Shen Qi Wan Ameliorates Learning and Memory Impairment Induced by STZ in AD Rats through PI3K/AKT Pathway
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animals
2.2. Drugs and Reagents
2.3. Streptozotocin (STZ)-Induced Rat Model of AD and Treatment
2.4. Morris Water Maze Test
2.5. Hematoxylin and Eosin (H&E) and Nissl Staining
2.6. Immunohistochemistry Analysis
2.7. RNA-Sequencing
2.8. qRT-PCR
2.9. Western Blot Analysis
2.10. Statistical Analysis
3. Results
3.1. SQW Improves Learning and Memory Impairment in STZ-Induced AD Rats
3.2. SQW Attenuates STZ-Induced Pathological Damage in the Hippocampus
3.3. SQW Improves NeuN Neuron Loss and Tau Hyperphosphorylation in the Hippocampal CA3 Region
3.4. SQW Improves the Level of Apoptosis in STZ-Induced AD Rats
3.5. SQW Regulates the Differential Expression of Hippocampal mRNA in STZ-Induced Rats
3.6. Transcriptomic qRT-PCR Validation Results
3.7. SQW Regulates the Expression Levels of PI3K/AKT Signaling Pathway-Related Proteins in STZ-Induced Rats
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
AD | Alzheimer disease |
SQW | Shen Qi wan |
Aβ | Amyloid-beta |
Tau | microtubule-associated protein |
T2DM | type 2 diabetes mellitus |
IR | insulin resistance |
PI3K/AKT | phosphatidylinositol 3-kinase/protein kinase B |
PDK | PI3K-dependent kinase |
APP | amyloid precursor protein |
TCM | Traditional Chinese Medicine |
CIG | Cornus iridoid glycosides |
STZ | Streptozotocin |
SD rat | Sprague-Dawley rat |
ICV | intracerebroventricular |
MWM | Morris water maze test |
HE | Hematoxylin-eosin staining |
mRNA | Messenger ribonucleic acid |
qRT-PCR | quantitative Real-time PCR |
WB | Western Blot |
De mRNAs | Differentially expressed mRNAs |
GO | Gene Ontology |
KEGG | Kyoto Encyclopedia of Genes and Genomes |
References
- Ju, Y.; Tam, K.Y. Pathological mechanisms and therapeutic strategies for Alzheimer’s disease. Neural Regen. Res. 2022, 17, 543–549. [Google Scholar] [PubMed]
- Ashrafian, H.; Zadeh, E.H.; Khan, R.H. Review on Alzheimer’s disease: Inhibition of amyloid beta and tau tangle formation. Int. J. Biol. Macromol. 2021, 167, 382–394. [Google Scholar] [CrossRef] [PubMed]
- Calsolaro, V.; Edison, P. Neuroinflammation in Alzheimer’s disease: Current evidence and future directions. Alzheimer’s Dement. 2016, 12, 719–732. [Google Scholar] [CrossRef] [PubMed]
- Marcatti, M.; Fracassi, A.; Montalbano, M.; Natarajan, C.; Krishnan, B.; Kayed, R.; Taglialatela, G. Abeta/tau oligomer interplay at human synapses supports shifting therapeutic targets for Alzheimer’s disease. Cell Mol. Life Sci. 2022, 79, 222. [Google Scholar] [CrossRef]
- Alzheimer’s Association. 2016 Alzheimer’s disease facts and figures. Alzheimer’s Dement. 2016, 12, 459–509. [Google Scholar] [CrossRef]
- Biessels, G.J.; Staekenborg, S.; Brunner, E.; Brayne, C.; Scheltens, P. Risk of dementia in diabetes mellitus: A systematic review. Lancet Neurol. 2006, 5, 64–74. [Google Scholar] [CrossRef]
