Ameliorative Effects of Aspergillus awamori against the Initiation of Hepatocarcinogenesis Induced by Diethylnitrosamine in a Rat Model: Regulation of Cyp19 and p53 Gene Expression
Abstract
:1. Introduction
2. Materials and Methods
2.1. Ethical Statement
2.2. Diethyelnitrosamie (DEN) Preparation
2.3. Aspergillus awamori Extract Preparation
2.4. UPLC-PDA-MS/MS for Metabolite Analysis
2.5. Determination of the Total Content of Flavonoids and Polyphenols
2.6. Experimental Animals
2.7. Experimental Protocol
2.8. Hematological Examination
2.9. Serum Biochemical Analysis
2.10. Hepatic Oxidative Stress and Antioxidant Status Estimation
2.11. RNA Extraction and Real Time-PCR
2.12. Histopathology
2.13. Immunohistochemical Analysis of Glutathione S-Transferase P
2.14. Statistical Analysis
3. Results
3.1. UPLC-PDA-MS/MS for Metabolite Analysis
3.2. Total Content of Flavonoids and Polyphenols
3.3. Body and Liver Weights
3.4. Hematological Examination
3.5. Biochemical Findings
3.6. Hepatic Oxidative Stress and Antioxidant Status
3.7. Genes Expression Level of Cyp19 and p53
3.8. Histopathology
3.9. Immunohistochemistry of GST-P Expression
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Qian, Y.; Lin, C.Q. Preventive effect of Ganfujian granule on experimental hepatocarcinoma in rats. World J. Gastroenterol. 2004, 10, 755–757. [Google Scholar] [CrossRef]
- Balogh, J.; Victor, D.; Asham, E.H.; Burroughs, S.G.; Boktour, M.; Saharia, A.; Li, X.; Ghobrial, R.M.; Monsour, H. Hepatocellular carcinoma: A review. J. Hepatocell. Carcinoma 2016, 3, 41–53. [Google Scholar] [CrossRef] [Green Version]
- Rashed, W.M.; Kandeil, M.A.M.; Mahmoud, M.O.; Ezzat, S. Hepatocellular Carcinoma (HCC) in Egypt: A comprehensive overview. J. Egypt. Natl. Cancer Inst. 2020, 32, 1–11. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jemal, A.; Siegel, R.; Ward, E.; Hao, Y.; Xu, J.; Thun, M.J. Cancer Statistics, 2009. CA Cancer J. Clin. 2009, 59, 225–249. [Google Scholar] [CrossRef]
- Reh, B.D.; Fajen, J.M. Worker Exposures to Nitrosamines in a Rubber Vehicle Sealing Plant. Am. Ind. Hyg. Assoc. J. 1996, 57, 918–923. [Google Scholar] [CrossRef] [PubMed]
- Hidajat, M.; McElvenny, D.M.; Ritchie, P.; Darnton, A.; Mueller, W.; Agius, R.M.; Cherrie, J.W.; De Vocht, F. Lifetime cumulative exposure to rubber dust, fumes and N-nitrosamines and non-cancer mortality: A 49-year follow-up of UK rubber factory workers. Occup. Environ. Med. 2020, 77, 316–323. [Google Scholar] [CrossRef] [Green Version]
- Bansal, A.K.; Bansal, M.; Soni, G.; Bhatnagar, D. Protective role of Vitamin E pre-treatment on N-nitrosodiethylamine induced oxidative stress in rat liver. Chem. Biol. Interact. 2005, 156, 101–111. [Google Scholar] [CrossRef]
