Low-Intensity Pulsed Ultrasound Attenuates Postoperative Neurocognitive Impairment and Salvages Hippocampal Synaptogenesis in Aged Mice
Abstract
1. Introduction
2. Materials and Methods
2.1. Animal Care
2.2. Anesthesia/Surgery
2.3. LIPUS on Hippocampus
2.4. Behavioral Test
2.5. Real Time-qPCR
2.6. Immunofluorescent Staining
2.7. Hematoxylin-Eosin (HE) Staining
2.8. Western Blotting
2.9. Statistical Analysis
3. Results
3.1. LIPUS Could Safely Induce Neuronal Activation in Dorsal Hippocampus
3.2. LIPUS Attenuates Hippocampus-Dependent Spatial Reference Learning and Memory Injury after A/S in Aged Mice
3.3. LIPUS Reduces the Neuroinflammation of Hippocampus after A/S in Aged Mice
3.4. LIPUS Reverses the Reduced Synapse-Related Proteins of the Hippocampus after A/S in Aged Mice
3.5. LIPUS Suppresses the Overexpression of Piezo1 after A/S in Aged Mice
3.6. LIPUS May Improve Synaptic Function through Modulating Piezo1/Calpain/Erk Pathway
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Shetty, A.K.; Kodali, M.; Upadhya, R.; Madhu, L.N. Emerging Anti-Aging Strategies—Scientific Basis and Efficacy. Aging Dis. 2018, 9, 1165–1184. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Holmgaard, F.; Vedel, A.G.; Rasmussen, L.S.; Paulson, O.B.; Nilsson, J.C.; Ravn, H.B. The association between postoperative cognitive dysfunction and cerebral oximetry during cardiac surgery: A secondary analysis of a randomised trial. Br. J. Anaesth. 2019, 123, 196–205. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, N.N.; Sun, L.; Chen, W.T.; Yang, Y.L.; Wu, Y.M. Effects of edaravone on postoperative cognitive function in elderly patients undergoing hip joint replacement surgery: A randomized controlled trial. Int. J. Surg. 2020, 80, 13–18. [Google Scholar] [CrossRef] [Scilit]
- Rundshagen, I. Postoperative cognitive dysfunction. Dtsch. Arztebl. Int. 2014, 111, 119–125. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mahanna-Gabrielli, E.; Schenning, K.J.; Eriksson, L.I.; Browndyke, J.N.; Wright, C.B.; Evered, L.; Scott, D.A.; Wang, N.Y.; Brown, C.H.; Oh, E.; et al. State of the clinical science of perioperative brain health: Report from the American Society of Anesthesiologists Brain Health Initiative Summit 2018. Br. J. Anaesth. 2019, 123, 464–478. [Google Scholar] [CrossRef] [Scilit]
- Saczynski, J.S.; Marcantonio, E.R.; Quach, L.; Fong, T.G.; Gross, A.; Inouye, S.K.; Jones, R.N. Cognitive trajectories after postoperative delirium. N. Engl. J. Med. 2012, 367, 30–39. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Viramontes, O.; Luan Erfe, B.M.; Erfe, J.M.; Brovman, E.Y.; Boehme, J.; Bader, A.M.; Urman, R.D. Cognitive impairment and postoperative outcomes in patients undergoing primary total hip arthroplasty: A systematic review. J. Clin. Anesth. 2019, 56, 65–76. [Google Scholar] [CrossRef] [Scilit]
- Yang, T.; Velagapudi, R.; Terrando, N. Neuroinflammation after surgery: From mechanisms to therapeutic targets. Nat. Immunol. 2020, 21, 1319–1326. [Google Scholar] [CrossRef] [Scilit]
- Skaper, S.D.; Facci, L.; Zusso, M.; Giusti, P. Synaptic Plasticity, Dementia and Alzheimer Disease. CNS Neurol. Disord. Drug Targets 2017, 16, 220–233. [Google Scholar] [CrossRef] [Scilit]
- Mandolesi, G.; Gentile, A.; Musella, A.; Fresegna, D.; De Vito, F.; Bullitta, S.; Sepman, H.; Marfia, G.A.; Centonze, D. Synaptopathy connects inflammation and neurodegeneration in multiple sclerosis. Nat. Rev. Neurol. 2015, 11, 711–724. [Google Scholar] [CrossRef] [Scilit]
