Serotonin Transporter mRNA Expression Is Reduced in the Peripheral Blood Mononuclear Cells of Subjects with Major Depression but Normal in Fibromyalgia
Abstract
1. Introduction
2. Materials and Methods
2.1. Participants
2.2. Clinical Assessments
2.3. PBMC Isolation and qPCR
2.4. Statistical Analyses
3. Results
3.1. Clinical Findings
3.1.1. Sociodemographic Differences
3.1.2. Pre- and Post-Treatment Effects
3.2. Differences in SERT mRNA Expression between Groups before Treatment
3.3. Changes in the SERT mRNA Expression Level after Treatment
3.4. Differences in the DAT mRNA Expression Level
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Marques, A.P.; Santo, A.D.S.D.E.; Berssaneti, A.A.; Matsutani, L.A.; Yuan, S.L.K. Prevalence of fibromyalgia: Literature review update. Rev. Bras. Reumatol. Engl. Ed. 2017, 57, 356–363. [Google Scholar] [CrossRef] [Scilit]
- Galvez-Sánchez, C.M.; Carmen, M.; Del Paso, G.A.R. Diagnostic Criteria for Fibromyalgia: Critical Review and Future Perspectives. J. Clin. Med. 2020, 9, 1219. [Google Scholar] [CrossRef] [Scilit]
- World Health Organization. Depressive Disorder (Depression). World Health Organization. Available online: https://www.who.int/news-room/fact-sheets/detail/depression (accessed on 31 March 2023).
- Buskila, D.; Cohen, H. Fibromyalgia and psychiatric disorders. Acta BioMed. Atenei Parm. 2007, 78, 88–95. [Google Scholar]
- Løge-Hagen, J.; Sæle, A.; Juhl, C.; Bech, P.; Stenager, E.; Mellentin, A. Prevalence of depressive disorder among patients with fibromyalgia: Systematic review and meta-analysis. J. Affect. Disord. 2019, 245, 1098–1105. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Albert, P.R.; Benkelfat, C. The neurobiology of depression—Revisiting the serotonin hypothesis. II. Genetic, epigenetic and clinical studies. Philos. Trans. R. Soc. B Biol. Sci. 2013, 368, 535. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Malhi, G.S.; Bell, E.; Bassett, D.; Boyce, P.; Bryant, R.; Hazell, P.; Hopwood, M.; Lyndon, B.; Mulder, R.; Porter, R.; et al. The 2020 Royal Australian and New Zealand College of Psychiatrists clinical practice guidelines for mood disorders. Aust. N. Z. J. Psychiatry 2021, 55, 7–117. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Meyer, J.H. Imaging the serotonin transporter during major depressive disorder and antidepressant treatment. J. Psychiatry Neurosci. 2007, 32, 86–102. [Google Scholar]
- Houwing, D.J.; Buwalda, B.; van der Zee, E.A.; de Boer, S.F.; Olivier, J.D.A. The Serotonin Transporter and Early Life Stress: Translational Perspectives. Front. Cell Neurosci. 2017, 11, 117. [Google Scholar] [CrossRef] [Scilit]
- Nikolaus, S.; Müller, H.-W.; Hautzel, H. Different patterns of 5-HT receptor and transporter dysfunction in neuropsychiatric disorders—A comparative analysis of in vivo imaging findings. Rev. Neurosci. 2016, 27, 27–59. [Google Scholar] [CrossRef] [Scilit]
- Kambeitz, J.P.; Howes, O.D. The serotonin transporter in depression: Meta-analysis of in vivo and post mortem findings and implications for understanding and treating depression. J. Affect. Disord. 2015, 186, 358–366. [Google Scholar] [CrossRef] [Scilit]