- Abdelhady, D.H.; Ghazi, E.; Abdo, W.; Eid, Y.Z.; Shukry, M. Biologically produced nano-selenium reduces initiation stage of diethyl nitrosamine hepatocarcinogenesis in rats. Assiut. Vet. Med. J. Assiut. Vet. Med. J. 2018, 64, 69–80. [Google Scholar]
- Archer, M.C. Mechanisms of action of N-nitroso compounds. Cancer Surv. 1989, 8, 241–250. [Google Scholar]
- Sato, K. Glutathione S-transferases and hepatocarcinogenesis. Jpn. J. Cancer Res. 1988, 79, 556–572. [Google Scholar] [CrossRef]
- Ito, N.; Hasegawa, R.; Imaida, K.; Hirose, M.; Shirai, T.; Tamano, S.; Hagiwara, A. Medium-term Rat Liver Bioassay for Rapid Detection of Hepatocarcinogenic Substances. J. Toxicol. Pathol. 1997, 10, 1–11. [Google Scholar] [CrossRef] [Green Version]
- Cohen, S.; Ellwein, L. Cell proliferation in carcinogenesis. Science 1990, 249, 1007–1011. [Google Scholar] [CrossRef] [PubMed]
- Guengerich, F. Metabolism of chemical carcinogens. Carcinogenesis 2000, 21, 345–351. [Google Scholar] [CrossRef] [PubMed]
- Bray, F.; Ferlay, J.; Soerjomataram, I.; Siegel, R.L.; Torre, L.A.; Jemal, A. Global cancer statistics: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J. Clin. 2018, 68, 394–424. [Google Scholar] [CrossRef] [Green Version]
- Gordaliza, M. Natural products as leads to anticancer drugs. Clin. Transl. Oncol. 2007, 9, 767–776. [Google Scholar] [CrossRef] [PubMed]
- Singh, D.; Singh, M.; Yadav, E.; Falls, N.; Singh Dangi, D.; Kumar, V.; Ramteke, P.W.; Verma, A. Attenuation of diethylnitrosamine (DEN)—Induced hepatic cancer in experimental model of Wistar rats by Carissa carandas embedded silver nanoparticles. Biomed. Pharmacother. 2018, 108, 757–765. [Google Scholar] [CrossRef]
- Smith, H.; Doyle, S.; Murphy, R. Filamentous fungi as a source of natural antioxidants. Food Chem. 2015, 185, 389–397. [Google Scholar] [CrossRef] [PubMed]
- Fox, E.M.; Howlett, B.J. Secondary metabolism: Regulation and role in fungal biology. Curr. Opin. Microbiol. 2008, 11, 481–487. [Google Scholar] [CrossRef]
- Archer, D.B. Filamentous fungi as microbial cell factories for food use. Curr. Opin. Biotechnol. 2000, 11, 478–483. [Google Scholar] [CrossRef]
- Yokoyama, K.; Wang, L.; Miyaji, M.; Nishimura, K. Identification, classification and phylogeny of the Aspergillus section Nigri inferred from mitochondrial cytochromebgene. FEMS Microbiol. Lett. 2001, 200, 241–246. [Google Scholar] [CrossRef] [Green Version]
- Parvatkar, R.R.; D’Souza, C.; Tripathi, A.; Naik, C.G. Aspernolides A and B, butenolides from a marine-derived fungus Aspergillus terreus. Phytochemistry 2009, 70, 128–132. [Google Scholar] [CrossRef] [PubMed]
- Saleh, A.A.; Eid, Y.Z.; Ebeid, T.A.; Kamizono, T.; Ohtsuka, A.; Hayashi, K. Effects of Feeding Aspergillus awamori and Aspergillus niger on Growth Performance and Meat Quality in Broiler Chickens. J. Poult. Sci. 2011, 48, 201–206. [Google Scholar] [CrossRef] [Green Version]
