Identification of Novel Hypothalamic MicroRNAs as Promising Therapeutics for SARS-CoV-2 by Regulating ACE2 and TMPRSS2 Expression: An In Silico Analysis
Abstract
:1. Introduction
2. Materials and Methods
3. Results
3.1. Identification of Potential Hypothalamic miRNAs Involved in Regulation of ACE2
3.2. Identification of Potential Hypothalamic miRNAs Involved in Regulation of TMPSS2
4. Discussion
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Rampal, L.; Seng, L.B. Coronavirus Disease (COVID-19) Pandemic. Med. J. Malays. 2020, 75, 95–97. [Google Scholar]
- Kandeel, M.; Ibrahim, A.; Fayez, M.; Al-Nazawi, M. From SARS and MERS CoVs to SARS-CoV-2: Moving toward more biased codon usage in viral structural and nonstructural genes. J. Med. Virol. 2020, 92, 660–666. [Google Scholar] [CrossRef]
- Baig, A.M.; Khaleeq, A.; Ali, U.; Syeda, H. Evidence of the COVID-19 Virus Targeting the CNS: Tissue Distribution, Host-Virus Interaction, and Proposed Neurotropic Mechanisms. ACS Chem. Neurosci. 2020, 11, 995–998. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shang, J.; Ye, G.; Shi, K.; Wan, Y.; Luo, C.; Aihara, H.; Geng, Q.; Auerbach, A.; Li, F. Structural basis of receptor recognition by SARS-CoV-2. Nature 2020, 581, 221–224. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lahiri, D.; Mondal, R.; Deb, S.; Bandyopadhyay, D.; Shome, G.; Sarkar, S.; Biswas, S.C. Neuroinvasive potential of a primary respiratory pathogen SARS-CoV2: Summarizing the evidences. Diabetes Metab. Syndr. Clin. Res. Rev. 2020, 14, 1053–1060. [Google Scholar] [CrossRef]
- Pennisi, M.; Lanza, G.; Falzone, L.; Fisicaro, F.; Ferri, R.; Bella, R. SARS-CoV-2 and the Nervous System: From Clinical Features to Molecular Mechanisms. Int. J. Mol. Sci. 2020, 21, 5475. [Google Scholar] [CrossRef]
- Parrotta, E.; Kister, I.; Charvet, L.; Sammarco, C.; Saha, V.; Charlson, R.E.; Howard, J.; Gutman, J.M.; Gottesman, M.; Abou-Fayssal, N.; et al. COVID-19 outcomes in MS: Observational study of early experience from NYU Multiple Sclerosis Comprehensive Care Center. Neurol. Neuroimmunol. Neuroinflamm. 2020, 7, e835. [Google Scholar] [CrossRef]
- Mao, L.; Jin, H.; Wang, M.; Hu, Y.; Chen, S.; He, Q.; Chang, J.; Hong, C.; Zhou, Y.; Wang, D.; et al. Neurologic Manifestations of Hospitalized Patients with Coronavirus Disease 2019 in Wuhan, China. JAMA Neurol. 2020, 77, 683–690. [Google Scholar] [CrossRef] [Green Version]
- Aghagoli, G.; Marin, B.G.; Katchur, N.J.; Chaves-Sell, F.; Asaad, W.F.; Murphy, S.A. Neurological Involvement in COVID-19 and Potential Mechanisms: A Review. Neurocrit. Care 2020, 1–10. [Google Scholar] [CrossRef]
- Wu, Y.; Xu, X.; Chen, Z.; Duan, J.; Hashimoto, K.; Yang, L.; Liu, C.; Yang, C. Nervous system involvement after infection with COVID-19 and other coronaviruses. Brain Behav. Immun. 2020, 87, 18–22. [Google Scholar] [CrossRef]
- Durrant, D.M.; Ghosh, S.; Klein, R.S. The Olfactory Bulb: An Immunosensory Effector Organ during Neurotropic Viral Infections. ACS Chem. Neurosci. 2016, 7, 464–469. [Google Scholar] [CrossRef] [Green Version]