- Chen, Y.; Fu, A.K.Y.; Ip, N.Y. Synaptic dysfunction in Alzheimer’s disease: Mechanisms and therapeutic strategies. Pharmacol. Ther. 2019, 195, 186–198. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Briz, V.; Baudry, M. Calpains: Master Regulators of Synaptic Plasticity. Neuroscientist 2017, 23, 221–231. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Leal, G.; Comprido, D.; Duarte, C.B. BDNF-induced local protein synthesis and synaptic plasticity. Neuropharmacology 2014, 76, 639–656. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Alonso, M.; Medina, J.H.; Pozzo-Miller, L. ERK1/2 activation is necessary for BDNF to increase dendritic spine density in hippocampal CA1 pyramidal neurons. Learn. Mem. 2004, 11, 172–178. [Google Scholar] [CrossRef] [Scilit]
- Shimizu, K.; Mackenzie, S.M.; Storm, D.R. SCOP/PHLPP and its functional role in the brain. Mol. Biosyst. 2010, 6, 38–43. [Google Scholar] [CrossRef] [Scilit]
- Chen, L.; Yang, N.; Li, Y.; Li, Y.; Hong, J.; Wang, Q.; Liu, K.; Han, D.; Han, Y.; Mi, X.; et al. Cholecystokinin octapeptide improves hippocampal glutamatergic synaptogenesis and postoperative cognition by inhibiting induction of A1 reactive astrocytes in aged mice. CNS Neurosci. Ther. 2021, 27, 1374–1384. [Google Scholar] [CrossRef] [Scilit]
- Wang, D.S.; Terrando, N.; Orser, B.A. Targeting microglia to mitigate perioperative neurocognitive disorders. Br. J. Anaesth. 2020, 125, 229–232. [Google Scholar] [CrossRef] [Scilit]
- Bystritsky, A.; Korb, A.S.; Douglas, P.K.; Cohen, M.S.; Melega, W.P.; Mulgaonkar, A.P.; DeSalles, A.; Min, B.K.; Yoo, S.S. A review of low-intensity focused ultrasound pulsation. Brain Stimul. 2011, 4, 125–136. [Google Scholar] [CrossRef] [Scilit]
- ter Haar, G. Therapeutic applications of ultrasound. Prog. Biophys. Mol. Biol. 2007, 93, 111–129. [Google Scholar] [CrossRef] [Scilit]
- Elias, W.J.; Lipsman, N.; Ondo, W.G.; Ghanouni, P.; Kim, Y.G.; Lee, W.; Schwartz, M.; Hynynen, K.; Lozano, A.M.; Shah, B.B.; et al. A Randomized Trial of Focused Ultrasound Thalamotomy for Essential Tremor. N. Engl. J. Med. 2016, 375, 730–739. [Google Scholar] [CrossRef] [Scilit]
- Legon, W.; Sato, T.F.; Opitz, A.; Mueller, J.; Barbour, A.; Williams, A.; Tyler, W.J. Transcranial focused ultrasound modulates the activity of primary somatosensory cortex in humans. Nat. Neurosci. 2014, 17, 322–329. [Google Scholar] [CrossRef] [Scilit]
- Tufail, Y.; Matyushov, A.; Baldwin, N.; Tauchmann, M.L.; Georges, J.; Yoshihiro, A.; Tillery, S.I.; Tyler, W.J. Transcranial pulsed ultrasound stimulates intact brain circuits. Neuron 2010, 66, 681–694. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sung, C.Y.; Chiang, P.K.; Tsai, C.W.; Yang, F.Y. Low-Intensity Pulsed Ultrasound Enhances Neurotrophic Factors and Alleviates Neuroinflammation in a Rat Model of Parkinson’s Disease. Cereb. Cortex 2021, 32, 176–185. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Niu, X.; Yu, K.; He, B. Transcranial focused ultrasound induces sustained synaptic plasticity in rat hippocampus. Brain Stimul. 2022, 15, 352–359. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dell’Italia, J.; Sanguinetti, J.L.; Monti, M.M.; Bystritsky, A.; Reggente, N. Current State of Potential Mechanisms Supporting Low Intensity Focused Ultrasound for Neuromodulation. Front. Hum. Neurosci. 2022, 16, 872639. [Google Scholar] [CrossRef] [Scilit]