- Saleh, A.A.; Eid, Y.Z.; Ebeid, T.A.; Ohtsuka, A.; Hioki, K.; Yamamoto, M.; Hayashi, K. The modification of the muscle fatty acid profile by dietary supplementation with Aspergillus awamori in broiler chickens. Br. J. Nutr. 2012, 108, 1596–1602. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Salar, R.K.; Purewal, S.S.; Sandhu, K.S. Bioactive profile, free-radical scavenging potential, DNA damage protection activity, and mycochemicals in Aspergillus awamori (MTCC 548) extracts: A novel report on filamentous fungi. 3 Biotech 2017, 7, 1–9. [Google Scholar] [CrossRef]
- Kiranmai, M.; Mahendra Kumar, C.B.; Ibrahim, M. Comparison of total flavanoid content of Azadirachta indica root bark extracts prepared by different methods of extraction. Res. J. Pharm. Biol. Chem. Sci. 2011, 2, 254–261. [Google Scholar]
- Attard, E. A rapid microtitre plate Folin-Ciocalteu method for the assessment of polyphenols. Cent. Eur. J. Biol. 2013, 8, 48–53. [Google Scholar] [CrossRef]
- Singh, D.; Singh, M.; Yadav, E.; Falls, N.; Komal, U.; Dangi, D.S.; Kumar, V.; Verma, A. Amelioration of diethylnitrosamine (DEN)-induced hepatocellular carcinogenesis in animal models via knockdown oxidative stress and proinflammatory markers by Madhuca longifolia embedded silver nanoparticles. RSC Adv. 2018, 8, 6940–6953. [Google Scholar] [CrossRef] [Green Version]
- Bois, C.; Delalande, C.; Nurmio, M.; Parvinen, M.; Zanatta, L.; Toppari, J.; Carreau, S. Age- and cell-related gene expression of aromatase and estrogen receptors in the rat testis. J. Mol. Endocrinol. 2010, 45, 147–159. [Google Scholar] [CrossRef]
- Long, C.; Xiao, Y.; Li, S.; Tang, X.; Yuan, Z.; Bai, Y. Involvement of proliferative and apoptotic factors in the development of hindgut in rat fetuses with ethylenethiourea-induced anorectal malformations. Acta Histochem. 2020, 122, 151466. [Google Scholar] [CrossRef] [PubMed]
- Jahromi, M.F.; Shokryazdan, P.; Idrus, Z.; Ebrahimi, R.; Bashokouh, F.; Liang, J.B. Modulation of Immune Function in Rats Using Oligosaccharides Extracted from Palm Kernel Cake. BioMed Res. Int. 2017, 2017, 1–10. [Google Scholar] [CrossRef]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef]
- Bancroft, J.D.; Layton, C. The Hematoxylin and eosin. In Theory Practice of Histological Techniques, 7th ed.; Suvarna, S.K., Layton, C., Bancroft, J.D., Eds.; Churchill Livingstone of El Sevier: Philadelphia, PA, USA, 2013. [Google Scholar]
- Asaoka, Y.; Sakai, H.; Hirata, A.; Sasaki, J.; Goryo, M.; Miyamoto, Y.; Yanai, T.; Masegi, T.; Okada, K. Detection of Initiation Activity of 1,2-Dimethylhydrazine in in vivo Medium-Term Liver Initiation Assay System using 4-Week-Old Rats without Hepatocellular Proliferative Stimuli during the Test Chemical Treatment Period. J. Vet. Med. Sci. 2010, 72, 43–53. [Google Scholar] [CrossRef] [Green Version]