- Gryglewski, G.; Lanzenberger, R.; Kranz, G.S.; Cumming, P. Meta-analysis of molecular imaging of serotonin transporters in major depression. J. Cereb. Blood Flow Metab. 2014, 34, 1096–1103. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Moncrieff, J.; Cooper, R.E.; Stockmann, T.; Amendola, S.; Hengartner, M.P.; Horowitz, M.A. The serotonin theory of depression: A systematic umbrella review of the evidence. Mol. Psychiatry, 2022; Online ahead of print. [CrossRef] [Scilit]
- Border, R.; Johnson, E.C.; Evans, L.M.; Smolen, A.; Berley, N.; Sullivan, P.F.; Keller, M.C. No Support for Historical Candidate Gene or Candidate Gene-by-Interaction Hypotheses for Major Depression Across Multiple Large Samples. Am. J. Psychiatry 2019, 176, 376–387. [Google Scholar] [CrossRef] [Scilit]
- Bleys, D.; Luyten, P.; Soenens, B.; Claes, S. Gene-environment interactions between stress and 5-HTTLPR in depression: A meta-analytic update. J. Affect. Disord. 2018, 226, 339–345. [Google Scholar] [CrossRef] [Scilit]
- Gershon, M.D.; Tack, J. The serotonin signaling system: From basic understanding to drug development for functional GI disorders. Gastroenterology 2007, 132, 397–414. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pacheco, R.; Prado, C.E.; Barrientos, M.J.; Bernales, S. Role of dopamine in the physiology of T-cells and dendritic cells. J. Neuroimmunol. 2009, 216, 8–19. [Google Scholar] [CrossRef] [Scilit]
- Abdouh, M.; Albert, P.R.; Drobetsky, E.; Filep, J.G.; Kouassi, E. 5-HT1A-mediated promotion of mitogen-activated T and B cell survival and proliferation is associated with increased translocation of NF-κB to the nucleus. Brain Behav. Immun. 2004, 18, 24–34. [Google Scholar] [CrossRef] [Scilit]
- Kushnir-Sukhov, N.M.; Brown, J.M.; Wu, Y.; Kirshenbaum, A.; Metcalfe, D.D. Human mast cells are capable of serotonin synthesis and release. J. Allergy Clin. Immunol. 2007, 119, 498–499. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- León-Ponte, M.; Ahern, G.P.; O’Connell, P.J. Serotonin provides an accessory signal to enhance T-cell activation by signaling through the 5-HT7 receptor. Blood 2007, 109, 3139–3146. [Google Scholar] [CrossRef] [Scilit]
- Nakamura, K.; Sato, T.; Ohashi, A.; Tsurui, H.; Hasegawa, H. Role of a serotonin precursor in development of gut microvilli. Am. J. Pathol. 2008, 172, 333–344. [Google Scholar] [CrossRef] [Scilit]
- O’Connell, P.J.; Wang, X.; Leon-Ponte, M.; Griffiths, C.; Pingle, S.C.; Ahern, G.P. A novel form of immune signaling revealed by transmission of the inflammatory mediator serotonin between dendritic cells and T cells. Blood 2006, 107, 1010–1017. [Google Scholar] [CrossRef] [Scilit]
- Lima, L.; Mata, S.; Urbina, M. Allelic isoforms and decrease in serotonin transporter mRNA in lymphocytes of patients with major depression. Neuroimmunomodulation 2005, 12, 299–306. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fazzino, F.; Urbina, M.; Cedeño, N.; Lima, L. Fluoxetine treatment to rats modifies serotonin transporter and cAMP in lymphocytes, CD4+ and CD8+ subpopulations and interleukins 2 and 4. Int. Immunopharmacol. 2009, 9, 463–467. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Peña, S.; Baccichet, E.; Urbina, M.; Carreira, I.; Lima, L. Effect of mirtazapine treatment on serotonin transporter in blood peripheral lymphocytes of major depression patients. Int. Immunopharmacol. 2005, 5, 1069–1076. [Google Scholar] [CrossRef] [Scilit]
