Activation of Nrf2 by Electrophiles Is Largely Independent of the Selenium Status of HepG2 Cells
Abstract
1. Introduction
2. Materials and Methods
2.1. Chemicals
2.2. Culture and Treatment of HepG2 Cells
2.3. RNA Isolation and Real-Time RT-PCR (qRT-PCR) Analysis
2.4. SDS-PAGE and Immunoblot Analysis
2.5. Statistical Analysis
3. Results and Discussion
3.1. Cytotoxicity of Selenite and the Applied Electrophilic Compounds in HepG2 Cells
3.2. Exposure of HepG2 Cells to Electrophiles Induces Rapid Nrf2 Stabilization and Nuclear Translocation that Is Largely Independent of the Cellular Se Status
3.3. Electrophile-Mediated Induction of Nrf2 Target Genes Is Marginally Affected by the Se Status of HepG2 Cells
3.4. Selenite-Induced Upregulation of Selenoprotein mRNAs Is Marginally Affected by Electrophiles
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Forman, H.J.; Davies, K.J.; Ursini, F. How do nutritional antioxidants really work: Nucleophilic tone and para-hormesis versus free radical scavenging in vivo. Free Radic. Biol. Med. 2014, 66, 24–35. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Klotz, L.O.; Steinbrenner, H. Cellular adaptation to xenobiotics: Interplay between xenosensors, reactive oxygen species and foxo transcription factors. Redox Biol. 2017, 13, 646–654. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tebay, L.E.; Robertson, H.; Durant, S.T.; Vitale, S.R.; Penning, T.M.; Dinkova-Kostova, A.T.; Hayes, J.D. Mechanisms of activation of the transcription factor nrf2 by redox stressors, nutrient cues, and energy status and the pathways through which it attenuates degenerative disease. Free Radic. Biol. Med. 2015, 88, 108–146. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yamamoto, M.; Kensler, T.W.; Motohashi, H. The keap1-nrf2 system: A thiol-based sensor-effector apparatus for maintaining redox homeostasis. Physiol. Rev. 2018, 98, 1169–1203. [Google Scholar] [CrossRef] [Scilit]
- Iso, T.; Suzuki, T.; Baird, L.; Yamamoto, M. Absolute amounts and status of the nrf2-keap1-cul3 complex within cells. Mol. Cell. Biol. 2016, 36, 3100–3112. [Google Scholar] [CrossRef] [Scilit]
- Dikic, I. Proteasomal and autophagic degradation systems. Annu. Rev. Biochem. 2017, 86, 193–224. [Google Scholar] [CrossRef] [Scilit]
- Jiang, T.; Harder, B.; Rojo de la Vega, M.; Wong, P.K.; Chapman, E.; Zhang, D.D. P62 links autophagy and nrf2 signaling. Free Radic. Biol. Med. 2015, 88, 199–204. [Google Scholar] [CrossRef] [Scilit]
- Pallauf, K.; Duckstein, N.; Hasler, M.; Klotz, L.O.; Rimbach, G. Flavonoids as putative inducers of the transcription factors nrf2, foxo, and ppargamma. Oxid. Med. Cell. Longev. 2017, 2017, 4397340. [Google Scholar] [CrossRef] [Scilit]
- Kryukov, G.V.; Castellano, S.; Novoselov, S.V.; Lobanov, A.V.; Zehtab, O.; Guigo, R.; Gladyshev, V.N. Characterization of mammalian selenoproteomes. Science 2003, 300, 1439–1443. [Google Scholar] [CrossRef] [Scilit]
- Steinbrenner, H.; Speckmann, B.; Klotz, L.O. Selenoproteins: Antioxidant selenoenzymes and beyond. Arch. Biochem. Biophys. 2016, 595, 113–119. [Google Scholar] [CrossRef] [Scilit]
