.Y.; Peng, S.Y.; Cheng, Y.B.; Wang, C.L.; Farooqi, A.A.; Yu, T.J.; Hou, M.F.; Wang, S.C.; Yen, C.H.; Chan, L.P.; et al. Ethyl acetate extract of Nepenthes adrianii x clipeata induces antiproliferation, apoptosis, and DNA damage against oral cancer cells through oxidative stress. Environ. Toxicol. 2019, 34, 891–901. [Google Scholar] [CrossRef] [Scilit]
- Tang, J.Y.; Shu, C.W.; Wang, C.L.; Wang, S.C.; Chang, M.Y.; Lin, L.C.; Chang, H.W. Sulfonyl chromen-4-ones (CHW09) shows an additive effect to inhibit cell growth of X-ray irradiated oral cancer cells, involving apoptosis and ROS generation. Int. J. Radiat. Biol. 2019, 95, 1226–1235. [Google Scholar] [CrossRef] [Scilit]
- Chang, H.S.; Tang, J.Y.; Yen, C.Y.; Huang, H.W.; Wu, C.Y.; Chung, Y.A.; Wang, H.R.; Chen, I.S.; Huang, M.Y.; Chang, H.W. Antiproliferation of Cryptocarya concinna-derived cryptocaryone against oral cancer cells involving apoptosis, oxidative stress, and DNA damage. BMC Complement. Altern. Med. 2016, 16, 94. [Google Scholar] [CrossRef] [Scilit]
- Vasdev, S.; Gill, V.D.; Singal, P.K. Modulation of oxidative stress-induced changes in hypertension and atherosclerosis by antioxidants. Exp. Clin. Cardiol. 2006, 11, 206–216. [Google Scholar] [PubMed]
- Hajleh, M.A.; Al-Dujaili, A. Anti-cancer activity of pomegranate and its biophenols; general review. EC Nutr. 2016, 6, 28–52. [Google Scholar]
- Shirode, A.B.; Kovvuru, P.; Chittur, S.V.; Henning, S.M.; Heber, D.; Reliene, R. Antiproliferative effects of pomegranate extract in MCF-7 breast cancer cells are associated with reduced DNA repair gene expression and induction of double strand breaks. Mol. Carcinog. 2014, 53, 458–470. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hong, M.Y.; Seeram, N.P.; Heber, D. Pomegranate polyphenols down-regulate expression of androgen-synthesizing genes in human prostate cancer cells overexpressing the androgen receptor. J. Nutr. Biochem. 2008, 19, 848–855. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Larrosa, M.; Tomas-Barberan, F.A.; Espin, J.C. The dietary hydrolysable tannin punicalagin releases ellagic acid that induces apoptosis in human colon adenocarcinoma Caco-2 cells by using the mitochondrial pathway. J. Nutr. Biochem. 2006, 17, 611–625. [Google Scholar] [CrossRef] [Scilit]
- Singh, K.K. Mitochondria damage checkpoint in apoptosis and genome stability. FEMS Yeast Res. 2004, 5, 127–132. [Google Scholar] [CrossRef] [Scilit]
- Peng, K.; Tao, Y.; Zhang, J.; Wang, J.; Ye, F.; Dan, G.; Zhao, Y.; Cai, Y.; Zhao, J.; Wu, Q.; et al. Resveratrol regulates mitochondrial biogenesis and fission/fusion to attenuate rotenone-induced neurotoxicity. Oxid. Med. Cell Longev. 2016, 2016, 6705621. [Google Scholar] [CrossRef] [Scilit]
- Kalogeris, T.J.; Baines, C.; Korthuis, R.J. Adenosine prevents TNFalpha-induced decrease in endothelial mitochondrial mass via activation of eNOS-PGC-1alpha regulatory axis. PLoS ONE 2014, 9, e98459. [Google Scholar] [CrossRef] [Scilit]
- Mei, H.; Sun, S.; Bai, Y.; Chen, Y.; Chai, R.; Li, H. Reduced mtDNA copy number increases the sensitivity of tumor cells to chemotherapeutic drugs. Cell Death Dis. 2015, 6, e1710. [Google Scholar] [CrossRef] [Scilit]
- Tann, A.W.; Boldogh, I.; Meiss, G.; Qian, W.; Van Houten, B.; Mitra, S.; Szczesny, B. Apoptosis induced by persistent single-strand breaks in mitochondrial genome: Critical role of EXOG (5′-EXO/endonuclease) in their repair. J. Biol. Chem. 2011, 286, 31975–31983. [Google Scholar] [CrossRef] [Scilit]
- Van Houten, B.; Hunter, S.E.; Meyer, J.N. Mitochondrial DNA damage induced autophagy, cell death, and disease. Front. Biosci. 2016, 21, 42–54. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ricci, C.; Pastukh, V.; Leonard, J.; Turrens, J.; Wilson, G.; Schaffer, D.; Schaffer, S.W. Mitochondrial DNA damage triggers mitochondrial-superoxide generation and apoptosis. Am. J. Physiol. Cell Physiol. 2008, 294, C413–C422. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bohr, V.A.; Dianov, G.L. Oxidative DNA damage processing in nuclear and mitochondrial DNA. Biochimie 1999, 81, 155–160. [Google Scholar] [CrossRef] [Scilit]
