Metformin Protects Radiation-Induced Early Brain Injury by Reducing Inflammation and DNA Damage
Abstract
1. Introduction
2. Materials and Methods
2.1. Animal
2.2. Establishment of RIBI Mouse Models and Drug Administration
2.3. Cell Culture and In Vitro Exposure Models
2.4. Immunofluorescent and Immunocytochemistry Assays
2.5. Y-Maze Spontaneous Alternation Test
2.6. Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR) Assays
2.7. Cell Counting Kit-8 (CCK-8) Assays
2.8. Comet Assays
2.9. Statistical Analyses
3. Results
3.1. Metformin Improves the Survival Time of Mice Subjected to a Lethal Dose of γ-ray Exposure
3.2. Metformin Attenuates the Loss of Neural Stem Cells in the Hippocampus and Improves the Learning and Memory Abilities in Mice with RIBI
3.3. Metformin Reduces the Inflammatory Response to Whole-Brain Irradiation in Mice
3.4. Metformin Reduces the Inflammatory Response of BV2 Cells after Irradiation
3.5. Metformin Reduced DNA Damage in BV2 Cells after Irradiation
3.6. Metformin Reduced the Activation of cGAS-STING after Irradiation
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Chen, Y.P.; Chan, A.T.C.; Le, Q.T.; Blanchard, P.; Sun, Y.; Ma, J. Nasopharyngeal carcinoma. Lancet 2019, 394, 64–80. [Google Scholar] [CrossRef] [Scilit]
- Cheung, M.C.; Chan, A.S.; Law, S.C.; Chan, J.H.; Tse, V.K. Impact of radionecrosis on cognitive dysfunction in patients after radiotherapy for nasopharyngeal carcinoma. Cancer 2003, 97, 2019–2026. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Greene-Schloesser, D.; Robbins, M.E.; Peiffer, A.M.; Shaw, E.G.; Wheeler, K.T.; Chan, M.D. Radiation-induced brain injury: A review. Front. Oncol. 2012, 2, 73. [Google Scholar] [CrossRef] [Scilit]
- Greene-Schloesser, D.; Moore, E.; Robbins, M.E. Molecular pathways: Radiation-induced cognitive impairment. Clin. Cancer Res. 2013, 19, 2294–2300. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Turnquist, C.; Harris, B.T.; Harris, C.C. Radiation-induced brain injury: Current concepts and therapeutic strategies targeting neuroinflammation. Neuro Oncol. Adv. 2020, 2, vdaa057. [Google Scholar] [CrossRef] [Scilit]
- Tofilon, P.J.; Fike, J.R. The radioresponse of the central nervous system: A dynamic process. Radiat. Res. 2000, 153, 357–370. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Balentova, S.; Adamkov, M. Molecular, Cellular and Functional Effects of Radiation-Induced Brain Injury: A Review. Int. J. Mol. Sci. 2015, 16, 27796–27815. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Suter, M.A.; Tan, N.Y.; Thiam, C.H.; Khatoo, M.; MacAry, P.A.; Angeli, V.; Gasser, S.; Zhang, Y.L. cGAS-STING cytosolic DNA sensing pathway is suppressed by JAK2-STAT3 in tumor cells. Sci. Rep. 2021, 11, 7243. [Google Scholar] [CrossRef] [Scilit]
- Anisimov, V.N.; Berstein, L.M.; Egormin, P.A.; Piskunova, T.S.; Popovich, I.G.; Zabezhinski, M.A.; Tyndyk, M.L.; Yurova, M.V.; Kovalenko, I.G.; Poroshina, T.E.; et al. Metformin slows down aging and extends life span of female SHR mice. Cell Cycle 2008, 7, 2769–2773. [Google Scholar] [CrossRef] [Scilit]
- Wang, J.; Gallagher, D.; DeVito, L.M.; Cancino, G.I.; Tsui, D.; He, L.; Keller, G.M.; Frankland, P.W.; Kaplan, D.R.; Miller, F.D. Metformin activates an atypical PKC-CBP pathway to promote neurogenesis and enhance spatial memory formation. Cell Stem Cell 2012, 11, 23–35. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ayoub, R.; Ruddy, R.M.; Cox, E.; Oyefiade, A.; Derkach, D.; Laughlin, S.; Ades-Aron, B.; Shirzadi, Z.; Fieremans, E.; MacIntosh, B.J.; et al. Assessment of cognitive and neural recovery in survivors of pediatric brain tumors in a pilot clinical trial using metformin. Nat. Med. 2020, 26, 1285–1294. [Google Scholar] [CrossRef] [Scilit]
- Derkach, D.; Kehtari, T.; Renaud, M.; Heidari, M.; Lakshman, N.; Morshead, C.M. Metformin pretreatment rescues olfactory memory associated with subependymal zone neurogenesis in a juvenile model of cranial irradiation. Cell Rep. Med. 2021, 2, 100231. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Storozhuk, Y.; Hopmans, S.N.; Sanli, T.; Barron, C.; Tsiani, E.; Cutz, J.C.; Pond, G.; Wright, J.; Singh, G.; Tsakiridis, T. Metformin inhibits growth and enhances radiation response of non-small cell lung cancer (NSCLC) through ATM and AMPK. Br. J. Cancer 2013, 108, 2021–2032. [Google Scholar] [CrossRef] [Scilit]