- Banning, A.; Deubel, S.; Kluth, D.; Zhou, Z.; Brigelius-Flohe, R. The gi-gpx gene is a target for nrf2. Mol. Cell. Biol. 2005, 25, 4914–4923. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sakurai, A.; Nishimoto, M.; Himeno, S.; Imura, N.; Tsujimoto, M.; Kunimoto, M.; Hara, S. Transcriptional regulation of thioredoxin reductase 1 expression by cadmium in vascular endothelial cells: Role of nf-e2-related factor-2. J. Cell. Physiol. 2005, 203, 529–537. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Barrera, L.N.; Cassidy, A.; Wang, W.; Wei, T.; Belshaw, N.J.; Johnson, I.T.; Brigelius-Flohe, R.; Bao, Y. Trxr1 and gpx2 are potently induced by isothiocyanates and selenium, and mutually cooperate to protect caco-2 cells against free radical-mediated cell death. Biochim. Biophys. Acta 2012, 1823, 1914–1924. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, J.; Svehlikova, V.; Bao, Y.; Howie, A.F.; Beckett, G.J.; Williamson, G. Synergy between sulforaphane and selenium in the induction of thioredoxin reductase 1 requires both transcriptional and translational modulation. Carcinogenesis 2003, 24, 497–503. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Burk, R.F.; Hill, K.E.; Nakayama, A.; Mostert, V.; Levander, X.A.; Motley, A.K.; Johnson, D.A.; Johnson, J.A.; Freeman, M.L.; Austin, L.M. Selenium deficiency activates mouse liver nrf2-are but vitamin e deficiency does not. Free Radic. Biol. Med. 2008, 44, 1617–1623. [Google Scholar] [CrossRef] [Scilit]
- Mostert, V.; Hill, K.E.; Ferris, C.D.; Burk, R.F. Selective induction of liver parenchymal cell heme oxygenase-1 in selenium-deficient rats. Biol. Chem. 2003, 384, 681–687. [Google Scholar] [CrossRef] [Scilit]
- Muller, M.; Banning, A.; Brigelius-Flohe, R.; Kipp, A. Nrf2 target genes are induced under marginal selenium-deficiency. Genes Nutr. 2010, 5, 297–307. [Google Scholar] [CrossRef] [Scilit]
- Suzuki, T.; Kelly, V.P.; Motohashi, H.; Nakajima, O.; Takahashi, S.; Nishimura, S.; Yamamoto, M. Deletion of the selenocysteine trna gene in macrophages and liver results in compensatory gene induction of cytoprotective enzymes by nrf2. J. Biol. Chem. 2008, 283, 2021–2030. [Google Scholar] [CrossRef] [Scilit]
- Cebula, M.; Schmidt, E.E.; Arner, E.S. Trxr1 as a potent regulator of the nrf2-keap1 response system. Antioxid. Redox Signal 2015, 23, 823–853. [Google Scholar] [CrossRef] [Scilit]
- Schwarz, M.; Lossow, K.; Kopp, J.F.; Schwerdtle, T.; Kipp, A.P. Crosstalk of nrf2 with the trace elements selenium, iron, zinc, and copper. Nutrients 2019, 11, 2112. [Google Scholar] [CrossRef] [Scilit]
- Yim, S.H.; Clish, C.B.; Gladyshev, V.N. Selenium deficiency is associated with pro-longevity mechanisms. Cell. Rep. 2019, 27, 2785–2797.e2783. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- De Spirt, S.; Eckers, A.; Wehrend, C.; Micoogullari, M.; Sies, H.; Stahl, W.; Steinbrenner, H. Interplay between the chalcone cardamonin and selenium in the biosynthesis of nrf2-regulated antioxidant enzymes in intestinal caco-2 cells. Free Radic. Biol. Med. 2016, 91, 164–171. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tindell, R.; Wall, S.B.; Li, Q.; Li, R.; Dunigan, K.; Wood, R.; Tipple, T.E. Selenium supplementation of lung epithelial cells enhances nuclear factor e2-related factor 2 (nrf2) activation following thioredoxin reductase inhibition. Redox Biol. 2018, 19, 331–338. [Google Scholar] [CrossRef] [Scilit]
- Takaya, K.; Suzuki, T.; Motohashi, H.; Onodera, K.; Satomi, S.; Kensler, T.W.; Yamamoto, M. Validation of the multiple sensor mechanism of the keap1-nrf2 system. Free Radic. Biol. Med. 2012, 53, 817–827. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Peng, S.; Hou, Y.; Yao, J.; Fang, J. Activation of nrf2-driven antioxidant enzymes by cardamonin confers neuroprotection of pc12 cells against oxidative damage. Food Funct. 2017, 8, 997–1007. [Google Scholar] [CrossRef] [Scilit]