- Leszek, J.; Trypka, E.; Tarasov, V.V.; Ashraf, G.M.; Aliev, G. Type 3 Diabetes Mellitus: A Novel Implication of Alzheimers Disease. Curr. Top. Med. Chem. 2017, 17, 1331–1335. [Google Scholar] [CrossRef]
- de la Monte, S.M. Contributions of brain insulin resistance and deficiency in amyloid-related neurodegeneration in Alzheimer’s disease. Drugs 2012, 72, 49–66. [Google Scholar] [CrossRef]
- Fusco, S.; Spinelli, M.; Cocco, S.; Ripoli, C.; Mastrodonato, A.; Natale, F.; Rinaudo, M.; Livrizzi, G.; Grassi, C. Maternal insulin resistance multigenerationally impairs synaptic plasticity and memory via gametic mechanisms. Nat. Commun. 2019, 10, 4799. [Google Scholar] [CrossRef] [Green Version]
- Matsuda, S.; Ikeda, Y.; Murakami, M.; Nakagawa, Y.; Tsuji, A.; Kitagishi, Y. Roles of PI3K/AKT/GSK3 Pathway Involved in Psychiatric Illnesses. Diseases 2019, 7, 22. [Google Scholar] [CrossRef] [Green Version]
- Cui, W.; Wang, S.; Wang, Z.; Wang, Z.; Sun, C.; Zhang, Y. Inhibition of PTEN Attenuates Endoplasmic Reticulum Stress and Apoptosis via Activation of PI3K/AKT Pathway in Alzheimer’s Disease. Neurochem. Res. 2017, 42, 3052–3060. [Google Scholar] [CrossRef] [PubMed]
- Fruman, D.A.; Chiu, H.; Hopkins, B.D.; Bagrodia, S.; Cantley, L.C.; Abraham, R.T. The PI3K Pathway in Human Disease. Cell 2017, 170, 605–635. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Huang, X.; Liu, G.; Guo, J.; Su, Z.Q. The PI3K/AKT pathway in obesity and type 2 diabetes. Int. J. Biol. Sci. 2018, 14, 1483–1496. [Google Scholar] [CrossRef] [Green Version]
- Datta, S.R.; Dudek, H.; Tao, X.; Masters, S.; Fu, H.; Gotoh, Y.; Greenberg, M.E. Akt phosphorylation of BAD couples survival signals to the cell-intrinsic death machinery. Cell 1997, 91, 231–241. [Google Scholar] [CrossRef] [Green Version]
- Lin, J.; Song, T.; Li, C.; Mao, W. GSK-3beta in DNA repair, apoptosis, and resistance of chemotherapy, radiotherapy of cancer. Biochim. Biophys. Acta Mol. Cell Res. 2020, 1867, 118659. [Google Scholar] [CrossRef]
- Lauretti, E.; Dincer, O.; Pratico, D. Glycogen synthase kinase-3 signaling in Alzheimer’s disease. Biochim. Biophys. Acta Mol. Cell Res. 2020, 1867, 118664. [Google Scholar] [CrossRef] [PubMed]
- Zhou, M.; Chen, S.; Peng, P.; Gu, Z.; Yu, J.; Zhao, G.; Deng, Y. Dulaglutide ameliorates STZ induced AD-like impairment of learning and memory ability by modulating hyperphosphorylation of tau and NFs through GSK3beta. Biochem. Biophys. Res. Commun. 2019, 511, 154–160. [Google Scholar] [CrossRef]
- Xiao, H.; Li, H.; Song, H.; Kong, L.; Yan, X.; Li, Y.; Deng, Y.; Tai, H.; Wu, Y.; Ni, Y.; et al. Shenzao jiannao oral liquid, an herbal formula, ameliorates cognitive impairments by rescuing neuronal death and triggering endogenous neurogenesis in AD-like mice induced by a combination of Abeta42 and scopolamine. J. Ethnopharmacol. 2020, 259, 112957. [Google Scholar] [CrossRef]
- Ren, Y.B.; Huang, J.H.; Cai, W.J.; Shen, Z.Y. Shen-Jing as a Chinese Medicine Concept Might Be a Counterpart of Stem Cells in Regenerative Medicine. Chin. J. Integr. Med. 2019, 25, 64–70. [Google Scholar] [CrossRef]
