Neuroprotective Effects of Activated Protein C Involve the PARP/AIF Pathway against Oxygen-Glucose Deprivation in SH-SY5Y Cells
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cell Culture and Treatment
2.2. Cell Viability Assessment
2.3. Electron Microscope Assay
2.4. PAR1, PAR3, and EPCR Expression by Flow Cytometry
2.5. Annexin V/Propidium Iodide (PI) Double-Staining Assay
2.6. Measurement of Mitochondrial Membrane Potential (MMP)
2.7. Caspase-3 Activity Assay
2.8. Analysis of BCL-2, Bax, PARP-1 and AIF mRNA Expression
2.9. Western Blotting
2.10. Statistical Analysis
3. Results
3.1. Effect of OGD Exposure in Differentiated SH-SY5Y Cells
3.2. Effect of APC Treatment on OGD Induced Cell Death
3.3. Effect of APC on the Expression of EPCR, PAR1, and PAR3
3.4. Effect of APC on Caspase-3 Activity and Mitochondrial Dysfunction
3.5. Expression of PARP-1 and AIF
4. Discussion
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Feigin, V.L.; Forouzanfar, M.H.; Krishnamurthi, R.; Mensah, G.A.; Connor, M.; Bennett, D.A.; Moran, A.E.; Sacco, R.L.; Anderson, L.; Truelsen, T.; et al. Global and regional burden of stroke during 1990–2010: Findings from the Global Burden of Disease Study 2010. Lancet 2014, 383, 245–255. [Google Scholar] [CrossRef]
- ClinicalTrials.gov. Available online: https://www.clinicaltrial.gov/ (accessed on 3 December 2015).
- Foster, D.; Davie, E.W. Characterization of a cDNA coding for human protein C. Proc. Natl. Acad. Sci. USA 1984, 81, 4766–4770. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jackson, C.; Whitmont, K.; Tritton, S.; March, L.; Sambrook, P.; Xue, M. New therapeutic applications for the anticoagulant, activated protein C. Expert Opin. Biol. Ther. 2008, 8, 1109–1122. [Google Scholar] [CrossRef] [PubMed]
- Dahlbäck, B.; Villoutreix, B.O. Regulation of blood coagulation by the protein C anticoagulant pathway: Novel insights into structure-function relationships and molecular recognition. Arterioscler. Thromb. Vasc. Biol. 2005, 25, 1311–1320. [Google Scholar] [CrossRef] [PubMed]
- Bernard, G.R.; Vincent, J.L.; Laterre, P.F.; LaRosa, S.P.; Dhainaut, J.F.; Lopez-Rodriguez, A.; Steingrub, J.S.; Garber, G.E.; Helterbrand, J.D.; Ely, E.W.; et al. Efficacy and safety of recombinant human activated protein C for severe sepsis. N. Engl. J. Med. 2001, 344, 699–709. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Folsom, A.R.; Ohira, T.; Yamagishi, K.; Cushman, M. Low protein C and incidence of ischemic stroke and coronary heart disease: The Atherosclerosis Risk in Communities (ARIC) Study. J. Thromb. Haemost. JTH 2009, 7, 1774–1778. [Google Scholar] [CrossRef] [Green Version]
- Joyce, D.E.; Gelbert, L.; Ciaccia, A.; DeHoff, B.; Grinnell, B.W. Gene expression profile of antithrombotic protein c defines new mechanisms modulating inflammation and apoptosis. J. Biol. Chem. 2001, 276, 11199–11203. [Google Scholar] [CrossRef] [Green Version]
- Gupta, A.; Gerlitz, B.; Richardson, M.A.; Bull, C.; Berg, D.T.; Syed, S.; Galbreath, E.J.; Swanson, B.A.; Jones, B.E.; Grinnell, B.W. Distinct Functions of Activated Protein C Differentially Attenuate Acute Kidney Injury. J. Am. Soc. Nephrol. JASN 2009, 20, 267–277. [Google Scholar] [CrossRef]
- Cheng, T.; Liu, D.; Griffin, J.H.; Fernández, J.A.; Castellino, F.; Rosen, E.D.; Fukudome, K.; Zlokovic, B.V. Activated protein C blocks p53-mediated apoptosis in ischemic human brain endothelium and is neuroprotective. Nat. Med. 2003, 9, 338–342. [Google Scholar] [CrossRef]
- Coughlin, S.R. Thrombin signalling and protease-activated receptors. Nature 2000, 407, 258–264. [Google Scholar] [CrossRef]
