Rutaecarpine Protects against Acetaminophen-Induced Acute Liver Injury in Mice by Activating Antioxidant Enzymes
Abstract
1. Introduction
2. Materials and Methods
2.1. Reagents
2.2. Animals and Treatments
2.3. Histopathological Examination
2.4. Biochemical Analysis
2.5. ELISA
2.6. RNA Extraction and Real-Time PCR
2.7. Western Blot
2.8. Statistical Analysis
3. Results
3.1. Rut Pretreatment Suppressed APAP-Induced Hepatotoxicity by Attenuating CYP2E1
3.2. Rut Pretreatment Suppressed APAP-Induced Proinflammatory Cytokines by Inhibiting NF-κB Signaling
3.3. Rut Pretreatment Prevented APAP-Reduced Antioxidant Enzymes by Activating Nrf2
3.4. Rut Pretreatment Attenuated APAP-Induced Hepatotoxicity by Inhibiting JNK1/2 Signaling
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Andrade, R.J.; Aithal, G.P.; Björnsson, E.S.; Kaplowitz, N.; Kullak-Ublick, G.A.; Larrey, D.; Karlsen, T.H. EASL Clinical Practice Guidelines: Drug-induced liver injury. J. Hepatol. 2019, 70, 1222–1261. [Google Scholar] [CrossRef] [Scilit]
- Larson, A.M.; Polson, J.; Fontana, R.J.; Davern, T.J.; Lalani, E.; Hynan, L.S.; Reisch, J.S.; Schiodt, F.V.; Ostapowicz, G.; Shakil, A.O.; et al. Acetaminophen-induced acute liver failure: Results of a United States multicenter, prospective study. Hepatology 2005, 42, 1364–1372. [Google Scholar] [CrossRef] [Scilit]
- Hinson, J.A.; Roberts, D.W.; James, L.P. Mechanisms of acetaminophen-induced liver necrosis. Handb. Exp. Pharmacol. 2010, 196, 369–405. [Google Scholar] [CrossRef] [Scilit]
- Nourjah, P.; Ahmad, S.R.; Karwoski, C.; Willy, M. Estimates of acetaminophen (Paracetomal)-associated overdoses in the United States. Pharmacoepidemiol. Drug Saf. 2006, 15, 398–405. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Budnitz, D.S.; Lovegrove, M.C.; Crosby, A.E. Emergency department visits for overdoses of acetaminophen-containing products. Am. J. Prev. Med. 2011, 40, 585–592. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kuna, L.; Bozic, I.; Kizivat, T.; Bojanic, K.; Mrso, M.; Kralj, E.; Smolic, R.; Wu, G.Y.; Smolic, M. Models of Drug Induced Liver Injury (DILI)—Current Issues and Future Perspectives. Curr. Drug Metab. 2018, 19, 830–838. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Madrigal-Santillan, E.; Madrigal-Bujaidar, E.; Alvarez-Gonzalez, I.; Sumaya-Martinez, M.T.; Gutierrez-Salinas, J.; Bautista, M.; Morales-Gonzalez, A.; Garcia-Luna y Gonzalez-Rubio, M.; Aguilar-Faisal, J.L.; Morales-Gonzalez, J.A. Review of natural products with hepatoprotective effects. World J. Gastroenterol. 2014, 20, 14787–14804. [Google Scholar] [CrossRef] [Scilit]
- Cao, H.; Chai, T.T.; Wang, X.; Morais-Braga, M.F.B.; Yang, J.H.; Wong, F.C.; Wang, R.; Yao, H.; Cao, J.; Cornara, L.; et al. Phytochemicals from fern species: Potential for medicine applications. Phytochem. Rev. 2017, 16, 379–440. [Google Scholar] [CrossRef] [Scilit]
- Cui, X.; Wang, S.; Cao, H.; Guo, H.; Li, Y.; Xu, F.; Zheng, M.; Xi, X.; Han, C. A Review: The Bioactivities and Pharmacological Applications of Polygonatum sibiricum polysaccharides. Molecules 2018, 23, 1170. [Google Scholar] [CrossRef] [Scilit]
- Tian, K.M.; Li, J.J.; Xu, S.W. Rutaecarpine: A promising cardiovascular protective alkaloid from Evodia rutaecarpa (Wu Zhu Yu). Pharmacol. Res. 2019, 141, 541–550. [Google Scholar] [CrossRef] [Scilit]