- Zhang, S.; Wei, Y.; Li, H. Central Nervous System Regeneration of Patients with Alzheimer’s Disease: Based on the Kidney-brain Related Theory. J. Tradit. Chin. Med. 2018, 59, 120–123. [Google Scholar]
- Su, Y.; Wang, Q.; Wang, C.; Chan, K.; Sun, Y.; Kuang, H. The treatment of Alzheimer’s disease using Chinese medicinal plants: From disease models to potential clinical applications. J. Ethnopharmacol. 2014, 152, 403–423. [Google Scholar] [CrossRef] [PubMed]
- Miao, Y.C.; Tian, J.Z.; Shi, J.; Mao, M. Effects of Chinese medicine for tonifying the kidney and resolving phlegm and blood stasis in treating patients with amnestic mild cognitive impairment: A randomized, double-blind and parallel-controlled trial. Zhong Xi Yi Jie He Xue Bao 2012, 10, 390–397. [Google Scholar] [CrossRef] [PubMed]
- Xiong, X.; Wang, P.; Li, X.; Zhang, Y. Shenqi pill, a traditional Chinese herbal formula, for the treatment of hypertension: A systematic review. Complement. Ther. Med. 2015, 23, 484–493. [Google Scholar] [CrossRef]
- Zhang, J.Y.; Hong, C.L.; Chen, H.S.; Zhou, X.J.; Zhang, Y.J.; Efferth, T.; Yang, Y.X.; Li, C.Y. Target Identification of Active Constituents of Shen Qi Wan to Treat Kidney Yang Deficiency Using Computational Target Fishing and Network Pharmacology. Front. Pharmacol. 2019, 1, 650. [Google Scholar] [CrossRef] [PubMed]
- Nan, Y.; Zhou, X.; Liu, Q.; Zhang, A.; Guan, Y.; Lin, S.; Kong, L.; Han, Y.; Wang, X. Serum metabolomics strategy for understanding pharmacological effects of ShenQi pill acting on kidney yang deficiency syndrome. J. Chromatogr. B Analyt. Technol. Biomed. Life Sci. 2016, 1026, 217–226. [Google Scholar] [CrossRef] [PubMed]
- Wu, Z. Effect of Shenqi Pill on antioxidant capacity and spermatogenic cell apoptosis of testis in aging rats. Chin. J. Gerontol. 2014, 34, 994–995. [Google Scholar]
- Zhang, Y. Jin Gui Shenqi Pill and Compound Danshen Tablet in the treatment of senile dementia clinical observation. J. Pract. Tradit. Chin. Med. 2019, 35, 660. [Google Scholar]
- Xie, L.; Wu, L.; Hua, H.U. Jin Gui Shenqi Pill on the Protective Effect of Cognitive Disability-like behavior. Chin. J. Clin. Med. 2020, 32, 1501–1504. [Google Scholar]
- Fang, L.; Zhang, Y.; Wu, Y. Jin Gui Shenqi Pill on the expression of β-amyloid and neuronal nuclear antigen in hippocampal neurons of Alzheimer’s disease rats. Prev. Treat. Cardio-Cerebrovasc. Dis. 2015, 15, 24–26. [Google Scholar]
- Wei, L.; Pan, Q.; Zhang, Y. Effect of Jin Gui Shengqi Pill on NT-3 expression in frontal cortex neurons of Alzheimer’s Disease model rats. Chin. J. TCM Emerg. 2013, 22, 211–213. [Google Scholar]
- Zhou, J.; Zhou, L.; Hou, D.; Tang, J.; Sun, J.; Bondy, S.C. Paeonol increases levels of cortical cytochrome oxidase and vascular actin and improves behavior in a rat model of Alzheimer’s disease. Brain Res. 2011, 1388, 141–147. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhu, Y.; Zhang, L.; Wang, W. Effects of iridoid glycoside of Corni officinalis on apoptosis of Okadate in alzheimer’s disease cell model. Chin. Pharm. 2009, 20, 1364–1367. [Google Scholar]