- Bagi, C.M.; Andresen, C.J. Models of hepatocellular carcinoma and biomarker strategy. Cancers 2010, 2, 1441–1452. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Abdo, W.; Hirata, A.; Shukry, M.; Kamal, T.; Abdel-Sattar, E.; Mahrous, E.; Yanai, T. Calligonum comosum extract inhibits diethylnitrosamine-induced hepatocarcinogenesis in rats. Oncol. Lett. 2015, 10, 716–722. [Google Scholar] [CrossRef]
- Ibrahima, R.M.; El-Halawany, A.M.; Saleh, D.O.; El Naggar, E.M.B.; El-Shabrawy, A.E.-R.O.; El-Hawary, S.S. HPLC-DAD-MS/MS profiling of phenolics from Securigera securidaca flowers and its anti-hyperglycemic and anti-hyperlipidemic activities. Rev. Bras. Farmacogn. 2015, 25, 134–141. [Google Scholar] [CrossRef] [Green Version]
- Saleh, A.A.; Ohtsuka, A.; Yamamoto, M.; Hayashi, K. Aspergillus awamori Feeding Modifies Lipid Metabolism in Rats. BioMed Res. Int. 2013, 2013, 594393. [Google Scholar] [CrossRef] [Green Version]
- Okazaki, Y.; Sitanggang, N.V.; Sato, S.; Ohnishi, N.; Inoue, J.; Iguchi, T.; Watanabe, T.; Tomotake, H.; Harada, K.; Kato, N. Burdock Fermented by Aspergillus awamori Elevates Cecal Bifidobacterium, and Reduces Fecal Deoxycholic Acid and Adipose Tissue Weight in Rats Fed a High-Fat Diet. Biosci. Biotechnol. Biochem. 2013, 77, 53–57. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sadik, N.A.H.; EL-Maraghy, S.A.; Ismail, M.F. Diethylnitrosamine-induced hepatocarcinogenesis in rats: Possible chemoprevention by blueberries. Afr. J. Biochem. Res. 2008, 2, 081–087. [Google Scholar]
- Jayakumar, S.; Madankumar, A.; Asokkumar, S.; Raghunandhakumar, S.; Gokula Dhas, K.; Kamaraj, S.; Divya, M.G.J.; Devaki, T. Potential preventive effect of carvacrol against diethylnitrosamine-induced hepatocellular carcinoma in rats. Mol. Cell. Biochem. 2012, 360, 51–60. [Google Scholar] [CrossRef]
- Miller, M.A.; Zachary, J.F. Mechanisms and Morphology of Cellular Injury, Adaptation, and Death 11 for a glossary of abbreviations and terms used in this chapter see E-Glossary 1-1. Pathol. Basis Vet. Dis. 2017, 2–43.e19. [Google Scholar] [CrossRef]
- Holsapple, M.P.; Bick, P.H.; Duke, S.S. Effects of N-NitrosodimethyIamine on Cell-Mediated Immunity. J. Leukoc. Biol. 1985, 37, 367–381. [Google Scholar] [CrossRef]
- Taha, M.M.E.; Abdul, A.B.; Abdullah, R.; Ibrahim, T.A.T.; Abdelwahab, S.I.; Mohan, S. Potential chemoprevention of diethylnitrosamine-initiated and 2-acetylaminofluorene-promoted hepatocarcinogenesis by zerumbone from the rhizomes of the subtropical ginger (Zingiber zerumbet). Chem. Biol. Interact. 2010, 186, 295–305. [Google Scholar] [CrossRef]
- Kadasa, N.M.; Abdallah, H.; Afifi, M.; Gowayed, S. Hepatoprotective Effects of Curcumin against Diethyl Nitrosamine Induced Hepatotoxicity in Albino Rats. Asian Pac. J. Cancer Prev. 2015, 16, 103–108. [Google Scholar] [CrossRef] [Green Version]