- Lima, L.; Urbina, M. Serotonin transporter modulation in blood lymphocytes from patients with major depression. Cell. Mol. Neurobiol. 2002, 22, 797–804. [Google Scholar] [CrossRef] [Scilit]
- Urbina, M.; Pineda, S.; Piñango, L.; Carreira, I.; Lima, L. [3H]Paroxetine binding to human peripheral lymphocyte membranes of patients with major depression before and after treatment with fluoxetine. Int. J. Immunopharmacol. 1999, 21, 631–646. [Google Scholar] [CrossRef] [Scilit]
- Tsao, C.-W.; Lin, Y.-S.; Chen, C.-C.; Bai, C.-H.; Wu, S.-R. Cytokines and serotonin transporter in patients with major depression. Prog. Neuro-Psychopharmacol. Biol. Psychiatry 2006, 30, 899–905. [Google Scholar] [CrossRef] [Scilit]
- Gackiã¨re, F.; Vinay, L. Serotonergic modulation of post-synaptic inhibition and locomotor alternating pattern in the spinal cord. Front. Neural Circuits 2014, 8, 102. [Google Scholar] [CrossRef] [Scilit]
- Potvin, S.; Morin, M.; Cloutier, C.; Gendron, A.; Bissonnette, A.; Marchand, S. Add-on treatment of quetiapine for fibromyalgia: A pilot, randomized, double-blind, placebo-controlled 12-week trial. J. Clin. Psychopharmacol. 2012, 32, 684–687. [Google Scholar] [CrossRef] [Scilit]
- Tanwar, S.; Mattoo, B.; Kumar, U.; Dada, R.; Bhatia, R. Does human serotonin-1A receptor polymorphism (rs6295) code for pain and associated symptoms in fibromyalgia syndrome? Reumatismo 2021, 73, 24–31. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Heddini, U.; Bohm-Starke, N.; Grönbladh, A.; Nyberg, F.; Nilsson, K.W.; Johannesson, U. Serotonin receptor gene (5HT-2A) polymorphism is associated with provoked vestibulodynia and comorbid symptoms of pain. J. Sex. Med. 2014, 11, 3064–3071. [Google Scholar] [CrossRef] [Scilit]
- Al-Nimer, M.S.M.; Mohammad, T.A.M.; Alsakeni, R. Serum levels of serotonin as a biomarker of newly diagnosed fibromyalgia in women: Its relation to the platelet indices. J. Res. Med. Sci. 2018, 23, 71. [Google Scholar] [CrossRef] [Scilit]
- Ellerbrock, I.; Sandström, A.; Tour, J.; Fanton, S.; Kadetoff, D.; Schalling, M.; Jensen, K.B.; Sitnikov, R.; Kosek, E. Serotonergic gene-to-gene interaction is associated with mood and GABA concentrations but not with pain-related cerebral processing in fibromyalgia subjects and healthy controls. Mol. Brain 2021, 14, 81. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tour, J.; Sandström, A.; Kadetoff, D.; Schalling, M.; Kosek, E. The OPRM1 gene and interactions with the 5-HT1a gene regulate conditioned pain modulation in fibromyalgia patients and healthy controls. PLoS ONE 2022, 17, e0277427. [Google Scholar] [CrossRef] [Scilit]
- Ferreira, G.E.; Abdel-Shaheed, C.; Underwood, M.; Finnerup, N.B.; Day, R.O.; McLachlan, A.; Eldabe, S.; Zadro, J.R.; Maher, C.G. Efficacy, safety, and tolerability of antidepressants for pain in adults: Overview of systematic reviews. BMJ (Clin. Res. Ed.) 2023, 380, e072415. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pae, C.-U.; Sohi, M.S.; Seo, H.-J.; Serretti, A.; Patkar, A.A.; Steffens, D.C.; Masand, P.S. Quetiapine XR: Current status for the treatment of major depressive disorder. Prog. Neuro-Psychopharmacol. Biol. Psychiatry 2010, 34, 1165–1173. [Google Scholar] [CrossRef] [Scilit]