- Grieb, P. Intracerebroventricular Streptozotocin Injections as a Model of Alzheimer’s Disease: In Search of a Relevant Mechanism. Mol. Neurobiol. 2016, 53, 1741–1752. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Agrawal, M.; Perumal, Y.; Bansal, S.; Arora, S.; Chopra, K. Phycocyanin alleviates ICV-STZ induced cognitive and molecular deficits via PI3-Kinase dependent pathway. Food Chem. Toxicol. 2020, 145, 111684. [Google Scholar] [CrossRef]
- Yu, N.; Huang, Y.; Jiang, Y.; Zou, L.; Liu, X.; Liu, S.; Chen, F.; Luo, J.; Zhu, Y. Ganoderma lucidum Triterpenoids (GLTs) Reduce Neuronal Apoptosis via Inhibition of ROCK Signal Pathway in APP/PS1 Transgenic Alzheimer’s Disease Mice. Oxidative Med. Cell Longev. 2020, 2020, 9894037. [Google Scholar] [CrossRef]
- Xu, S.; Yang, Z.; Zhi, Y.; Yu, S.; Zhang, T.; Jiang, J.; Tang, J.; He, H.; Lu, M.; Wang, X.; et al. The effects of antimony on Alzheimer’s disease-like pathological changes in mice brain. Sci. Total Environ. 2021, 760, 143235. [Google Scholar] [CrossRef]
- Jiang, W.; Zhen, F.; Yao, T.; Gong, F.; Zheng, W.; Yao, N. IFI30 as a prognostic biomarker and correlation with immune infiltrates in glioma. Ann. Transl. Med. 2021, 9, 1686. [Google Scholar] [CrossRef]
- Song, W.; Qiu, J.; Yin, L.; Hong, X.; Dai, W.; Tang, D.; Liu, D.; Dai, Y. Integrated analysis of competing endogenous RNA networks in peripheral blood mononuclear cells of systemic lupus erythematosus. J. Transl. Med. 2021, 19, 362. [Google Scholar] [CrossRef]
- Akhtar, A.; Sah, S.P. Insulin signaling pathway and related molecules: Role in neurodegeneration and Alzheimer’s disease. Neurochem. Int. 2020, 135, 104707. [Google Scholar] [CrossRef]
- Simo, R.; Ciudin, A.; Simo-Servat, O.; Hernández, C. Cognitive impairment and dementia: A new emerging complication of type 2 diabetes-The diabetologist’s perspective. Acta Diabetol. 2017, 54, 417–424. [Google Scholar] [CrossRef]
- de Felice, F.G.; Ferreira, S.T. Inflammation, defective insulin signaling, and mitochondrial dysfunction as common molecular denominators connecting type 2 diabetes to Alzheimer disease. Diabetes 2014, 63, 2262–2272. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bharadwaj, P.; Wijesekara, N.; Liyanapathirana, M.; Newsholme, P.; Ittner, L.; Fraser, P.; Verdile, G. The Link between Type 2 Diabetes and Neurodegeneration: Roles for Amyloid-beta, Amylin, and Tau Proteins. J. Alzheimer’s Dis. 2017, 59, 421–432. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Arnold, S.E.; Arvanitakis, Z.; Macauley-Rambach, S.L.; Koenig, A.M.; Wang, H.Y.; Ahima, R.S.; Craft, S.; Gandy, S.; Buettner, C.; Stoeckel, L.E. Brain insulin resistance in type 2 diabetes and Alzheimer disease: Concepts and conundrums. Nat. Rev. Neurol 2018, 14, 168–181. [Google Scholar] [CrossRef] [PubMed]