- Guo, J.; Gu, D.; Zhao, T.; Zhao, Z.; Xiong, Y.; Sun, M.; Xin, C.; Zhang, Y.; Pei, L.; Sun, J. Trends in Piezo Channel Research Over the Past Decade: A Bibliometric Analysis. Front. Pharmacol. 2021, 12, 668714. [Google Scholar] [CrossRef] [Scilit]
- Fang, X.Z.; Zhou, T.; Xu, J.Q.; Wang, Y.X.; Sun, M.M.; He, Y.J.; Pan, S.W.; Xiong, W.; Peng, Z.K.; Gao, X.H.; et al. Structure, kinetic properties and biological function of mechanosensitive Piezo channels. Cell Biosci. 2021, 11, 13. [Google Scholar] [CrossRef] [Scilit]
- Tang, H.; Zeng, R.; He, E.; Zhang, I.; Ding, C.; Zhang, A. Piezo-Type Mechanosensitive Ion Channel Component 1 (Piezo1): A Promising Therapeutic Target and Its Modulators. J. Med. Chem. 2022, 65, 6441–6453. [Google Scholar] [CrossRef] [Scilit]
- Prieto, M.L.; Firouzi, K.; Khuri-Yakub, B.T.; Maduke, M. Activation of Piezo1 but Not NaV1.2 Channels by Ultrasound at 43 MHz. Ultrasound Med. Biol. 2018, 44, 1217–1232. [Google Scholar] [CrossRef] [Scilit]
- Qiu, Z.; Guo, J.; Kala, S.; Zhu, J.; Xian, Q.; Qiu, W.; Li, G.; Zhu, T.; Meng, L.; Zhang, R.; et al. The Mechanosensitive Ion Channel Piezo1 Significantly Mediates In Vitro Ultrasonic Stimulation of Neurons. iScience 2019, 21, 448–457. [Google Scholar] [CrossRef] [Scilit]
- Ren, X.; Li, B.; Xu, C.; Zhuang, H.; Lei, T.; Jiang, F.; Zhou, P. High expression of Piezo1 induces senescence in chondrocytes through calcium ions accumulation. Biochem. Biophys. Res. Commun. 2022, 607, 138–145. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Velasco-Estevez, M.; Mampay, M.; Boutin, H.; Chaney, A.; Warn, P.; Sharp, A.; Burgess, E.; Moeendarbary, E.; Dev, K.K.; Sheridan, G.K. Infection Augments Expression of Mechanosensing Piezo1 Channels in Amyloid Plaque-Reactive Astrocytes. Front. Aging Neurosci. 2018, 10, 332. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, Y.Y.; Zhang, H.; Ma, T.; Lu, Y.; Xie, H.Y.; Wang, W.; Ma, Y.H.; Li, G.H.; Li, Y.W. Piezo1 mediates neuron oxygen-glucose deprivation/reoxygenation injury via Ca(2+)/calpain signaling. Biochem. Biophys. Res. Commun. 2019, 513, 147–153. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ma, T.; Wang, Y.Y.; Lu, Y.; Feng, L.; Yang, Y.T.; Li, G.H.; Li, C.; Chu, Y.; Wang, W.; Zhang, H. Inhibition of Piezo1/Ca(2+)/calpain signaling in the rat basal forebrain reverses sleep deprivation-induced fear memory impairments. Behav. Brain. Res. 2022, 417, 113594. [Google Scholar] [CrossRef] [Scilit]
- Percie du Sert, N.; Hurst, V.; Ahluwalia, A.; Alam, S.; Avey, M.T.; Baker, M.; Browne, W.J.; Clark, A.; Cuthill, I.C.; Dirnagl, U.; et al. The ARRIVE guidelines 2.0: Updated guidelines for reporting animal research. PLoS Biol. 2020, 18, e3000410. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Han, D.; Li, Z.; Liu, T.; Yang, N.; Li, Y.; He, J.; Qian, M.; Kuang, Z.; Zhang, W.; Ni, C.; et al. Prebiotics Regulation of Intestinal Microbiota Attenuates Cognitive Dysfunction Induced by Surgery Stimulation in APP/PS1 Mice. Aging Dis. 2020, 11, 1029–1045. [Google Scholar] [CrossRef] [Scilit]
- He, J.; Liu, T.; Li, Y.; Mi, X.; Han, D.; Yang, N.; Chen, L.; Li, Y.; Hong, J.; Kuang, C.; et al. JNK inhibition alleviates delayed neurocognitive recovery after surgery by limiting microglia pyroptosis. Int. Immunopharmacol. 2021, 99, 107962. [Google Scholar] [CrossRef] [Scilit]