- Hu, X.; Li, D.; Chu, C.; Li, X.; Wang, X.; Jia, Y.; Hua, H.; Xu, F. Antiproliferative Effects of Alkaloid Evodiamine and Its Derivatives. Int. J. Mol. Sci. 2018, 19, 3403. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jin, S.W.; Hwang, Y.P.; Choi, C.Y.; Kim, H.G.; Kim, S.J.; Kim, Y.; Chung, Y.C.; Lee, K.J.; Jeong, T.C.; Jeong, H.G. Protective effect of rutaecarpine against t-BHP-induced hepatotoxicity by upregulating antioxidant enzymes via the CaMKII-Akt and Nrf2/ARE pathways. Food Chem. Toxicol. 2017, 100, 138–148. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Choi, J.H.; Jin, S.W.; Choi, C.Y.; Kim, H.G.; Kim, S.J.; Lee, H.S.; Chung, Y.C.; Kim, E.J.; Lee, Y.C.; Jeong, H.G. Saponins from the roots of Platycodon grandiflorum ameliorate high fat diet-induced non-alcoholic steatohepatitis. Biomed. Pharmacother. 2017, 86, 205–212. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gum, S.I.; Cho, M.K. Korean red ginseng extract prevents APAP-induced hepatotoxicity through metabolic enzyme regulation: The role of ginsenoside Rg3, a protopanaxadiol. Liver Int. 2013, 33, 1071–1084. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sanz-Garcia, C.; Ferrer-Mayorga, G.; Gonzalez-Rodriguez, A.; Valverde, A.M.; Martin-Duce, A.; Velasco-Martin, J.P.; Regadera, J.; Fernandez, M.; Alemany, S. Sterile inflammation in acetaminophen-induced liver injury is mediated by Cot/tpl2. J. Biol. Chem. 2013, 288, 15342–15351. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, J.; Zhang, S.; Bi, J.; Gu, J.; Deng, Y.; Liu, C. Astaxanthin pretreatment attenuates acetaminophen-induced liver injury in mice. Int. Immunopharmacol. 2017, 45, 26–33. [Google Scholar] [CrossRef] [Scilit]
- Ding, Y.; Li, Q.; Xu, Y.; Chen, Y.; Deng, Y.; Zhi, F.; Qian, K. Attenuating Oxidative Stress by Paeonol Protected against Acetaminophen-Induced Hepatotoxicity in Mice. PLoS ONE 2016, 11, e0154375. [Google Scholar] [CrossRef] [Scilit]
- Shen, H.; Sheng, L.; Chen, Z.; Jiang, L.; Su, H.; Yin, L.; Omary, M.B.; Rui, L. Mouse hepatocyte overexpression of NF-kappaB-inducing kinase (NIK) triggers fatal macrophage-dependent liver injury and fibrosis. Hepatology 2014, 60, 2065–2076. [Google Scholar] [CrossRef] [Scilit]
- Shi, L.; Hao, Z.; Zhang, S.; Wei, M.; Lu, B.; Wang, Z.; Ji, L. Baicalein and baicalin alleviate acetaminophen-induced liver injury by activating Nrf2 antioxidative pathway: The involvement of ERK1/2 and PKC. Biochem. Pharmacol. 2018, 150, 9–23. [Google Scholar] [CrossRef] [Scilit]
- Yan, M.; Ye, L.; Yin, S.; Lu, X.; Liu, X.; Lu, S.; Cui, J.; Fan, L.; Kaplowitz, N.; Hu, H. Glycycoumarin protects mice against acetaminophen-induced liver injury predominantly via activating sustained autophagy. Br. J. Pharmacol. 2018, 175, 3747–3757. [Google Scholar] [CrossRef] [Scilit]
- Zhang, J.; Song, Q.; Han, X.; Zhang, Y.; Zhang, Y.; Zhang, X.; Chu, X.; Zhang, F.; Chu, L. Multi-targeted protection of acetaminophen-induced hepatotoxicity in mice by tannic acid. Int. Immunopharmacol. 2017, 47, 95–105. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, X.; Liu, J.; Zhang, X.; Zhao, S.; Zou, K.; Xie, J.; Wang, X.; Liu, C.; Wang, J.; Wang, Y. Seabuckthorn berry polysaccharide extracts protect against acetaminophen induced hepatotoxicity in mice via activating the Nrf-2/HO-1-SOD-2 signaling pathway. Phytomedicine 2018, 38, 90–97. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, Z.; Hu, J.N.; Yan, M.H.; Xing, J.J.; Liu, W.C.; Li, W. Caspase-Mediated Anti-Apoptotic Effect of Ginsenoside Rg5, a Main Rare Ginsenoside, on Acetaminophen-Induced Hepatotoxicity in Mice. J. Agric. Food Chem. 2017, 65, 9226–9236. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hussain, Z.; Khan, J.A.; Arshad, A.; Asif, P.; Rashid, H.; Arshad, M.I. Protective effects of Cinnamomum zeylanicum L. (Darchini) in acetaminophen-induced oxidative stress, hepatotoxicity and nephrotoxicityin mouse model. Biomed. Pharmacother. 2019, 109, 2285–2292. [Google Scholar] [CrossRef] [Scilit]
- Xie, W.; Jiang, Z.; Wang, J.; Zhang, X.; Melzig, M.F. Protective effect of hyperoside against acetaminophen (APAP) induced liver injury through enhancement of APAP clearance. Chem. Biol. Interact. 2016, 246, 11–19. [Google Scholar] [CrossRef] [Scilit]