- Kshirsagar, V.; Thingore, C.; Juvekar, A. Insulin resistance: A connecting link between Alzheimer’s disease and metabolic disorder. Metab. Brain Dis. 2021, 36, 67–83. [Google Scholar] [CrossRef]
- Song, L.; Yuan, J.; Liu, Y.; Zhang, D.; Zhang, C.; Lin, Q.; Li, M.; Su, K.; Li, Y.; Gao, G. Ghrelin system is involved in improvements in glucose metabolism mediated by hyperbaric oxygen treatment in a streptozotocininduced type 1 diabetes mouse model. Mol. Med. Rep. 2020, 22, 3767–3776. [Google Scholar]
- Zhang, C.; Zhang, D.; Wang, H.; Lin, Q.; Li, M.; Yuan, J.; Gao, G.; Dong, J. Hyperbaric oxygen treatment improves pancreatic betacell function and hepatic gluconeogenesis in STZinduced type2 diabetes mellitus model mice. Mol. Med. Rep. 2022, 25, 90. [Google Scholar] [CrossRef]
- Moreira-Silva, D.; Vizin, R.C.L.; Martins, T.M.S.; Ferreira, T.L.; Almeida, M.C.; Carrettiero, D.C. Intracerebral Injection of Streptozotocin to Model Alzheimer Disease in Rats. Bio-Protocol 2019, 9, e3397. [Google Scholar] [CrossRef]
- Latina, V.; Giacovazzo, G.; Calissano, P.; Atlante, A.; Regina, F.L.; Malerba, F.; Dell’Aquila, M.; Stigliano, E.; Balzamino, B.O.; Micera, A. Tau Cleavage Contributes to Cognitive Dysfunction in Strepto-Zotocin-Induced Sporadic Alzheimer’s Disease (sAD) Mouse Model. Int. J. Mol. Sci. 2021, 22, 12158. [Google Scholar] [CrossRef]
- Akhtar, A.; Dhaliwal, J.; Sah, S.P. 7,8-Dihydroxyflavone improves cognitive functions in ICV-STZ rat model of sporadic Alzheimer’s disease by reversing oxidative stress, mitochondrial dysfunction, and insulin resistance. Berl 2021, 238, 1991–2009. [Google Scholar] [CrossRef]
- Soni, N.D.; Ramesh, A.; Roy, D.; Patel, A.B. Brain energy metabolism in intracerebroventricularly administered streptozotocin mouse model of Alzheimer’s disease: A (1)H-[(13)C]-NMR study. J. Cereb. Blood Flow Metab. 2021, 41, 2344–2355. [Google Scholar] [CrossRef]
- Akhtar, A.; Dhaliwal, J.; Saroj, P.; Uniyal, A.; Bishnoi, M.; Sah, S.P. Chromium picolinate attenuates cognitive deficit in ICV-STZ rat paradigm of sporadic Alzheimer’s-like dementia via targeting neuroinflammatory and IRS-1/PI3K/AKT/GSK-3beta pathway. Inflammopharmacology 2020, 28, 385–400. [Google Scholar] [CrossRef] [PubMed]
- He, J.; Chen, Z.; Kang, X.; Wu, L.; Jiang, J.M.; Liu, S.M.; Wei, H.J.; Chen, Y.J.; Zou, W.; Wang, C.Y.; et al. SIRT1 Mediates H2S-Ameliorated Diabetes-Associated Cognitive Dysfunction in Rats: Possible Involvement of Inhibiting Hippocampal Endoplasmic Reticulum Stress and Synaptic Dysfunction. Neurochem. Res. 2021, 46, 611–623. [Google Scholar] [CrossRef] [PubMed]
- Zhu, L.; Hou, X.J.; Che, X.H.; Zhou, T.S.; Liu, X.Q.; Wu, C.F.; Yang, J.Y. Pseudoginsenoside-F11 attenuates cognitive dysfunction and tau phosphorylation in sporadic Alzheimer’s disease rat model. Acta Pharmacol. Sin. 2021, 42, 1401–1408. [Google Scholar] [CrossRef] [PubMed]