- Vorhees, C.V.; Williams, M.T. Morris water maze: Procedures for assessing spatial and related forms of learning and memory. Nat. Protoc. 2006, 1, 848–858. [Google Scholar] [CrossRef] [Scilit]
- Joo, J.Y.; Schaukowitch, K.; Farbiak, L.; Kilaru, G.; Kim, T.K. Stimulus-specific combinatorial functionality of neuronal c-fos enhancers. Nat. Neurosci. 2016, 19, 75–83. [Google Scholar] [CrossRef] [Scilit]
- Santos, A.R.; Comprido, D.; Duarte, C.B. Regulation of local translation at the synapse by BDNF. Prog. Neurobiol. 2010, 92, 505–516. [Google Scholar] [CrossRef] [Scilit]
- Han, K.; Kim, E. Synaptic adhesion molecules and PSD-95. Prog. Neurobiol. 2008, 84, 263–283. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shimizu, K.; Phan, T.; Mansuy, I.M.; Storm, D.R. Proteolytic degradation of SCOP in the hippocampus contributes to activation of MAP kinase and memory. Cell 2007, 128, 1219–1229. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Folloni, D. Ultrasound neuromodulation of the deep brain. Science 2022, 377, 589. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Eckenhoff, R.G.; Maze, M.; Xie, Z.; Culley, D.J.; Goodlin, S.J.; Zuo, Z.; Wei, H.; Whittington, R.A.; Terrando, N.; Orser, B.A.; et al. Perioperative Neurocognitive Disorder: State of the Preclinical Science. Anesthesiology 2020, 132, 55–68. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, T.T.; Lan, T.H.; Yang, F.Y. Low-Intensity Pulsed Ultrasound Attenuates LPS-Induced Neuroinflammation and Memory Impairment by Modulation of TLR4/NF-kappaB Signaling and CREB/BDNF Expression. Cereb. Cortex 2019, 29, 1430–1438. [Google Scholar] [CrossRef] [Scilit]
- Subramaniyan, S.; Terrando, N. Neuroinflammation and Perioperative Neurocognitive Disorders. Anesth. Analg. 2019, 128, 781–788. [Google Scholar] [CrossRef] [Scilit]
- Wang, B.; Li, S.; Cao, X.; Dou, X.; Li, J.; Wang, L.; Wang, M.; Bi, Y. Blood-brain Barrier Disruption Leads to Postoperative Cognitive Dysfunction. Curr. Neurovasc. Res. 2017, 14, 359–367. [Google Scholar] [CrossRef] [Scilit]
- Hshieh, T.T.; Fong, T.G.; Marcantonio, E.R.; Inouye, S.K. Cholinergic deficiency hypothesis in delirium: A synthesis of current evidence. J. Gerontol. A Biol. Sci. Med. Sci. 2008, 63, 764–772. [Google Scholar] [CrossRef] [Scilit]
- Netto, M.B.; de Oliveira Junior, A.N.; Goldim, M.; Mathias, K.; Fileti, M.E.; da Rosa, N.; Laurentino, A.O.; de Farias, B.X.; Costa, A.B.; Rezin, G.T.; et al. Oxidative stress and mitochondrial dysfunction contributes to postoperative cognitive dysfunction in elderly rats. Brain Behav. Immun. 2018, 73, 661–669. [Google Scholar] [CrossRef] [Scilit]
- Li, Y.; Yuan, Y.; Li, Y.; Han, D.; Liu, T.; Yang, N.; Mi, X.; Hong, J.; Liu, K.; Song, Y.; et al. Inhibition of alpha-Synuclein Accumulation Improves Neuronal Apoptosis and Delayed Postoperative Cognitive Recovery in Aged Mice. Oxidative Med. Cell. Longev. 2021, 2021, 5572899. [Google Scholar] [CrossRef] [Scilit]