- McIntyre, A.; Paisley, D.; Kouassi, E.; Gendron, A. Quetiapine Fumarate extended-release for the treatment of major depression with comorbid fibromyalgia syndrome: A double-blind, randomized, placebo-controlled study. Arthritis Rheumatol. 2014, 66, 451–461. [Google Scholar] [CrossRef] [Scilit]
- Horacek, J.; Bubenikova-Valesova, V.; Kopecek, M.; Palenicek, T.; Dockery, C.; Mohr, P.; Höschl, C. Mechanism of action of atypical antipsychotic drugs and the neurobiology of schizophrenia. CNS Drugs 2006, 20, 389–409. [Google Scholar] [CrossRef] [Scilit]
- Prieto, E.; Micó, J.A.; Meana, J.J.; Majadas, S. Neurobiological bases of quetiapine antidepresant effect in the bipolar disorder. Actas Espanolas Psiquiatr. 2010, 38, 22–32. [Google Scholar]
- Wood, P.B.; Patterson, J.C., II; Sunderland, J.J.; Tainter, K.H.; Glabus, M.F.; Lilien, D.L. Reduced presynaptic dopamine activity in fibromyalgia syndrome demonstrated with positron emission tomography: A pilot study. J. Pain 2007, 8, 51–58. [Google Scholar] [CrossRef] [Scilit]
- Taniguchi, W.; Nakatsuka, T.; Miyazaki, N.; Yamada, H.; Takeda, D.; Fujita, T.; Kumamoto, E.; Yoshida, M. In vivo patch-clamp analysis of dopaminergic antinociceptive actions on substantia gelatinosa neurons in the spinal cord. Pain 2011, 152, 95–105. [Google Scholar] [CrossRef] [Scilit]
- Carrozzino, D.; Patierno, C.; Fava, G.A.; Guidi, J. The Hamilton Rating Scales for Depression: A Critical Review of Clinimetric Properties of Different Versions. Psychother. Psychosom. 2020, 89, 133–150. [Google Scholar] [CrossRef] [Scilit]
- Obeid, S.; Azzi, V.; Hallit, S. Validation and psychometric properties of the Arabic version of Hamilton Depression Rating Scale 7 items (HAMD-7) among non-clinical and clinical samples of Lebanese adults. PLoS ONE 2023, 18, e0285665. [Google Scholar] [CrossRef] [Scilit]
- Lee, M. Clinimetrics: The Revised Fibromyalgia Impact Questionnaire. J. Physiother. 2021, 67, 220–221. [Google Scholar] [CrossRef] [Scilit]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- R Core Team. R: A Language and Environment for Statistical Computing; R Foundation for Statistical Computing: Vienna, Austria, 2022. [Google Scholar]
- Bates, D.; Mächler, M.; Bolker, B.; Walker, S. Fitting Linear Mixed-Effects Models Using lme4. J. Stat. Soft. 2015, 67, 1–48. Available online: https://www.jstatsoft.org/index.php/jss/article/view/v067i01 (accessed on 13 September 2023). [CrossRef] [Scilit]
- Fazzino, F.; Montes, C.; Urbina, M.; Carreira, I.; Lima, L. Serotonin transporter is differentially localized in subpopulations of lymphocytes of major depression patients. Effect of fluoxetine on proliferation. J. Neuroimmunol. 2008, 196, 173–180. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Arreola, R.; Becerril-Villanueva, E.; Cruz-Fuentes, C.; Velasco-Velázquez, M.A.; Garcés-Alvarez, M.E.; Hurtado-Alvarado, G.; Quintero-Fabian, S.; Pavón, L. Immunomodulatory effects mediated by serotonin. J. Immunol. Res. 2015, 2015, 354957. [Google Scholar] [CrossRef] [Scilit]