- Patel, R.; Kaur, K.; Singh, S. Protective effect of andrographolide against STZ induced Alzheimer’s disease in experimental rats: Possible neuromodulation and Abeta(1-42) analysis. Inflammopharmacology 2021, 29, 1157–1168. [Google Scholar] [CrossRef] [PubMed]
- Sharma, V.K.; Singh, T.G.; Singh, S.; Garg, N.; Dhiman, S. Apoptotic Pathways and Alzheimer’s Disease: Probing Therapeutic Potential. Neurochem. Res. 2021, 46, 3103–3122. [Google Scholar] [CrossRef] [PubMed]
- Obulesu, M.; Lakshmi, M.J. Apoptosis in Alzheimer’s disease: An understanding of the physiology, pathology and therapeutic avenues. Neurochem. Res. 2014, 39, 2301–2312. [Google Scholar] [CrossRef]
- Paquet, C.; Nicoll, J.A.; Love, S.; Mouton-Liger, F.; Holmes, C.; Hugon, J.; Boche, D. Downregulated apoptosis and autophagy after anti-Abeta immunotherapy in Alzheimer’s disease. Brain Pathol. 2018, 28, 603–610. [Google Scholar] [CrossRef] [Green Version]
- Lopez, J.; Tait, S.W. Mitochondrial apoptosis: Killing cancer using the enemy within. Br. J. Cancer 2015, 112, 957–962. [Google Scholar] [CrossRef] [Green Version]
- D’Orsi, B.; Mateyka, J.; Prehn, J.H.M. Control of mitochondrial physiology and cell death by the Bcl-2 family proteins Bax and Bok. Neurochem. Int. 2017, 109, 162–170. [Google Scholar] [CrossRef]
- Liu, P.; Cui, L.; Liu, B.; Liu, W.; Hayashi, T.; Mizuno, K.; Hattori, S.; Ushiki-Kaku, Y.; Onodera, S.; Ikejima, T. Silibinin ameliorates STZ-induced impairment of memory and learning by up- regulating insulin signaling pathway and attenuating apoptosis. Physiol. Behav. 2020, 213, 112689. [Google Scholar] [CrossRef]
- Cui, J.; Wang, G.; Kandhare, A.D.; Mukherjee-Kandhare, A.A.; Bodhankar, S.L. Neuroprotective effect of naringin, a flavone glycoside in quinolinic acid-induced neurotoxicity: Possible role of PPAR-gamma, Bax/Bcl-2, and caspase-3. Food Chem. Toxicol. 2018, 121, 95–108. [Google Scholar] [CrossRef] [PubMed]
- Lossi, L.; Castagna, C.; Merighi, A. Caspase-3 Mediated Cell Death in the Normal Development of the Mammalian Cerebellum. Int. J. Mol. Sci. 2018, 19, 3999. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chu, J.; Lauretti, E.; Pratico, D. Caspase-3-dependent cleavage of Akt modulates tau phosphorylation via GSK3beta kinase: Implications for Alzheimer’s disease. Mol. Psychiatry 2017, 22, 1002–1008. [Google Scholar] [CrossRef] [PubMed]
- Agrawal, R.; Reno, C.M.; Sharma, S.; Christensen, C.; Huang, Y.; Fisher, S.J. Insulin action in the brain regulates both central and peripheral functions. Am. J. Physiol. Endocrinol. Metab. 2021, 321, E156–E163. [Google Scholar] [CrossRef] [PubMed]
- Gabbouj, S.; Ryhanen, S.; Marttinen, M.; Wittrahm, R.; Takalo, M.; Kemppainen, S.; Martiskainen, H.; Tanila, H.; Haapasalo, A.; Hiltunen, M. Altered Insulin Signaling in Alzheimer’s Disease Brain—Special Emphasis on PI3K-Akt Pathway. Front. Neurosci. 2019, 13, 629. [Google Scholar] [CrossRef]
- Razani, E.; Pourbagheri-Sigaroodi, A.; Safaroghli-Azar, A.; Zoghi, A.; Shanaki-Bavarsad, M.; Bashash, D. The PI3K/Akt signaling axis in Alzheimer’s disease: A valuable target to stimulate or suppress? Cell Stress Chaperones 2021, 26, 871–887. [Google Scholar] [CrossRef]