- Dömötör, E.; Benzakour, O.; Griffin, J.H.; Yule, D.; Fukudome, K.; Zlokovic, B.V. Activated protein C alters cytosolic calcium flux in human brain endothelium via binding to endothelial protein C receptor and activation of protease activated receptor-1. Blood 2003, 101, 4797–4801. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Guo, H.; Liu, D.; Gelbard, H.; Cheng, T.; Insalaco, R.; Fernández, J.A.; Griffin, J.H.; Zlokovic, B.V. Activated protein C prevents neuronal apoptosis via protease activated receptors 1 and 3. Neuron 2004, 41, 563–572. [Google Scholar] [CrossRef] [Green Version]
- Mosnier, L.O.; Zlokovic, B.V.; Griffin, J.H. The cytoprotective protein C pathway. Blood 2007, 109, 3161–3172. [Google Scholar] [CrossRef] [PubMed]
- Mosnier, L.O.; Griffin, J.H. Inhibition of staurosporine-induced apoptosis of endothelial cells by activated protein C requires protease-activated receptor-1 and endothelial cell protein C receptor. Biochem. J. 2003, 373, 65–70. [Google Scholar] [CrossRef] [Green Version]
- O’Brien, P.J.; Molino, M.; Kahn, M.; Brass, L.F. Protease activated receptors: Theme and variations. Oncogene 2001, 20, 1570–1581. [Google Scholar] [CrossRef] [Green Version]
- Riewald, M.; Petrovan, R.J.; Donner, A.; Mueller, B.M.; Ruf, W. Activation of endothelial cell protease activated receptor 1 by the protein C pathway. Science 2002, 296, 1880–1882. [Google Scholar] [CrossRef]
- Hamby, A.M.; Suh, S.W.; Kauppinen, T.M.; Swanson, R.A. Use of a poly(ADP-ribose) polymerase inhibitor to suppress inflammation and neuronal death after cerebral ischemia-reperfusion. Stroke J. Cereb. Circ. 2007, 38, 632–636. [Google Scholar] [CrossRef] [Green Version]
- Krishnakumar, R.; Kraus, W.L. The PARP Side of the Nucleus: Molecular Actions, Physiological Outcomes, and Clinical Targets. Mol. Cell 2010, 39, 8–24. [Google Scholar] [CrossRef] [Green Version]
- Li, Y.; Li, C.; Sun, L.; Chu, G.; Li, J.; Chen, F.; Li, G.; Zhao, Y. Role of p300 in regulating neuronal nitric oxide synthase gene expression through nuclear factor-κB-mediated way in neuronal cells. Neuroscience 2013, 248, 681–689. [Google Scholar] [CrossRef]
- Degterev, A.; Yuan, J. Expansion and evolution of cell death programmes. Nat. Rev. Mol. Cell Biol. 2008, 9, 378–390. [Google Scholar] [CrossRef]
- Curtin, N.J.; Szabo, C. Therapeutic applications of PARP inhibitors: Anticancer therapy and beyond. Mol. Asp. Med. 2013, 34, 1217–1256. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Komjáti, K.; Besson, V.C.; Szabó, C. Poly (adp-ribose) polymerase inhibitors as potential therapeutic agents in stroke and neurotrauma. Curr. Drug Targets CNS Neurol. Disord. 2005, 4, 179–194. [Google Scholar] [CrossRef] [PubMed]
- Abdelkarim, G.E.; Gertz, K.; Harms, C.; Katchanov, J.; Dirnagl, U.; Szabó, C.; Endres, M. Protective effects of PJ34, a novel, potent inhibitor of poly(ADP-ribose) polymerase (PARP) in in vitro and in vivo models of stroke. Int. J. Mol. Med. 2001, 7, 255–260. [Google Scholar] [CrossRef] [PubMed]
- Haddad, M.; Rhinn, H.; Bloquel, C.; Coqueran, B.; Szabó, C.; Plotkine, M.; Scherman, D.; Margaill, I. Anti-inflammatory effects of PJ34, a poly(ADP-ribose) polymerase inhibitor, in transient focal cerebral ischemia in mice. Br. J. Pharmacol. 2006, 149, 23–30. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Park, E.-M.; Cho, S.; Frys, K.; Racchumi, G.; Zhou, P.; Anrather, J.; Iadecola, C. Interaction between inducible nitric oxide synthase and poly(ADP-ribose) polymerase in focal ischemic brain injury. Stroke J. Cereb. Circ. 2004, 35, 2896–2901. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Matsuo, N.; Ogawa, S.; Takagi, T.; Wanaka, A.; Mori, T.; Matsuyama, T.; Pinsky, D.J.; Stern, D.M.; Tohyama, M. Cloning of a putative vesicle transport-related protein, RA410, from cultured rat astrocytes and its expression in ischemic rat brain. J. Biol. Chem. 1997, 272, 16438–16444. [Google Scholar] [CrossRef] [Green Version]