- Bohmwald, K.; Gálvez, N.M.S.; Ríos, M.; Kalergis, A.M. Neurologic alterations due to respiratory virus infections. Front. Cell. Neurosci. 2018, 12, 386. [Google Scholar] [CrossRef]
- Leonardi, M.; Padovani, A.; McArthur, J.C. Neurological manifestations associated with COVID-19: A review and a call for action. J. Neurol. 2020, 267, 1573–1576. [Google Scholar] [CrossRef] [PubMed]
- Das, G.; Mukherjee, N.; Ghosh, S. Neurological Insights of COVID-19 Pandemic. Acs Chem. Neurosci. 2020, 11, 1206–1209. [Google Scholar] [CrossRef] [PubMed]
- Chen, K.; Rajewsky, N. The evolution of gene regulation by transcription factors and microRNAs. Nat. Rev. Genet. 2007, 8, 93–103. [Google Scholar] [CrossRef]
- Zhang, Y.; Li, T.; Fu, L.; Yu, C.; Li, Y.; Xu, X.; Wang, Y.; Ning, H.; Zhang, S.; Chen, W.; et al. Silencing SARS-CoV Spike protein expression in cultured cells by RNA interference. FEBS Lett. 2004, 560, 141–146. [Google Scholar] [CrossRef] [Green Version]
- Turjya, R.R.; Khan, M.A.-A.-K.K.; Islam, M.K.; Islam, A.B.M.M.K. Perversely expressed long noncoding RNAs can alter host 1 response and viral proliferation in SARS-CoV-2 infection. bioRxiv 2020. [Google Scholar] [CrossRef]
- Vishnubalaji, R.; Shaath, H.; Alajez, N.M. Protein coding and long noncoding RNA (lncRNA)) transcriptional landscape in SARS-CoV-2 infected bronchial epithelial cells highlight a role for interferon and inflammatory response. Genes 2020, 11, 760. [Google Scholar] [CrossRef]
- Kaczmarek, J.C.; Kowalski, P.S.; Anderson, D.G. Advances in the delivery of RNA therapeutics: From concept to clinical reality. Genome Med. 2017, 9, 60. [Google Scholar] [CrossRef] [Green Version]
- Baumann, V.; Winkler, J. MiRNA-based therapies: Strategies and delivery platforms for oligonucleotide and non-oligonucleotide agents. Future Med. Chem. 2014, 6, 1967–1984. [Google Scholar] [CrossRef] [Green Version]
- Khan, M.A.A.K.; Sany, M.R.U.; Islam, M.S.; Islam, A.B.M.M.K. Epigenetic Regulator miRNA Pattern Differences Among SARS-CoV, SARS-CoV-2, and SARS-CoV-2 World-Wide Isolates Delineated the Mystery Behind the Epic Pathogenicity and Distinct Clinical Characteristics of Pandemic COVID-19. Front. Genet. 2020, 11, 765. [Google Scholar] [CrossRef] [PubMed]
- Trobaugh, D.W.; Klimstra, W.B. MicroRNA Regulation of RNA Virus Replication and Pathogenesis. Trends Mol. Med. 2017, 23, 80–93. [Google Scholar] [CrossRef]
- Gruber, A.R.; Lorenz, R.; Bernhart, S.H.; Neuböck, R.; Hofacker, I.L. The Vienna RNA websuite. Nucleic Acids Res. 2008, 36, W70–W74. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cullen, B.R. MicroRNAs as mediators of viral evasion of the immune system. Nat. Immunol. 2013, 14, 205–210. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ivashchenko, A.; Rakhmetullina, A.; Akimniyazova, A.; Aisina, D.; Pyrkova, A. The miRNA COMPLEXES AGAINST CORONAVIRUSES COVID-19, SARS-CoV, and MERS-CoV. Virology 2020. [Google Scholar] [CrossRef] [Green Version]