- Wang, W.; Guan, C.; Sun, X.; Zhao, Z.; Li, J.; Fu, X.; Qiu, Y.; Huang, M.; Jin, J.; Huang, Z. Tanshinone IIA protects against acetaminophen-induced hepatotoxicity via activating the Nrf2 pathway. Phytomedicine 2016, 23, 589–596. [Google Scholar] [CrossRef] [Scilit]
- Jaeschke, H.; McGill, M.R.; Ramachandran, A. Oxidant stress, mitochondria, and cell death mechanisms in drug-induced liver injury: Lessons learned from acetaminophen hepatotoxicity. Drug Metab. Rev. 2012, 44, 88–106. [Google Scholar] [CrossRef] [Scilit]
- Lv, H.; Xiao, Q.; Zhou, J.; Feng, H.; Liu, G.; Ci, X. Licochalcone A Upregulates Nrf2 Antioxidant Pathway and Thereby Alleviates Acetaminophen-Induced Hepatotoxicity. Front. Pharmacol. 2018, 9, 147. [Google Scholar] [CrossRef] [Scilit]
- Xu, X.Y.; Hu, J.N.; Liu, Z.; Zhang, R.; He, Y.F.; Hou, W.; Wang, Z.Q.; Yang, G.; Li, W. Saponins (Ginsenosides) from the Leaves of Panax quinquefolius Ameliorated Acetaminophen-Induced Hepatotoxicity in Mice. J. Agric. Food Chem. 2017, 65, 3684–3692. [Google Scholar] [CrossRef] [Scilit]
- Yang, C.; Yi, J.; Gong, X.; Ge, P.; Dai, J.; Lin, L.; Xing, Y.; Zhang, L. Anti-oxidative and anti-inflammatory benefits of the ribonucleoside analogue 5-azacitidine in mice with acetaminophen-induced toxic hepatitis. Int. Immunopharmacol. 2017, 48, 91–95. [Google Scholar] [CrossRef] [Scilit]
- Yang, G.; Zhang, L.; Ma, L.; Jiang, R.; Kuang, G.; Li, K.; Tie, H.; Wang, B.; Chen, X.; Xie, T.; et al. Glycyrrhetinic acid prevents acetaminophen-induced acute liver injury via the inhibition of CYP2E1 expression and HMGB1-TLR4 signal activation in mice. Int. Immunopharmacol. 2017, 50, 186–193. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, L.; Zhang, S.; Cheng, H.; Lv, H.; Cheng, G.; Ci, X. Nrf2-mediated liver protection by esculentoside A against acetaminophen toxicity through the AMPK/Akt/GSK3beta pathway. Free Radic. Biol. Med. 2016, 101, 401–412. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kaspar, J.W.; Niture, S.K.; Jaiswal, A.K. Nrf2:INrf2 (Keap1) signaling in oxidative stress. Free Radic. Biol. Med. 2009, 47, 1304–1309. [Google Scholar] [CrossRef] [Scilit] [PubMed]







| Gene | Sequences | NCBI Number | |
|---|---|---|---|
| TNF-α | F | TTGTCTACTCCCAGGTTCTCTT | NM_001278601.1 |
| R | ACTTTCTCCTGGTATGAGATAGC | ||
| IL-1β | F | GAAAGAATCTATACCTGTCCTGTGTAA | NM_008361.4 |
| R | CTTCTATCTTGTTGAAGACAAACCG | ||
| IL-6 | F | ATACAGAAACTCTAATTCATATCTTCAACC | NM_031168.2 |
| R | AGCTTATCTGTTAGGAGAGCAT | ||
| β-actin | F | CCACCAGTTCGCCATGGAT | NM_007393.5 |
| R | CCACGATGGAGGGGAATACA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Choi, J.H.; Jin, S.W.; Lee, G.H.; Han, E.H.; Hwang, Y.P.; Jeong, H.G. Rutaecarpine Protects against Acetaminophen-Induced Acute Liver Injury in Mice by Activating Antioxidant Enzymes. Antioxidants 2021, 10, 86. https://doi.org/10.3390/antiox10010086
Choi JH, Jin SW, Lee GH, Han EH, Hwang YP, Jeong HG. Rutaecarpine Protects against Acetaminophen-Induced Acute Liver Injury in Mice by Activating Antioxidant Enzymes. Antioxidants. 2021; 10(1):86. https://doi.org/10.3390/antiox10010086
Chicago/Turabian StyleChoi, Jae Ho, Sun Woo Jin, Gi Ho Lee, Eun Hee Han, Yong Pil Hwang, and Hye Gwang Jeong. 2021. "Rutaecarpine Protects against Acetaminophen-Induced Acute Liver Injury in Mice by Activating Antioxidant Enzymes" Antioxidants 10, no. 1: 86. https://doi.org/10.3390/antiox10010086
APA StyleChoi, J. H., Jin, S. W., Lee, G. H., Han, E. H., Hwang, Y. P., & Jeong, H. G. (2021). Rutaecarpine Protects against Acetaminophen-Induced Acute Liver Injury in Mice by Activating Antioxidant Enzymes. Antioxidants, 10(1), 86. https://doi.org/10.3390/antiox10010086