- Elguindy, N.M.; Yacout, G.A.; El Azab, E.F.; Maghraby, H.K. Chemoprotective effect of Elettaria cardamomum against chemically induced hepatocellular carcinoma in rats by inhibiting NF-κB, oxidative stress, and activity of ornithinedecarboxylase. S. Afr. J. Bot. 2016, 105, 251–258. [Google Scholar] [CrossRef]
- Lu, Y.; Zhang, X.; Zhang, H.; Lan, J.; Huang, G.; Varin, E.; Lincet, H.; Poulain, L.; Icard, P. Citrate induces apoptotic cell death: A promising way to treat gastric carcinoma? Anticancer Res. 2011, 31, 797–805. [Google Scholar]
- Ren, J.-G.; Seth, P.; Ye, H.; Jian-Guo, R.; Hanai, J.-I.; Husain, Z.; Sukhatme, V.P. Citrate Suppresses Tumor Growth in Multiple Models through Inhibition of Glycolysis, the Tricarboxylic Acid Cycle and the IGF-1R Pathway. Sci. Rep. 2017, 7, 4537. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Abdel Salam, O.M.E.; Sleem, A.A.; Shaffie, N.M. Hepatoprotective effects of citric acid and aspartame on carbon tetrachloride-induced hepatic damage in rats. EXCLI J. 2009, 8, 41–49. [Google Scholar] [CrossRef]
- Richard, D.; Kefi, K.; Barbe, U.; Bausero, P.; Visioli, F. Polyunsaturated fatty acids as antioxidants. Pharmacol. Res. 2008, 57, 451–455. [Google Scholar] [CrossRef] [PubMed]
- Ray, A. Cancer preventive role of selected dietary factors. Indian J. Cancer 2005, 42, 15–24. [Google Scholar] [CrossRef]
- Larrosa, M.; Tomás-Barberán, F.A.; Espín, J.C. The dietary hydrolysable tannin punicalagin releases ellagic acid that induces apoptosis in human colon adenocarcinoma Caco-2 cells by using the mitochondrial pathway. J. Nutr. Biochem. 2006, 17, 611–625. [Google Scholar] [CrossRef]
- Aly, S.M.; Fetaih, H.A.; Hassanin, A.A.I.; Abomughaid, M.M.; Ismail, A.A. Protective Effects of Garlic and Cinnamon Oils on Hepatocellular Carcinoma in Albino Rats. Anal. Cell. Pathol. 2019, 2019, 9895485. [Google Scholar] [CrossRef] [Green Version]
- Su, X.Y.; Zhao, J.Q.; Li, N.; Kumar, M.; Ou Yang, A.M. Chemoprotective effects of resveratrol against diethylnitrosamine induced hepatocellular carcinoma in wistar rats. Int. J. Pharmacol. 2019, 15, 549–559. [Google Scholar] [CrossRef]
- Rodriguezantona, C.; Ingelmansundberg, M. Cytochrome P450 pharmacogenetics and cancer. Oncogene 2006, 25, 1679–1691. [Google Scholar] [CrossRef] [Green Version]
- McFadyen, M.C.; Murray, G.I. Cytochrome P450 1B1: A novel anticancer therapeutic target. Futur. Oncol. 2005, 1, 259–263. [Google Scholar] [CrossRef] [PubMed]
- Zilfou, J.T.; Lowe, S.W. Tumor Suppressive Functions of p53. Cold Spring Harb. Perspect. Biol. 2009, 1, a001883. [Google Scholar] [CrossRef]
- Sionov, R.V.; Hayon, I.L.; Haupt, Y. The Regulation of p53 Growth Suppression. In Madame Curie Bioscience Database [Internet]; Landes Bioscience: Austin, TX, USA, 2013. [Google Scholar]
- Levine, A.J.; Momand, J.; Finlay, C.A. The p53 tumour suppressor gene. Nature 1991, 351, 453–456. [Google Scholar] [CrossRef]