- Tarazi, F.I.; Zhang, K.; Baldessarini, R.J. Olanzapine, quetiapine, and risperidone: Long-term effects on monoamine transporters in rat forebrain. Neurosci. Lett. 2000, 287, 81–84. [Google Scholar] [CrossRef] [Scilit]
- Borchers, A.T.; Gershwin, M.E. Fibromyalgia: A Critical and Comprehensive Review. Clin. Rev. Allergy Immunol. 2015, 49, 100–151. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Paul-Savoie, M.; Potvin, S.; Daigle, K.B.; Normand, E.M.; Corbin, J.-F.; Gagnon, R.; Marchand, S. A deficit in peripheral serotonin levels in major depressive disorder but not in chronic widespread pain. Clin. J. Pain 2011, 27, 529–534. [Google Scholar] [CrossRef] [Scilit]
- Potvin, S.; Larouche, A.; Normand, E.; de Souza, J.B.; Gaumond, I.; Marchand, S.; Grignon, S. No relationship between the ins del polymorphism of the serotonin transporter promoter and pain perception in fibromyalgia patients and healthy controls. Eur. J. Pain 2010, 14, 742–746. [Google Scholar] [CrossRef] [Scilit]
- Hao, S.; Shi, W.; Liu, W.; Chen, Q.-Y.; Zhuo, M. Multiple modulatory roles of serotonin in chronic pain and injury-related anxiety. Front. Synaptic Neurosci. 2023, 15, 1122381. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, Q.Q.; Yao, X.X.; Gao, S.H.; Li, R.; Li, B.J.; Yang, W.; Cui, R.J. Role of 5-HT receptors in neuropathic pain: Potential therapeutic implications. Pharmacol. Res. 2020, 159, 104949. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, S.; Leri, F.; Rizvi, S.J. Anhedonia as a central factor in depression: Neural mechanisms revealed from preclinical to clinical evidence. Prog. Neuro-Psychopharmacol. Biol. Psychiatry 2021, 110, 110289. [Google Scholar] [CrossRef] [Scilit]
- Custodio, R.J.P.; Sayson, L.V.; Botanas, C.J.; Abiero, A.; Kim, M.; Lee, H.J.; Ryu, H.W.; Lee, Y.S.; Kim, H.J.; Cheong, J.H. Two newly-emerging substituted phenethylamines MAL and BOD induce differential psychopharmacological effects in rodents. J. Psychopharmacol. 2020, 34, 1056–1067. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, F.; Peng, W.; Sweeney, J.A.; Jia, Z.; Gong, Q. Brain structure alterations in depression: Psychoradiological evidence. CNS Neurosci. Ther. 2018, 24, 994–1003. [Google Scholar] [CrossRef] [Scilit]
- Zhang, X.; Han, Y.; Liu, X.; Chen, J.; Yuan, Z.; Wang, Y. Assessment of genetic variants in D2 dopamine receptor (DRD2) gene as risk factors for post-traumatic stress disorder (PTSD) and major depressive disorder (MDD): A systematic review and meta-analysis. J. Affect. Disord. 2023, 328, 312–323. [Google Scholar] [CrossRef] [Scilit]
- Wray, N.R.; Ripke, S.; Mattheisen, M.; Trzaskowski, M.; Byrne, E.M.; Abdellaoui, A.; Adams, M.J.; Agerbo, E.; Air, T.M.; Andlauer, T.M.F.; et al. Genome-wide association analyses identify 44 risk variants and refine the genetic architecture of major depression. Nat. Genet. 2018, 50, 668–681. [Google Scholar] [CrossRef] [Scilit]
- Savitz, J.B.; Drevets, W.C. Neuroreceptor imaging in depression. Neurobiol. Dis. 2013, 52, 49–65. [Google Scholar] [CrossRef] [Scilit]