- Gille, A.; Turkistani, A.; Tsitsipatis, D.; Hou, X.; Tauber, S.; Hamann, I.; Urban, N.; Erler, K.; Steinbrenner, H.; Klotz, L.O. Nuclear trapping of inactive foxo1 by the nrf2 activator diethyl maleate. Redox Biol. 2019, 20, 19–27. [Google Scholar] [CrossRef] [Scilit]
- Speckmann, B.; Walter, P.L.; Alili, L.; Reinehr, R.; Sies, H.; Klotz, L.O.; Steinbrenner, H. Selenoprotein p expression is controlled through interaction of the coactivator pgc-1alpha with foxo1a and hepatocyte nuclear factor 4alpha transcription factors. Hepatology 2008, 48, 1998–2006. [Google Scholar] [CrossRef] [Scilit]
- Fosang, A.J.; Colbran, R.J. Transparency is the key to quality. J. Biol. Chem. 2015, 290, 29692–29694. [Google Scholar] [CrossRef] [Scilit]
- Hoefig, C.S.; Renko, K.; Kohrle, J.; Birringer, M.; Schomburg, L. Comparison of different selenocompounds with respect to nutritional value vs. Toxicity using liver cells in culture. J. Nutr. Biochem. 2011, 22, 945–955. [Google Scholar] [CrossRef] [Scilit]
- Burk, R.F.; Hill, K.E. Regulation of selenium metabolism and transport. Annu. Rev. Nutr. 2015, 35, 109–134. [Google Scholar] [CrossRef] [Scilit]
- Fradejas-Villar, N.; Seeher, S.; Anderson, C.B.; Doengi, M.; Carlson, B.A.; Hatfield, D.L.; Schweizer, U.; Howard, M.T. The rna-binding protein secisbp2 differentially modulates uga codon reassignment and rna decay. Nucleic Acids Res. 2017, 45, 4094–4107. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kemmerer, Z.A.; Ader, N.R.; Mulroy, S.S.; Eggler, A.L. Comparison of human nrf2 antibodies: A tale of two proteins. Toxicol. Lett. 2015, 238, 83–89. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Basten, G.P.; Bao, Y.; Williamson, G. Sulforaphane and its glutathione conjugate but not sulforaphane nitrile induce udp-glucuronosyl transferase (ugt1a1) and glutathione transferase (gsta1) in cultured cells. Carcinogenesis 2002, 23, 1399–1404. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lau, A.; Tian, W.; Whitman, S.A.; Zhang, D.D. The predicted molecular weight of nrf2: It is what it is not. Antioxid. Redox Signal 2013, 18, 91–93. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hirao, H.; Dery, K.J.; Kageyama, S.; Nakamura, K.; Kupiec-Weglinski, J.W. Heme oxygenase-1 in liver transplant ischemia-reperfusion injury: From bench-to-bedside. Free Radic. Biol. Med. 2020, 157, 75–82. [Google Scholar] [CrossRef] [Scilit]
- Dagnell, M.; Schmidt, E.E.; Arner, E.S.J. The a to z of modulated cell patterning by mammalian thioredoxin reductases. Free Radic. Biol. Med. 2018, 115, 484–496. [Google Scholar] [CrossRef] [Scilit]
- Lu, J.; Holmgren, A. The thioredoxin antioxidant system. Free Radic. Biol. Med. 2014, 66, 75–87. [Google Scholar] [CrossRef] [Scilit]
- Hayes, J.D.; Pulford, D.J. The glutathione s-transferase supergene family: Regulation of gst and the contribution of the isoenzymes to cancer chemoprotection and drug resistance. Crit. Rev. Biochem. Mol. Biol. 1995, 30, 445–600. [Google Scholar] [CrossRef] [Scilit]
- Park, S.H.; Kim, J.H.; Chi, G.Y.; Kim, G.Y.; Chang, Y.C.; Moon, S.K.; Nam, S.W.; Kim, W.J.; Yoo, Y.H.; Choi, Y.H. Induction of apoptosis and autophagy by sodium selenite in a549 human lung carcinoma cells through generation of reactive oxygen species. Toxicol. Lett. 2012, 212, 252–261. [Google Scholar] [CrossRef] [Scilit]
- Roos, N.J.; Aliu, D.; Bouitbir, J.; Krahenbuhl, S. Lapatinib activates the kelch-like ech-associated protein 1-nuclear factor erythroid 2-related factor 2 pathway in hepg2 cells. Front Pharm. 2020, 11, 944. [Google Scholar] [CrossRef] [Scilit]