- Liu, Q.; Du, J.; Yu, X.; Xu, J.; Huang, F.; Li, X.; Zhang, C.; Li, X.; Chang, J.; Shang, D.; et al. MiRNA-200c-3p is crucial in acute respiratory distress syndrome. Cell Discov. 2017, 3, 17021. [Google Scholar] [CrossRef]
- Petrescu, G.E.D.; Sabo, A.A.; Torsin, L.I.; Calin, G.A.; Dragomir, M.P. MicroRNA based theranostics for brain cancer: Basic principles. J. Exp. Clin. Cancer Res. 2019, 38, 231. [Google Scholar] [CrossRef] [Green Version]
- Angelucci, F.; Cechova, K.; Valis, M.; Kuca, K.; Zhang, B.; Hort, J. MicroRNAs in Alzheimer’s Disease: Diagnostic Markers or Therapeutic Agents? Front. Pharmacol. 2019, 10, 665. [Google Scholar] [CrossRef]
- Singh, A.; Sen, D. MicroRNAs in Parkinson’s disease. Exp. Brain Res. 2017, 235, 2359–2374. [Google Scholar] [CrossRef]
- Kapsimali, M.; Kloosterman, W.P.; de Bruijn, E.; Rosa, F.; Plasterk, R.H.A.; Wilson, S.W. MicroRNAs show a wide diversity of expression profiles in the developing and mature central nervous system. Genome Biol. 2007, 8, R173. [Google Scholar] [CrossRef] [Green Version]
- Mussa, B.M.; Taneera, J.; Mohammed, A.K.; Srivastava, A.; Mukhopadhyay, D.; Sulaiman, N. Potential role of hypothalamic microRNAs in regulation of FOS and FTO expression in response to hypoglycemia. J. Physiol. Sci. 2019, 69, 981–991. [Google Scholar] [CrossRef]
- Schneeberger, M.; Gomez-Valadés, A.G.; Ramirez, S.; Gomis, R.; Claret, M. Hypothalamic miRNAs: Emerging roles in energy balance control. Front. Neurosci. 2015, 9, 41. [Google Scholar] [CrossRef] [Green Version]
- Najam, S.S.; Zglinicki, B.; Vinnikov, I.A.; Konopka, W. MicroRNAs in the hypothalamic control of energy homeostasis. Cell Tissue Res. 2019, 375, 173–177. [Google Scholar] [CrossRef]
- Nampoothiri, S.; Sauve, F.; Ternier, G.; Fernandois, D.; Coelho, C.; Imbernon, M.; Deligia, E.; Perbet, R.; Florent, V.; Baroncini, M.; et al. The hypothalamus as a hub for SARS-CoV-2 brain infection and pathogenesis. bioRxiv 2020, 1–46. [Google Scholar] [CrossRef]
- Crépin, D.; Benomar, Y.; Riffault, L.; Amine, H.; Gertler, A.; Taouis, M. The over-expression of miR-200a in the hypothalamus of ob/ob mice is linked to leptin and insulin signaling impairment. Mol. Cell. Endocrinol. 2014, 384, 1–11. [Google Scholar] [CrossRef]
- Herzer, S.; Silahtaroglu, A.; Meister, B. Locked Nucleic Acid-Based In Situ Hybridisation Reveals miR-7a as a Hypothalamus-Enriched MicroRNA with a Distinct Expression Pattern. J. Neuroendocrinol. 2012, 24, 1492–1504. [Google Scholar] [CrossRef]
- Lee, H.J.; Palkovits, M.; Young, W.S. miR-7b, a microRNA up-regulated in the hypothalamus after chronic hyperosmolar stimulation, inhibits Fos translation. Proc. Natl. Acad. Sci. USA 2006, 103, 15669–15674. [Google Scholar] [CrossRef] [Green Version]
- Sangiao-Alvarellos, S.; Pena-Bello, L.; Manfredi-Lozano, M.; Tena-Sempere, M.; Cordido, F. Perturbation of Hypothalamic MicroRNA Expression Patterns in Male Rats After Metabolic Distress: Impact of Obesity and Conditions of Negative Energy Balance. Endocrinology 2014, 155, 1838–1850. [Google Scholar] [CrossRef] [Green Version]