- Nasr, S.; Wendt, B.; Popli, A.; Crayton, J. Comparing outcomes of adjunctive treatment in depression: Aripiprazole versus Bupropion. J. Affect. Disord. 2014, 162, 50–54. [Google Scholar] [CrossRef] [Scilit]
- Serafini, R.A.; Pryce, K.D.; Zachariou, V. The Mesolimbic Dopamine System in Chronic Pain and Associated Affective Comorbidities. Biol. Psychiatry 2020, 87, 64–73. [Google Scholar] [CrossRef] [Scilit]
- Albrecht, D.S.; Mackie, P.J.; Kareken, D.A.; Hutchins, G.D.; Chumin, E.J.; Christian, B.T.; Yoder, K.K. Differential dopamine function in fibromyalgia. Brain Imaging Behav. 2016, 10, 829–839. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Banerjee, S.; Poddar, M.K. Platelet monoamine oxidase-A activity and aging: Effect of carnosine. J. Physiol. Sci. 2013, 63, 279–285. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Madsen, K.; Haahr, M.T.; Marner, L.; Keller, S.H.; Baaré, W.F.; Svarer, C.; Hasselbalch, S.G.; Knudsen, G.M. Age and sex effects on 5-HT4 receptors in the human brain: A [11C]SB207145 PET study. J. Cereb. Blood Flow Metab. 2011, 31, 1475–1481. [Google Scholar] [CrossRef] [Scilit] [PubMed]



| Species | Sense | Antisense | Amplicon |
|---|---|---|---|
| SERT (NM_001045.6) | GTGGCCAAAGACGCAGGTC (1494–1512) | CTCATCCAGCACAGCCGTGATC (1664–1643) | 171 bp |
| DAT (NM_001044.5) | CTGCGAGGCGTCTGTTTGGATTG (1053–1075) | GTGGTGACAATCGCGTCCCTGTAG (1187–1164) | 135 bp |
| β2-microglobulin (NM_004048.4) | CACGTCATCCAGCAGAGAATGG (122–143) | GATGCTGCTTACATGTCTCGATCC (398–375) | 277 bp |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Villanueva-Charbonneau, G.; Potvin, S.; Marchand, S.; McIntyre, A.; McIntosh, D.; Bissonnette, A.; Gendron, A.; Giguère, C.-É.; Koué, M.-È.; Kouassi, É. Serotonin Transporter mRNA Expression Is Reduced in the Peripheral Blood Mononuclear Cells of Subjects with Major Depression but Normal in Fibromyalgia. Brain Sci. 2023, 13, 1485. https://doi.org/10.3390/brainsci13101485
Villanueva-Charbonneau G, Potvin S, Marchand S, McIntyre A, McIntosh D, Bissonnette A, Gendron A, Giguère C-É, Koué M-È, Kouassi É. Serotonin Transporter mRNA Expression Is Reduced in the Peripheral Blood Mononuclear Cells of Subjects with Major Depression but Normal in Fibromyalgia. Brain Sciences. 2023; 13(10):1485. https://doi.org/10.3390/brainsci13101485
Chicago/Turabian StyleVillanueva-Charbonneau, Gaël, Stéphane Potvin, Serge Marchand, Alexander McIntyre, Diane McIntosh, Alain Bissonnette, Alain Gendron, Charles-Édouard Giguère, Marie-Ève Koué, and Édouard Kouassi. 2023. "Serotonin Transporter mRNA Expression Is Reduced in the Peripheral Blood Mononuclear Cells of Subjects with Major Depression but Normal in Fibromyalgia" Brain Sciences 13, no. 10: 1485. https://doi.org/10.3390/brainsci13101485
APA StyleVillanueva-Charbonneau, G., Potvin, S., Marchand, S., McIntyre, A., McIntosh, D., Bissonnette, A., Gendron, A., Giguère, C.-É., Koué, M.-È., & Kouassi, É. (2023). Serotonin Transporter mRNA Expression Is Reduced in the Peripheral Blood Mononuclear Cells of Subjects with Major Depression but Normal in Fibromyalgia. Brain Sciences, 13(10), 1485. https://doi.org/10.3390/brainsci13101485