- Van Gijssel, H.E.; Maassen, C.B.M.; Mulder, G.J.; Meerman, J.H.N. p53 protein expression by hepatocarcinogens in the rat liver and its potential role in mitoinhibition of normal hepatocytes as a mechanism of hepatic tumour promotion. Carcinogenesis 1997, 18, 1027–1033. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ahmed, O.M.; Ahmed, A.A.; Fahim, H.I.; Zaky, M.Y. Quercetin and naringenin abate diethylnitrosamine/acetylaminofluorene-induced hepatocarcinogenesis in Wistar rats: The roles of oxidative stress, inflammation and cell apoptosis. Drug Chem. Toxicol. 2019, 1–12. [Google Scholar] [CrossRef]
Genes | 5′→3′ | References |
---|---|---|
CYP19 | F: CGTCATGTTGCTTCTCATCG | [28] |
R: TACCGCAGGCTCTCGTTAAT | ||
p53 | F: CCCAGGGAGTGCAAAGAGAG | [29] |
R: TCTCGGAACATCTCGAAGCG | ||
GAPDH * | F: TGCACCACCAACTGCTTAGC | [30] |
R: GGCATGGACTGTGGTCATGAG |
NO. | Rt Min | [M-H]- m/z | MS/MS Ions m/z | Identification |
---|---|---|---|---|
1 | 1.51 | 195 | 177, 159, 129, 99, 75 | Gluconic acid |
2 | 1.63 | 191 | 129, 111, 87, 85 | Citric acid isomer 1 |
3 | 1.82 | 191 | 129, 111, 87, 85 | Citric acid isomer 2 |
4 | 2.25 | 191 | 129, 111, 87, 85 | Citric acid |
5 | 2.84 | 205 | 143, 111, 87 | Methyl derivative of citric acid |
6 | 2.99 | 147 | 147, 103 | Cinnamic acid |
7 | 3.30 | 161 | 129, 101, 85, 83 | Methyl cinnamate |
8 | 4.31 | 219 | 187, 159, 157, 143, 129, 125, 115,111, 97, 87 | 1,3-Dimethyl citrate |
9 | 4.96 | 153 | 109 | Gentisic acid |
10 | 6.52 | 219 | 157, 113, 111, 87 | 1,5-Dimethyl Citrate isomer |
11 | 7.48 | 175 | 157, 129, 115, 113, 85 | L-ascorbic acid |
12 | 8.34 | 563 | 545, 503, 473, 443, 425, 412, 406, 383, 365, 353, 311, 378, 293, 233 | Apigenin-6,8-diglucoside (vicenin II) |
13 | 8.59 | 165 | 121 | Phthalic acid |
14 | 8.89 | 415 | 191, 175, 139, 119, 101, 89 | Tetrahydroxy coumarin-3′-carboxylic acid-β-D-glucoside |
15 | 9.27 | 151 | 107 | Anisic acid |
16 | 10.12 | 163 | 119 | p-Coumaric acid |
17 | 10.66 | 187 | 169, 143, 125, 123, 97 | Benzoic acid or gallic acid derivative |
18 | 11.10 | 221 | 206, 162, 150, 133 | Isofraxidin |
19 | 11.12 | 439 | 289, 274, 247, 175, 149, 134 | Unknown |
20 | 12.98 | 331 | 313, 295, 201, 171, 157, 127 | Trihydroxy octadecanoic acid |
21 | 13.09 | 663 | 447, 234,215, 203, 157, 125, 124, 111 | Unknown |
22 | 13.29 | 329 | 314, 299, 271, 229, 211, 171, 157, 139, 127, 99 | Trihydroxy octadecenoic acid |
23 | 13.50 | 413 | 252, 234, 193, 175, 163, 134, 119 | Methyl-dihydroxy-dihydrocoumarin-3′-carboxymethyl-β-D-glucoside |
24 | 14.31 | 1085 | 865 | Derivative of procyanidin C1 |
25 | a-14.53 b-14.81 | 329 | 293, 275, 211, 201, 181, 171, 155, 139, 127 | Trihydroxy octadecenoic acid isomers |
26 | 16.53 | 499 | 467, 455, 439, 423 | Ursolic acid derivative |
27 | 16.80 | 287 | 287, 269, 251, 225, 201, 155 | Aromadendrin |