- Long, H.Z.; Cheng, Y.; Zhou, Z.W.; Luo, H.Y.; Wen, D.D.; Gao, L.C. PI3K/AKT Signal Pathway: A Target of Natural Products in the Prevention and Treatment of Alzheimer’s Disease and Parkinson’s Disease. Front. Pharmacol. 2021, 12, 648636. [Google Scholar] [CrossRef]
- Huang, S.; Czech, M.P. The GLUT4 glucose transporter. Cell Metab. 2007, 5, 237–252. [Google Scholar] [CrossRef] [Green Version]
- McNay, E.C.; Pearson-Leary, J. GluT4: A central player in hippocampal memory and brain insulin resistance. Exp. Neurol. 2020, 323, 113076. [Google Scholar] [CrossRef]
- Kioumourtzoglou, D.; Gould, G.W.; Bryant, N.J. Insulin stimulates syntaxin4 SNARE complex assembly via a novel regulatory mechanism. Mol. Cell Biol. 2014, 34, 1271–1279. [Google Scholar] [CrossRef] [Green Version]
- Bowman, P.R.T.; Smith, G.L.; Gould, G.W. Cardiac SNARE Expression in Health and Disease. Front. Endocrinol. 2019, 10, 881. [Google Scholar] [CrossRef] [PubMed]
- Hao, X.; Zhu, B.; Yang, P.; Dong, D.; Sahbaie, P.; Oliver, P.L.; Shen, W.J.; Azhar, S.; Kraemer, F.B. SNAP25 mutation disrupts metabolic homeostasis, steroid hormone production and central neurobehavior. Biochim. Biophys. Acta Mol. Basis Dis. 2022, 1868, 166304. [Google Scholar] [CrossRef] [PubMed]
Primer | Sequence 5′-3′ | Primer Length |
---|---|---|
Bdnf-F | AGGCTTGACATCATTGGCTGACAC | 24 bp |
Bdnf-R | GGCACTTGACTACTGAGCATCACC | 24 bp |
Ppp2r2b-F | CCGCTGATGACCTGAGGATTAACC | 24 bp |
Ppp2r2b-R | GTGGAACTCGGCTGCTGTGATC | 22 bp |
Lpar1-F | AATCTATGTCAACCGCCGCTTCC | 23 bp |
Lpar1-R | GCCATGTGCTAACAGTCAGTCTCC | 24 bp |
Nr4a1-F | GCACCTTCATGGACGGCTACAC | 22 bp |
Nr4a1-R | CTGAGGACGAGGATGTGGAGGAG | 23 bp |
Atf2-F | GGTCATGGTAGCGGATTGGTTAGG | 24 bp |
Atf2-R | GTAGTGGATGTGGCTGGCTGTTG | 23 bp |
Kit-F | GCGTTCTGCTCCTACTGCTTCG | 22 bp |
Kit-R | TGGATGGATGGTGGAGACGGTTC | 23 bp |
β-Actin-F | TCAGGTCATCACTATCGGCAAT | 22 bp |
β-Actin-R | AAAGAAAGGGTGTAAAACGCA | 22 bp |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Huang, J.; Xu, Z.; Chen, H.; Lin, Y.; Wei, J.; Wang, S.; Yu, H.; Huang, S.; Zhang, Y.; Li, C.; et al. Shen Qi Wan Ameliorates Learning and Memory Impairment Induced by STZ in AD Rats through PI3K/AKT Pathway. Brain Sci. 2022, 12, 758. https://doi.org/10.3390/brainsci12060758
Huang J, Xu Z, Chen H, Lin Y, Wei J, Wang S, Yu H, Huang S, Zhang Y, Li C, et al. Shen Qi Wan Ameliorates Learning and Memory Impairment Induced by STZ in AD Rats through PI3K/AKT Pathway. Brain Sciences. 2022; 12(6):758. https://doi.org/10.3390/brainsci12060758
Chicago/Turabian StyleHuang, Junhao, Zhiwei Xu, Hongshu Chen, Yiyou Lin, Jiale Wei, Sichen Wang, Hongxia Yu, Shuo Huang, Yehui Zhang, Changyu Li, and et al. 2022. "Shen Qi Wan Ameliorates Learning and Memory Impairment Induced by STZ in AD Rats through PI3K/AKT Pathway" Brain Sciences 12, no. 6: 758. https://doi.org/10.3390/brainsci12060758