- Lee, H.; Han, S.; Kwon, C.S.; Lee, D. Biogenesis and regulation of the let-7 miRNAs and their functional implications. Protein Cell 2016, 7, 100–113. [Google Scholar] [CrossRef] [Green Version]
- Benoit, C.; Doubi-Kadmiri, S.; Benigni, X.; Crepin, D.; Riffault, L.; Poizat, G.; Vacher, C.-M.; Taouis, M.; Baroin-Tourancheau, A.; Amar, L. MiRNA long-term response to early metabolic environmental challenge in hypothalamic arcuate nucleus. Front. Mol. Neurosci. 2018, 11, 90. [Google Scholar] [CrossRef] [Green Version]
- Zhu, J.; Chen, Z.; Meng, Z.; Ju, M.; Zhang, M.; Wu, G.; Guo, H.; Tian, Z. Electroacupuncture Alleviates Surgical Trauma-Induced Hypothalamus Pituitary Adrenal Axis Hyperactivity Via microRNA-142. Front. Mol. Neurosci. 2017, 10, 308. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ruan, W.; Ning, G.; Feng, S.; Gao, S.; Hao, Y. MicroRNA-381/Hes1 is a potential therapeutic target for spinal cord injury. Int. J. Mol. Med. 2018, 42, 1008–1017. [Google Scholar] [CrossRef] [Green Version]
- Ye, R.-S.; Xi, Q.-Y.; Qi, Q.; Cheng, X.; Chen, T.; Li, H.; Kallon, S.; Shu, G.; Wang, S.-B.; Jiang, Q.-Y.; et al. Differentially Expressed miRNAs after GnRH Treatment and Their Potential Roles in FSH Regulation in Porcine Anterior Pituitary Cell. PLoS ONE 2013, 8, e57156. [Google Scholar] [CrossRef]
- Schroeder, M.; Drori, Y.; Ben-Efraim, Y.J.; Chen, A. Hypothalamic miR-219 regulates individual metabolic differences in response to diet-induced weight cycling. Mol. Metab. 2018, 9, 176–186. [Google Scholar] [CrossRef]
- Svetoni, F.; de Paola, E.; la Rosa, P.; Mercatelli, N.; Caporossi, D.; Sette, C.; Paronetto, M.P. Post-transcriptional regulation of FUS and EWS protein expression by miR-141 during neural differentiation. Hum. Mol. Genet. 2017, 26, 2732–2746. [Google Scholar] [CrossRef] [Green Version]
- Aschrafi, A.; Verheijen, J.; Gordebeke, P.M.; Loohuis, N.F.O.; Menting, K.; Jager, A.; Palkovits, M.; Geenen, B.; Kos, A.; Martens, G.J.M.; et al. MicroRNA-326 acts as a molecular switch in the regulation of midbrain urocortin 1 expression. J. Psychiatry Neurosci. 2016, 41, 342–353. [Google Scholar] [CrossRef] [Green Version]
- D’Angelo, D.; Palmieri, D.; Mussnich, P.; Roche, M.; Wierinckx, A.; Raverot, G.; Fedele, M.; Croce, C.M.; Trouillas, J.; Fusco, A. Altered MicroRNA Expression Profile in Human Pituitary GH Adenomas: Down-Regulation of miRNA Targeting HMGA1, HMGA2, and E2F1. J. Clin. Endocrinol. Metab. 2012, 97, E1128–E1138. [Google Scholar] [CrossRef]
- Ciernia, A.V.; Laufer, B.I.; Dunaway, K.W.; Mordaunt, C.E.; Coulson, R.L.; Totah, T.S.; Stolzenberg, D.S.; Frahm, J.C.; Singh-Taylor, A.; Baram, T.Z.; et al. Experience-dependent neuroplasticity of the developing hypothalamus: Integrative epigenomic approaches. Epigenetics 2018, 13, 318–330. [Google Scholar] [CrossRef] [Green Version]
- Yu, Z.-W.; Gao, W.; Feng, X.-Y.; Zhang, J.-Y.; Guo, H.-X.; Wang, C.-J.; Chen, J.; Hu, J.-P.; Ren, W.-Z.; Yuan, B. Roles of differential expression of miR-543-5p in GH regulation in rat anterior pituitary cells and GH3 cells. PLoS ONE 2019, 14, e0222340. [Google Scholar] [CrossRef] [Green Version]