- Yamaguchi, T.; Sano, K.; Takakura, K.; Saito, I.; Shinohara, Y.; Asano, T.; Yasuhara, H. Ebselen in acute ischemic stroke: A placebo-controlled, double-blind clinical trial. Ebselen Study Group. Stroke J. Cereb. Circ. 1998, 29, 12–17. [Google Scholar] [CrossRef] [PubMed]
- Zeng, Y.; Xie, K.; Dong, H.; Zhang, H.; Wang, F.; Li, Y.; Xiong, L. Hyperbaric oxygen preconditioning protects cortical neurons against oxygen-glucose deprivation injury: Role of peroxisome proliferator-activated receptor-gamma. Brain Res. 2012, 1452, 140–150. [Google Scholar] [CrossRef]
- McGahon, A.J.; Martin, S.J.; Bissonnette, R.P.; Mahboubi, A.; Shi, Y.; Mogil, R.J.; Nishioka, W.K.; Green, D.R. The end of the (cell) line: Methods for the study of apoptosis in vitro. Methods Cell Biol. 1995, 46, 153–185. [Google Scholar]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods San Diego Calif. 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Ginsberg, M.D. Neuroprotection for ischemic stroke: Past, present and future. Neuropharmacology 2008, 55, 363–389. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mendioroz, M.; Fernández-Cadenas, I.; Alvarez-Sabín, J.; Rosell, A.; Quiroga, D.; Cuadrado, E.; Delgado, P.; Rubiera, M.; Ribó, M.; Molina, C.; et al. Endogenous activated protein C predicts hemorrhagic transformation and mortality after tissue plasminogen activator treatment in stroke patients. Cerebrovasc. Dis. Basel Switz. 2009, 28, 143–150. [Google Scholar] [CrossRef] [PubMed]
- Zlokovic, B.V.; Griffin, J.H. Cytoprotective protein C pathways and implications for stroke and neurological disorders. Trends Neurosci. 2011, 34, 198–209. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bouwens, E.A.; Stavenuiter, F.; Mosnier, L.O. Mechanisms of anticoagulant and cytoprotective actions of the protein C pathway. J. Thromb. Haemost. 2013, 11 (Suppl. 1), 242–253. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Danese, S.; Vetrano, S.; Zhang, L.; Poplis, V.A.; Castellino, F.J. The protein C pathway in tissue inflammation and injury: Pathogenic role and therapeutic implications. Blood 2010, 115, 1121–1130. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Esmon, C.T. Protein C anticoagulant system—Anti-inflammatory effects. Semin. Immunopathol. 2012, 34, 127–132. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, D.; Cheng, T.; Guo, H.; Fernández, J.A.; Griffin, J.H.; Song, X.; Zlokovic, B.V. Tissue plasminogen activator neurovascular toxicity is controlled by activated protein C. Nat. Med. 2004, 10, 1379–1383. [Google Scholar] [CrossRef]
- Zamzami, N.; Larochette, N.; Kroemer, G. Mitochondrial permeability transition in apoptosis and necrosis. Cell Death Differ. 2005, 12 (Suppl. 2), 1478–1480. [Google Scholar] [CrossRef]
- Andrabi, S.A.; Kim, N.S.; Yu, S.-W.; Wang, H.; Koh, D.W.; Sasaki, M.; Klaus, J.A.; Otsuka, T.; Zhang, Z.; Koehler, R.C.; et al. Poly(ADP-ribose) (PAR) polymer is a death signal. Proc. Natl. Acad. Sci. USA 2006, 103, 18308–18313. [Google Scholar] [CrossRef] [Green Version]
- Yu, S.-W.; Andrabi, S.A.; Wang, H.; Kim, N.S.; Poirier, G.G.; Dawson, T.M.; Dawson, V.L. Apoptosis-inducing factor mediates poly(ADP-ribose) (PAR) polymer-induced cell death. Proc. Natl. Acad. Sci. USA 2006, 103, 18314–18319. [Google Scholar] [CrossRef] [Green Version]
- Dugan, L.L.; Sensi, S.L.; Canzoniero, L.M.; Handran, S.D.; Rothman, S.M.; Lin, T.S.; Goldberg, M.P.; Choi, D.W. Mitochondrial production of reactive oxygen species in cortical neurons following exposure to N-methyl-D-aspartate. J. Neurosci. Off. J. Soc. Neurosci. 1995, 15, 6377–6388. [Google Scholar] [CrossRef] [Green Version]