- Vayssiere, J.L.; Petit, P.X.; Risler, Y.; Mignotte, B. Commitment to apoptosis is associated with changes in mitochondrial biogenesis and activity in cell lines conditionally immortalized with simian virus 40. Proc. Natl. Acad. Sci. USA 1994, 91, 11752–11756. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Meira Martins, L.A.; Vieira, M.Q.; Ilha, M.; de Vasconcelos, M.; Biehl, H.B.; Lima, D.B.; Schein, V.; Barbe-Tuana, F.; Borojevic, R.; Guma, F.C. The interplay between apoptosis, mitophagy and mitochondrial biogenesis induced by resveratrol can determine activated hepatic stellate cells death or survival. Cell Biochem. Biophys. 2015, 71, 657–672. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sanchez-Alvarez, R.; De Francesco, E.M.; Fiorillo, M.; Sotgia, F.; Lisanti, M.P. Mitochondrial fission factor (MFF) inhibits mitochondrial metabolism and reduces breast cancer stem cell (CSC) activity. Front. Oncol. 2020, 10, 1776. [Google Scholar] [CrossRef] [Scilit] [PubMed]










| Genes | Forward Primers (5′→3′) | Reverse Primers (5′→3′) | Length |
|---|---|---|---|
| NFE2L2 | GATCTGCCAACTACTCCCAGGTT [36] | CTGTAACTCAGGAATGGATAATAGCTCC [36] | 302 bp |
| GCLC | ACAAGCACCCTCGCTTCAGTACC [36] | CTGCAGGCTTGGAATGTCACCT [36] | 232 bp |
| TXN | GAAGCAGATCGAGAGCAAGACTG [36] | GCTCCAGAAAATTCACCCACCT [36] | 270 bp |
| CAT | ATGCAGGACAATCAGGGTGGT [36] | CCTCAGTGAAGTTCTTGACCGCT [36] | 274 bp |
| SOD1 | AGGGCATCATCAATTTCGAGC [37] | CCCAAGTCTCCAACATGCCTC [36] | 211 bp |
| HMOX1 | CCTTCTTCACCTTCCCCAACAT [36] | GGCAGAATCTTGCACTTTGTTGC [36] | 251 bp |
| NQO1 | GAAGGACCCTGCGAACTTTCAGTA [36] | GAAAGCACTGCCTTCTTACTCCG [36] | 258 bp |
| TFB2M | CTGCTGGAGTGCAATCCAGGTC | TCCAACTACTTTTAAAGGGATGTCTGC | 285 bp |
| TFAM | TTAAAGCTCAGAACCCAGATGCA [39] | TTACAGTCTTCAGCTTTTCCTGCG | 354 bp |
| POLRMT | CTGAGCGACTTTCCCCAGGAGT | CTTACGTGTGTTGGGCTTTCGG | 294 bp |
| TUFM | TGCTCTCTGTGCCCTTGAGGGT | CTTGTGGAACATCTCAATGCCTGTC | 277 bp |
| GAPDH | CCTCAACTACATGGTTTACATGTTCC [41] | CAAATGAGCCCCAGCCTTCT [42] | 220 bp |
| Genes | Forward Primers (5′→3′) | Reverse Primers (5′→3′) | Length |
|---|---|---|---|
| ND1 | CCTCCTACTCCTCATTGTACCCATTC | TGAAGAGTTTTATGGCGTCAGCG | 155 bp |
| ND1-L | CCTCCTACTCCTCATTGTACCCATTC | GAGTGTGCCTGCAAAGATGGTAGAG | 1203 bp |
| ND5 | GTTTCATCCTCGCCTTAGCATGA | AGTCAGGGGTGGAGACCTAATTGG | 157 bp |
| ND5-L | GTTTCATCCTCGCCTTAGCATGA | GGTGATGATGGAGGTGGAGATTTG | 1190 bp |
| GAPDH | GAAGCTGAGTCATGGGTAGTTGG [44] | GATCTGGTTTCCGGAAGACG [44] | 220 bp |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Peng, S.-Y.; Lin, L.-C.; Chen, S.-R.; Farooqi, A.A.; Cheng, Y.-B.; Tang, J.-Y.; Chang, H.-W. Pomegranate Extract (POMx) Induces Mitochondrial Dysfunction and Apoptosis of Oral Cancer Cells. Antioxidants 2021, 10, 1117. https://doi.org/10.3390/antiox10071117
Peng S-Y, Lin L-C, Chen S-R, Farooqi AA, Cheng Y-B, Tang J-Y, Chang H-W. Pomegranate Extract (POMx) Induces Mitochondrial Dysfunction and Apoptosis of Oral Cancer Cells. Antioxidants. 2021; 10(7):1117. https://doi.org/10.3390/antiox10071117
Chicago/Turabian StylePeng, Sheng-Yao, Li-Ching Lin, Shu-Rong Chen, Ammad A. Farooqi, Yuan-Bin Cheng, Jen-Yang Tang, and Hsueh-Wei Chang. 2021. "Pomegranate Extract (POMx) Induces Mitochondrial Dysfunction and Apoptosis of Oral Cancer Cells" Antioxidants 10, no. 7: 1117. https://doi.org/10.3390/antiox10071117
APA StylePeng, S.-Y., Lin, L.-C., Chen, S.-R., Farooqi, A. A., Cheng, Y.-B., Tang, J.-Y., & Chang, H.-W. (2021). Pomegranate Extract (POMx) Induces Mitochondrial Dysfunction and Apoptosis of Oral Cancer Cells. Antioxidants, 10(7), 1117. https://doi.org/10.3390/antiox10071117