28 | 17.01 | 311 | 293, 275, 255, 223, 183 | 15,16-Dihydroxy-9,12-octadecadienoic acid |
29 | a-18.08 b-18.37 | 313 | 277, 201, 171, 165, 155, 127 | 10-Hydroperoxy-8E-octadecenoic acid and its isomer |
30 | 18.61 | 485 | 485, 439, 391 | Methoxy ursolic acid |
31 | a-19.29 b-19.87 | 315 | 313, 297, 279, 201, 171, 155, 141, 127 | Dihydroxy-octadecanoic acid and its siomer |
32 | a-20.38 b-20.74 | 355 | 313, 295, 277, 201, 171, 123 | Propyl ester of compound 313 and its isomer |
33 | 21.37 | 295 | 277, 195, 171, 113 | 13(S)-hydroxyoctadecadienoic acid (α-Artemisolic acid) |
34 | 25.86 | 295 | 249, 193, 155, 141 | Isomer of compound 28 |
35 | a-22.05 b-22.39 | 357 | 315, 297, 279, 171 | Propyl ester of compound 26 and its isomer |
36 | 24.82 | 333 | 279, 265, 155, 139, 127 | Unknown |
37 | 26.59 | 509 | 491, 465, 447, 421, 359, 347, 325, 295, 181 | Unknown |
38 | 28.68 | 297 | 251 | 6,7-epoxystearic acid |
39 | 28.15 | 271 | 253, 225 | 2-Hydroxy palmitic acid |
40 | 29.09 | 392 | 130 | Unknown |
Groups | Items | |||||
---|---|---|---|---|---|---|
Initial Weight (kg/Animal) | Final Weight (kg/Animal) | Body Gain (kg/Animal) | Gain Relative Weight * | Liver Weight | Liver Relative Weight # | |
Control | 0.164 ± 0.01 a | 0.227 ± 0.05 a | 0.063 ± 0.04 a | 27.75 ± 18.19 a | 5.98 ± 0.20 b | 2.63 b |
DEN | 0.164 ± 0.02 a | 0.144 ± 0.02 d | -0.02 ± 0.01 d | -13.89 ± 7.21 d | 7.28 ± 0.54 a | 5.06 a |
DEN + ASP (0.1 mg/kg BW) | 0.163 ± 0.02 a | 0.197 ± 0.01 b | 0.034 ± 0.01 b | 17.26 ± 11.49 b | 6.02 ± 0.33 b | 3.06 b |
DEN + ASP(0.05 mg/kgBW) | 0.166 ± 0.02 a | 0.198 ± 0.02 b | 0.032 ± 0.01 b | 16.16 ± 7.07 b | 5.75 ± 0.45 b | 2.90 b |
DEN + ASP(0.025 mg/kgB) | 0.167 ± 0.02 a | 0.172 ± 0.03 c | 0.005 ± 0.02 c | 2.91 ± 1.01 c | 5.84 ± 0.37 b | 3.34 b |
ASP(0.1 mg/kg BW) | 0.164 ± 0.02 a | 0.187 ± 0.02 b | 0.023 ± 0.02 b | 12.3 ± 4.11 b | 5.64 ± 0.38 b | 3.02 b |
ASP(0.05 mg/kg BW) | 0.161 ± 0.02 a | 0.219 ± 0.02 a | 0.058 ± 0.01 a | 26.48 ± 8.61 a | 5.91 ± 0.37 b | 2.70 b |
ASP(0.025 mg/kg BW) | 0.161 ± 0.03 a | 0.222 ± 0.06 a | 0.061 ± 0.04 a | 27.48 ± 21.12 a | 5.68 ± 0.22 b | 2.56 b |
Groups | Items | |||||||||
---|---|---|---|---|---|---|---|---|---|---|
RBCS (106/µL) | HGB (g/dL) | HCT (%) | MCV (fL) | MCH (pg) | MCHC (%) | WBCS (103/µL) | Lymphocyte (103/µL) | Neutrophils (103/µL) | Monocytes (103/µL) | |
Control | 6.08 ± 0.08 a | 13.9 ± 0.10 a | 34.4 ± 0.18 a | 56.58 ± 0.92 a | 22.86 ± 0.20 a | 40.41 ± 0.41 a | 17.5 ± 0.32 b | 12.92 ± 0.10 b | 1.95 ± 0.23 b | 2.63 ± 0.12 b |
DEN | 6.19 ± 0.19 a | 13.4 ± 0.49 a | 33.08 ± 1.2 a | 53.44 ± 1.10a | 21.65 ± 0.41a | 40.51 ± 0.19 a | 23.7 ± 0.20a | 16.1 ± 0.34 a | 3.2 ± 0.18 a | 4.4 ± 0.15 a |
DEN + ASP (0.1 mg/kg BW) | 5.66 ± 0.11 a | 12.4 ± 0.37 a | 31.5 ± 0.98 a | 55.65 ± 0.97 a | 21.9 ± 0.34 a | 39.37 ± 0.18 a | 17.75 ± 0.7 b | 12.9 ± 0.56 b | 2.2 ± 0.30 b | 2.65 ± 0.145 b |