- Cheki, M.; Shirazi, A.; Mahmoudzadeh, A.; Bazzaz, J.T.; Hosseinimehr, S.J. The radioprotective effect of metformin against cytotoxicity and genotoxicity induced by ionizing radiation in cultured human blood lymphocytes. Mutat. Res. Genet. Toxicol. Environ. Mutagen. 2016, 809, 24–32. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, T.; Li, D.; He, Y.; Zhang, F.; Qiao, M.; Chen, Y. Prognostic value of metformin for non-small cell lung cancer patients with diabetes. World J. Surg. Oncol. 2018, 16, 60. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, T.; Liang, G.; Yang, L.; Zhang, F. Prognosis of small cell lung cancer patients with diabetes treated with metformin. Clin. Transl. Oncol. 2015, 17, 819–824. [Google Scholar] [CrossRef] [Scilit]
- Kong, F.; Gao, F.; Liu, H.; Chen, L.; Zheng, R.; Yu, J.; Li, X.; Liu, G.; Jia, Y. Metformin use improves the survival of diabetic combined small-cell lung cancer patients. Tumour. Biol. 2015, 36, 8101–8106. [Google Scholar] [CrossRef] [Scilit]
- Deng, W.; Aimone, J.B.; Gage, F.H. New neurons and new memories: How does adult hippocampal neurogenesis affect learning and memory? Nat. Rev. Neurosci. 2010, 11, 339–350. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dong, X.; Luo, M.; Huang, G.; Zhang, J.; Tong, F.; Cheng, Y.; Cai, Q.; Dong, J.; Wu, G.; Cheng, J. Relationship between irradiation-induced neuro-inflammatory environments and impaired cognitive function in the developing brain of mice. Int. J. Radiat. Biol. 2015, 91, 224–239. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jenrow, K.A.; Brown, S.L.; Lapanowski, K.; Naei, H.; Kolozsvary, A.; Kim, J.H. Selective inhibition of microglia-mediated neuroinflammation mitigates radiation-induced cognitive impairment. Radiat. Res. 2013, 179, 549–556. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Santos, C.L.; Pourrut, B.; Ferreira de Oliveira, J.M. The use of comet assay in plant toxicology: Recent advances. Front. Genet. 2015, 6, 216. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, T.; Chen, Z.J. The cGAS-cGAMP-STING pathway connects DNA damage to inflammation, senescence, and cancer. J. Exp. Med. 2018, 215, 1287–1299. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shen, R.; Liu, D.; Wang, X.; Guo, Z.; Sun, H.; Song, Y.; Wang, D. DNA Damage and Activation of cGAS/STING Pathway Induce Tumor Microenvironment Remodeling. Front. Cell Dev. Biol. 2021, 9, 828657. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Deng, L.; Liang, H.; Xu, M.; Yang, X.; Burnette, B.; Arina, A.; Li, X.D.; Mauceri, H.; Beckett, M.; Darga, T.; et al. STING-Dependent Cytosolic DNA Sensing Promotes Radiation-Induced Type I Interferon-Dependent Antitumor Immunity in Immunogenic Tumors. Immunity 2014, 41, 843–852. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liang, H.; Deng, L.; Hou, Y.; Meng, X.; Huang, X.; Rao, E.; Zheng, W.; Mauceri, H.; Mack, M.; Xu, M.; et al. Host STING-dependent MDSC mobilization drives extrinsic radiation resistance. Nat. Commun. 2017, 8, 1736. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chevalier, B.; Pasquier, D.; Lartigau, E.F.; Chargari, C.; Schernberg, A.; Jannin, A.; Mirabel, X.; Vantyghem, M.C.; Escande, A. Metformin: (future) best friend of the radiation oncologist? Radiother. Oncol. 2020, 151, 95–105. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, P.; Zhao, S.; Lu, X.; Shi, Z.; Liu, H.; Zhu, B. Metformin enhances the sensitivity of colorectal cancer cells to cisplatin through ROS-mediated PI3K/Akt signaling pathway. Gene 2020, 745, 144623. [Google Scholar] [CrossRef] [Scilit]
- Chiang, C.F.; Chao, T.T.; Su, Y.F.; Hsu, C.C.; Chien, C.Y.; Chiu, K.C.; Shiah, S.G.; Lee, C.H.; Liu, S.Y.; Shieh, Y.S. Metformin-treated cancer cells modulate macrophage polarization through AMPK-NF-kappaB signaling. Oncotarget 2017, 8, 20706–20718. [Google Scholar] [CrossRef] [Scilit]