- Mandir, A.S.; Poitras, M.F.; Berliner, A.R.; Herring, W.J.; Guastella, D.B.; Feldman, A.; Poirier, G.G.; Wang, Z.Q.; Dawson, T.M.; Dawson, V.L. NMDA but not non-NMDA excitotoxicity is mediated by Poly(ADP-ribose) polymerase. J. Neurosci. Off. J. Soc. Neurosci. 2000, 20, 8005–8011. [Google Scholar] [CrossRef]
- Moroni, F.; Meli, E.; Peruginelli, F.; Chiarugi, A.; Cozzi, A.; Picca, R.; Romagnoli, P.; Pellicciari, R.; Pellegrini-Giampietro, D.E. Poly(ADP-ribose) polymerase inhibitors attenuate necrotic but not apoptotic neuronal death in experimental models of cerebral ischemia. Cell Death Differ. 2001, 8, 921–932. [Google Scholar] [CrossRef] [PubMed]
- Strosznajder, R.P.; Gadamski, R.; Czapski, G.A.; Jesko, H.; Strosznajder, J.B. Poly(ADP-ribose) polymerase during reperfusion after transient forebrain ischemia: Its role in brain edema and cell death. J. Mol. Neurosci. 2003, 20, 61–72. [Google Scholar] [CrossRef]
- Suh, S.W.; Aoyama, K.; Chen, Y.; Garnier, P.; Matsumori, Y.; Gum, E.; Liu, J.; Swanson, R.A. Hypoglycemic neuronal death and cognitive impairment are prevented by poly(ADP-ribose) polymerase inhibitors administered after hypoglycemia. J. Neurosci. Off. J. Soc. Neurosci. 2003, 23, 10681–10690. [Google Scholar] [CrossRef] [Green Version]
- Culmsee, C.; Zhu, C.; Landshamer, S.; Becattini, B.; Wagner, E.; Pellecchia, M.; Pellechia, M.; Blomgren, K.; Plesnila, N. Apoptosis-inducing factor triggered by poly(ADP-ribose) polymerase and Bid mediates neuronal cell death after oxygen-glucose deprivation and focal cerebral ischemia. J. Neurosci. Off. J. Soc. Neurosci. 2005, 25, 10262–10272. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Moubarak, R.S.; Yuste, V.J.; Artus, C.; Bouharrour, A.; Greer, P.A.; Menissier-de Murcia, J.; Susin, S.A. Sequential activation of poly(ADP-ribose) polymerase 1, calpains, and Bax is essential in apoptosis-inducing factor-mediated programmed necrosis. Mol. Cell. Biol. 2007, 27, 4844–4862. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Gene | Primer Sequence (5′-3′) |
---|---|
BCL2 | F: GTGCCACCTGTGGTCCACCT |
R: CTTCACTTGTGGCCCAGATAGG | |
Bax | F: GCTTCAGGGTTTCATCCAGG |
R: AACATGTCAGCTGCCACTCG | |
PARP-1 | F: TTGAAAAAGCCCTAAAGGCTCA |
R: CTACTCGGTCCAAGATCGCC | |
AIF | F: AAATCTCTCCACTACACT |
R: AATTTTAGCAGATTAAGAAGC | |
GAPDH | F: AACAGCGACACCCATCCTC |
R: CATACCAGGAAATGAGCTTGACAA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sriwastva, M.K.; Kunjunni, R.; Andrabi, M.; Prasad, K.; Saxena, R.; Subbiah, V. Neuroprotective Effects of Activated Protein C Involve the PARP/AIF Pathway against Oxygen-Glucose Deprivation in SH-SY5Y Cells. Brain Sci. 2020, 10, 959. https://doi.org/10.3390/brainsci10120959
Sriwastva MK, Kunjunni R, Andrabi M, Prasad K, Saxena R, Subbiah V. Neuroprotective Effects of Activated Protein C Involve the PARP/AIF Pathway against Oxygen-Glucose Deprivation in SH-SY5Y Cells. Brain Sciences. 2020; 10(12):959. https://doi.org/10.3390/brainsci10120959
Chicago/Turabian StyleSriwastva, Mukesh Kumar, Remesh Kunjunni, Mutahar Andrabi, Kameshwar Prasad, Renu Saxena, and Vivekanandhan Subbiah. 2020. "Neuroprotective Effects of Activated Protein C Involve the PARP/AIF Pathway against Oxygen-Glucose Deprivation in SH-SY5Y Cells" Brain Sciences 10, no. 12: 959. https://doi.org/10.3390/brainsci10120959
APA StyleSriwastva, M. K., Kunjunni, R., Andrabi, M., Prasad, K., Saxena, R., & Subbiah, V. (2020). Neuroprotective Effects of Activated Protein C Involve the PARP/AIF Pathway against Oxygen-Glucose Deprivation in SH-SY5Y Cells. Brain Sciences, 10(12), 959. https://doi.org/10.3390/brainsci10120959