DEN + ASP (0.05 mg/kg BW) | 5.93 ± 0.18 a | 12.8 ± 0.36 a | 32.1 ± 0.96 a | 54.13 ± 0.84 a | 21.6 ± 0.27 a | 39.88 ± 0.11 a | 17.6 ± 0.76 b | 11.77 ± 0.5 b | 2.7 ± 0.20 b | 3.13 ± 0.313 b |
DEN + ASP (0.025 mg/kg BW) | 6.15 ± 0.12 a | 13.2 ± 0.38 a | 33.5 ± 1.04 a | 54.47 ± 0.84 a | 21.5 ± 0.34 a | 39.40 ±0.17 a | 18.2 ± 0. 67 b | 11.8 ± 0.37 b | 2.93 ± 0.21 a | 3.44 ± 0.25 b |
ASP (0.1 mg/kg BW) | 5.72 ± 0.10 a | 12.8 ± 0.31 a | 32.7 ± 0.85 a | 57.17 ± 0.65 a | 22.38 ± 0.29 a | 40.10 ± 0.177 a | 17.4 ± 0.45 b | 12.9 ± 0.27 b | 1.93 ± 0.19 b | 2.57 ± 0.38 b |
ASP(0.05 mg/kg BW) | 5.90 ± 0.19 a | 12.6 ± 0.11 a | 31.7 ± 0.40 a | 53.73 ± 0.60 a | 21.36 ± 0.34 a | 39.4 ± 0.23 a | 16.13 ± 0.06 b | 11.5 ± 0.57 b | 1.83 ± 0.31 b | 2.8 ± 0.26 b |
ASP(0.025 mg/kg BW) | 5.75 ± 0.09 a | 12.6 ± 0.38 a | 32.2 ± 1.08 a | 55.7 ± 0.8 a | 21.9 ± 0.29 a | 39.13 ± 0.16 a | 17.3 ± 0.44 b | 12.7 ± 0.56 b | 2.06 ± 0.38 b | 2.53 ± 0.29 b |
Groups | IHC |
---|---|
Control | Zero |
DEN | 43.33 ± 1.19 a |
DEN + ASP (0.1 mg/kg BW) | 16.33 ± 0.6 b |
DEN + ASP (0.05 mg/kg BW) | 30.33 ± 0.37 c |
DEN + ASP (0.025 mg/kg BW) | 36.6 ± 0.33 d |
ASP (0.1 mg/kg BW) | Zero |
ASP (0.05 mg/kg BW) | Zero |
ASP (0.025 mg/kg BW) | Zero |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Assar, D.H.; Mokhbatly, A.-A.A.; Ghazy, E.W.; Ragab, A.E.; Abou Asa, S.; Abdo, W.; Elbialy, Z.I.; Mohamed, N.E.; El-Far, A.H. Ameliorative Effects of Aspergillus awamori against the Initiation of Hepatocarcinogenesis Induced by Diethylnitrosamine in a Rat Model: Regulation of Cyp19 and p53 Gene Expression. Antioxidants 2021, 10, 922. https://doi.org/10.3390/antiox10060922
Assar DH, Mokhbatly A-AA, Ghazy EW, Ragab AE, Abou Asa S, Abdo W, Elbialy ZI, Mohamed NE, El-Far AH. Ameliorative Effects of Aspergillus awamori against the Initiation of Hepatocarcinogenesis Induced by Diethylnitrosamine in a Rat Model: Regulation of Cyp19 and p53 Gene Expression. Antioxidants. 2021; 10(6):922. https://doi.org/10.3390/antiox10060922
Chicago/Turabian StyleAssar, Doaa H., Abd-Allah A. Mokhbatly, Emad W. Ghazy, Amany E. Ragab, Samah Abou Asa, Walied Abdo, Zizy I. Elbialy, Nora Elbialy Mohamed, and Ali H. El-Far. 2021. "Ameliorative Effects of Aspergillus awamori against the Initiation of Hepatocarcinogenesis Induced by Diethylnitrosamine in a Rat Model: Regulation of Cyp19 and p53 Gene Expression" Antioxidants 10, no. 6: 922. https://doi.org/10.3390/antiox10060922
APA StyleAssar, D. H., Mokhbatly, A.-A. A., Ghazy, E. W., Ragab, A. E., Abou Asa, S., Abdo, W., Elbialy, Z. I., Mohamed, N. E., & El-Far, A. H. (2021). Ameliorative Effects of Aspergillus awamori against the Initiation of Hepatocarcinogenesis Induced by Diethylnitrosamine in a Rat Model: Regulation of Cyp19 and p53 Gene Expression. Antioxidants, 10(6), 922. https://doi.org/10.3390/antiox10060922