- LaMoia, T.E.; Shulman, G.I. Cellular and Molecular Mechanisms of Metformin Action. Endocr. Rev. 2021, 42, 77–96. [Google Scholar] [CrossRef] [Scilit]
- Flory, J.; Lipska, K. Metformin in 2019. JAMA 2019, 321, 1926–1927. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yuen, N.; Szulc-Lerch, K.U.; Li, Y.Q.; Morshead, C.M.; Mabbott, D.J.; Wong, C.S.; Nieman, B.J. Metformin effects on brain development following cranial irradiation in a mouse model. Neuro Oncol. 2021, 23, 1523–1536. [Google Scholar] [CrossRef] [Scilit]
- Tian, L.; Ma, L.; Kaarela, T.; Li, Z. Neuroimmune crosstalk in the central nervous system and its significance for neurological diseases. J. Neuroinflamm. 2012, 9, 155. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, L.; He, D.; Bai, Y. Microglia-Mediated Inflammation and Neurodegenerative Disease. Mol. Neurobiol. 2016, 53, 6709–6715. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Terreros-Roncal, J.; Moreno-Jimenez, E.P.; Flor-Garcia, M.; Rodriguez-Moreno, C.B.; Trinchero, M.F.; Cafini, F.; Rabano, A.; Llorens-Martin, M. Impact of neurodegenerative diseases on human adult hippocampal neurogenesis. Science 2021, 374, 1106–1113. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- York, E.M.; Zhang, J.; Choi, H.B.; MacVicar, B.A. Neuroinflammatory inhibition of synaptic long-term potentiation requires immunometabolic reprogramming of microglia. Glia 2021, 69, 567–578. [Google Scholar] [CrossRef] [Scilit]
- Hammond, T.R.; Dufort, C.; Dissing-Olesen, L.; Giera, S.; Young, A.; Wysoker, A.; Walker, A.J.; Gergits, F.; Segel, M.; Nemesh, J.; et al. Single-Cell RNA Sequencing of Microglia throughout the Mouse Lifespan and in the Injured Brain Reveals Complex Cell-State Changes. Immunity 2019, 50, 253–271.e6. [Google Scholar] [CrossRef] [Scilit]
- Olah, M.; Menon, V.; Habib, N.; Taga, M.F.; Ma, Y.; Yung, C.J.; Cimpean, M.; Khairallah, A.; Coronas-Samano, G.; Sankowski, R.; et al. Single cell RNA sequencing of human microglia uncovers a subset associated with Alzheimer’s disease. Nat. Commun. 2020, 11, 6129. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, C.; Ren, J.; Zhang, M.; Wang, H.; Yi, F.; Wu, J.; Tang, Y. The heterogeneity of microglial activation and its epigenetic and non-coding RNA regulations in the immunopathogenesis of neurodegenerative diseases. Cell. Mol. Life Sci. 2022, 79, 511. [Google Scholar] [CrossRef] [Scilit] [PubMed]






| Genes | Primers | Primer Sequences (5′→3′) |
|---|---|---|
| IL-1β | Forward | TGTAATGAAAGACGGCACACC |
| Reverse | TCTTCTTTGGGTATTGCTTGG | |
| IL-6 | Forward | TCCAGTTGCCTTCTTGGGAC′ |
| Reverse | GTGTAATTAAGCCTCCGACTTG | |
| TNF-α | Forward | CAGGCGGTGCCTATGTCTC |
| Reverse | CGATCACqCCCGAAGTTCAGTAG | |
| IκB | Forward | CAGCTCCAAGAAAGGACGAAC |
| Reverse | GGCAGTGTAACTCTTCTGCAT | |
| IRF-3 | Forward | GAGAGCCGAACGAGGTTCAG |
| Reverse | CTTCCAGGTTGACACGTCCG | |
| Actin | Forward | ATCGTACTCCTGCTTGCTGAT |
| Reverse | AGATTACTGCTCTGGCTCCTAG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xiang, J.; Lu, Y.; Quan, C.; Gao, Y.; Zhou, G. Metformin Protects Radiation-Induced Early Brain Injury by Reducing Inflammation and DNA Damage. Brain Sci. 2023, 13, 645. https://doi.org/10.3390/brainsci13040645
Xiang J, Lu Y, Quan C, Gao Y, Zhou G. Metformin Protects Radiation-Induced Early Brain Injury by Reducing Inflammation and DNA Damage. Brain Sciences. 2023; 13(4):645. https://doi.org/10.3390/brainsci13040645
Chicago/Turabian StyleXiang, Jiabao, Yiming Lu, Cheng Quan, Yan Gao, and Gangqiao Zhou. 2023. "Metformin Protects Radiation-Induced Early Brain Injury by Reducing Inflammation and DNA Damage" Brain Sciences 13, no. 4: 645. https://doi.org/10.3390/brainsci13040645
APA StyleXiang, J., Lu, Y., Quan, C., Gao, Y., & Zhou, G. (2023). Metformin Protects Radiation-Induced Early Brain Injury by Reducing Inflammation and DNA Damage. Brain Sciences, 13(4), 645. https://doi.org/10.3390/brainsci13040645