- Touat-Hamici, Z.; Bulteau, A.L.; Bianga, J.; Jean-Jacques, H.; Szpunar, J.; Lobinski, R.; Chavatte, L. Selenium-regulated hierarchy of human selenoproteome in cancerous and immortalized cells lines. Biochim. Biophys. Acta Gen. Subj. 2018, 1862, 2493–2505. [Google Scholar] [PubMed]
- Goncalves, L.M.; Valente, I.M.; Rodrigues, J.A. An overview on cardamonin. J. Med. Food 2014, 17, 633–640. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, T.; Yamamoto, N.; Ashida, H. Chalcones suppress fatty acid-induced lipid accumulation through a lkb1/ampk signaling pathway in hepg2 cells. Food Funct. 2014, 5, 1134–1141. [Google Scholar] [PubMed]
- Brigelius-Flohe, R.; Flohe, L. Regulatory phenomena in the glutathione peroxidase superfamily. Antioxid. Redox Signal 2020, 33, 498–516. [Google Scholar] [CrossRef] [Scilit]
- Sunde, R.A.; Raines, A.M. Selenium regulation of the selenoprotein and nonselenoprotein transcriptomes in rodents. Adv. Nutr. 2011, 2, 138–150. [Google Scholar]
- Becker, N.P.; Martitz, J.; Renko, K.; Stoedter, M.; Hybsier, S.; Cramer, T.; Schomburg, L. Hypoxia reduces and redirects selenoprotein biosynthesis. Metallomics 2014, 6, 1079–1086. [Google Scholar] [CrossRef] [Scilit]
- Steinbrenner, H.; Klotz, L.O. [selenium and zinc: “Antioxidants” for healthy aging?]. Z Gerontol. Geriatr. 2020, 53, 295–302. [Google Scholar] [CrossRef] [Scilit]
- Ravn-Haren, G.; Bugel, S.; Krath, B.N.; Hoac, T.; Stagsted, J.; Jorgensen, K.; Bresson, J.R.; Larsen, E.H.; Dragsted, L.O. A short-term intervention trial with selenate, selenium-enriched yeast and selenium-enriched milk: Effects on oxidative defence regulation. Br. J. Nutr. 2008, 99, 883–892. [Google Scholar] [CrossRef] [Scilit]





| Gene | Gene-ID | Forward Primer | Reverse Primer |
|---|---|---|---|
| GPX1 | NM_000581 | caaccagtttgggcatcag | tctcgaagagcatgaagttgg |
| GSTA1 | NM_145740 | ctacgtcgaggagcttgactc | cttcttcactgtgggcaggt |
| HMOX1 | NM_002133 | agactgcgttcctgctcaac | ggctctggtccttggtgtc |
| HPRT1 | NM_000194 | ggggacataaaagtaattggtggag | ctgaccaaggaaagcaaagtctg |
| SELENOP | NM_005410 | aactgctctctcacgactctc | agcatttggtgctcctggtt |
| SELENOW | NM_003009 | cgtggacacagaaagcaagtt | gagaggggctgggtcaag |
| SQSTM1 | NM_003900 | agctgccttgtacccacatc | cagagaagcccatggacag |
| TXNRD1 | NM_182729 | ttggaatccaccctgtctgt | catccacactggggcttaac |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tauber, S.; Sieckmann, M.K.; Erler, K.; Stahl, W.; Klotz, L.-O.; Steinbrenner, H. Activation of Nrf2 by Electrophiles Is Largely Independent of the Selenium Status of HepG2 Cells. Antioxidants 2021, 10, 167. https://doi.org/10.3390/antiox10020167
Tauber S, Sieckmann MK, Erler K, Stahl W, Klotz L-O, Steinbrenner H. Activation of Nrf2 by Electrophiles Is Largely Independent of the Selenium Status of HepG2 Cells. Antioxidants. 2021; 10(2):167. https://doi.org/10.3390/antiox10020167
Chicago/Turabian StyleTauber, Sarah, Maria Katharina Sieckmann, Katrin Erler, Wilhelm Stahl, Lars-Oliver Klotz, and Holger Steinbrenner. 2021. "Activation of Nrf2 by Electrophiles Is Largely Independent of the Selenium Status of HepG2 Cells" Antioxidants 10, no. 2: 167. https://doi.org/10.3390/antiox10020167
APA StyleTauber, S., Sieckmann, M. K., Erler, K., Stahl, W., Klotz, L.-O., & Steinbrenner, H. (2021). Activation of Nrf2 by Electrophiles Is Largely Independent of the Selenium Status of HepG2 Cells. Antioxidants, 10(2), 167. https://doi.org/10.3390/antiox10020167