- Chen, S.M.; Li, M.; Xie, J.; Li, S.; Xiang, S.S.; Liu, H.Y.; Chen, Z.; Zhang, P.; Kuang, X.; Tang, X.Q. Hydrogen sulfide attenuates postoperative cognitive dysfunction through promoting the pathway of Warburg effect-synaptic plasticity in hippocampus. Toxicol. Appl. Pharmacol. 2020, 409, 115286. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, F.; Wang, Q.; Wang, L.; Ren, J.; Song, X.; Tian, Y.; Zheng, C.; Yang, J.; Ming, D. Low-Intensity Focused Ultrasound Stimulation Ameliorates Working Memory Dysfunctions in Vascular Dementia Rats via Improving Neuronal Environment. Front. Aging Neurosci. 2022, 14, 814560. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Leinenga, G.; Götz, J. Scanning ultrasound removes amyloid-β and restores memory in an Alzheimer’s disease mouse model. Sci. Transl. Med. 2015, 7, 278ra233. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Eguchi, K.; Shindo, T.; Ito, K.; Ogata, T.; Kurosawa, R.; Kagaya, Y.; Monma, Y.; Ichijo, S.; Kasukabe, S.; Miyata, S.; et al. Whole-brain low-intensity pulsed ultrasound therapy markedly improves cognitive dysfunctions in mouse models of dementia—Crucial roles of endothelial nitric oxide synthase. Brain Stimul. 2018, 11, 959–973. [Google Scholar] [CrossRef] [Scilit]
- Baudry, M.; Chou, M.M.; Bi, X. Targeting calpain in synaptic plasticity. Expert. Opin. Ther. Targets 2013, 17, 579–592. [Google Scholar] [CrossRef] [Scilit]
- Valtorta, F.; Pennuto, M.; Bonanomi, D.; Benfenati, F. Synaptophysin: Leading actor or walk-on role in synaptic vesicle exocytosis? Bioessays 2004, 26, 445–453. [Google Scholar] [CrossRef] [Scilit]
- Yang, F.Y.; Lu, W.W.; Lin, W.T.; Chang, C.W.; Huang, S.L. Enhancement of Neurotrophic Factors in Astrocyte for Neuroprotective Effects in Brain Disorders Using Low-intensity Pulsed Ultrasound Stimulation. Brain Stimul. 2015, 8, 465–473. [Google Scholar] [CrossRef] [Scilit]







| Gene ID | Protein Name | Forward | Reverse |
|---|---|---|---|
| Tnf | TNF-α | ATGTCTCAGCCTCTTCTCATTC | GCTTGTCACTCGAATTTTGAGA |
| Il1b | IL-1β | CACTACAGGCTCCGAGATGAACAAC | TGTCGTTGCTTGGTTCTCCTTGTAC |
| Il6 | IL-6 | CTCCCAACAGACCTGTCTATAC | CCATTGCACAACTCTTTTCTCA |
| Piezo1 | Piezo1 | GAATGTGATTGGGCAGCGTATGAAC | GAACAGCGTGAGGAACAGACAGTAG |
| Actb | β-actin | TATGCTCTCCCTCACGCCATCC | GTCACGCACGATTTCCCTCTCAG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, Q.; Liu, T.; Chang, H.; Li, Z.; Chen, L.; Mi, X.; Xing, H.; Wang, X.; Hong, J.; Liu, K.; et al. Low-Intensity Pulsed Ultrasound Attenuates Postoperative Neurocognitive Impairment and Salvages Hippocampal Synaptogenesis in Aged Mice. Brain Sci. 2023, 13, 657. https://doi.org/10.3390/brainsci13040657
Wang Q, Liu T, Chang H, Li Z, Chen L, Mi X, Xing H, Wang X, Hong J, Liu K, et al. Low-Intensity Pulsed Ultrasound Attenuates Postoperative Neurocognitive Impairment and Salvages Hippocampal Synaptogenesis in Aged Mice. Brain Sciences. 2023; 13(4):657. https://doi.org/10.3390/brainsci13040657
Chicago/Turabian StyleWang, Qian, Taotao Liu, Huixian Chang, Zhengqian Li, Lei Chen, Xinning Mi, Huayi Xing, Xiaoxiao Wang, Jingshu Hong, Kaixi Liu, and et al. 2023. "Low-Intensity Pulsed Ultrasound Attenuates Postoperative Neurocognitive Impairment and Salvages Hippocampal Synaptogenesis in Aged Mice" Brain Sciences 13, no. 4: 657. https://doi.org/10.3390/brainsci13040657
APA StyleWang, Q., Liu, T., Chang, H., Li, Z., Chen, L., Mi, X., Xing, H., Wang, X., Hong, J., Liu, K., Li, Y., Han, D., Li, Y., Yang, N., Li, X., Li, Y., & Guo, X. (2023). Low-Intensity Pulsed Ultrasound Attenuates Postoperative Neurocognitive Impairment and Salvages Hippocampal Synaptogenesis in Aged Mice. Brain Sciences, 13(4), 657. https://doi.org/10.3390/brainsci13040657