- Zhao, C.-L.; Cui, H.-A.; Zhang, X.-R. MiR-543-5p inhibits inflammation and promotes nerve regeneration through inactivation of the NF-κB in rats after spinal cord injury. Eur. Rev. Med. Pharm. Sci. 2019, 23, 39–46. [Google Scholar]
- Panta, A.; Pandey, S.; Duncan, I.N.; Duhamel, S.; Sohrabji, F. Mir363-3p attenuates post-stroke depressive-like behaviors in middle-aged female rats. Brain Behav. Immun. 2019, 78, 31–40. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.C.; Bai, W.Z.; Hashikawa, T. The neuroinvasive potential of SARS-CoV2 may play a role in the respiratory failure of COVID-19 patients. J. Med. Virol. 2020, 92, 552–555. [Google Scholar] [CrossRef] [PubMed]
- Patel, V.B.; Zhong, J.-C.; Fan, D.; Basu, R.; Morton, J.S.; Parajuli, N.; McMurtry, M.S.; Davidge, S.T.; Kassiri, Z.; Oudit, G.Y. Angiotensin-converting enzyme 2 is a critical determinant of angiotensin II-induced loss of vascular smooth muscle cells and adverse vascular remodeling. Hypertension 2014, 64, 157–164. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Z.Z.; Chen, L.J.; Zhong, J.C.; Gao, P.J.; Oudit, G.Y. ACE2/Ang-(1-7) signaling and vascular remodeling. Sci. China Life Sci. 2014, 57, 802–808. [Google Scholar] [CrossRef] [Green Version]
- Yu, X.-H.; Tang, Z.-B.; Liu, L.-J.; Qian, H.; Tang, S.-L.; Zhang, D.-W.; Tian, G.-P.; Tang, C.-K. Apelin and its receptor APJ in cardiovascular diseases. Clin. Chim. Acta 2014, 428, 1–8. [Google Scholar] [CrossRef]
- Bátkai, S.; Thum, T. MicroRNAs in hypertension: Mechanisms and therapeutic targets. Curr. Hypertens. Rep. 2012, 14, 79–87. [Google Scholar] [CrossRef]
- Kohlstedt, K.; Trouvain, C.; Boettger, T.; Shi, L.; Fisslthaler, B.; Fleming, I. AMP-activated protein kinase regulates endothelial cell angiotensin-converting enzyme expression via p53 and the post-transcriptional regulation of microRNA-143/145. Circ. Res. 2013, 112, 1150–1158. [Google Scholar] [CrossRef] [Green Version]
- Hu, B.; Song, J.t.; Qu, H.y.; Bi, C.l.; Huang, X.z.; Liu, X.x.; Zhang, M. Mechanical Stretch Suppresses microRNA-145 Expression by Activating Extracellular Signal-Regulated Kinase 1/2 and Upregulating Angiotensin-Converting Enzyme to Alter Vascular Smooth Muscle Cell Phenotype. PLoS ONE 2014, 9, e96338. [Google Scholar] [CrossRef] [Green Version]
- Kemp, J.R.; Unal, H.; Desnoyer, R.; Yue, H.; Bhatnagar, A.; Karnik, S.S. Angiotensin II-regulated microRNA 483-3p directly targets multiple components of the renin-angiotensin system. J. Mol. Cell. Cardiol. 2014, 75, 25–39. [Google Scholar] [CrossRef] [Green Version]
- Lambert, D.W.; Lambert, L.A.; Clarke, N.E.; Hooper, N.M.; Porter, K.E.; Turner, A.J. Angiotensin-converting enzyme 2 is subject to post-transcriptional regulation by miR-421. Clin. Sci. 2014, 127, 243–249. [Google Scholar] [CrossRef]
- Gu, Q.; Wang, B.; Zhang, X.F.; Ma, Y.P.; Liu, J.D.; Wang, X.Z. Contribution of renin-angiotensin system to exercise-induced attenuation of aortic remodeling and improvement of endothelial function in spontaneously hypertensive rats. Cardiovasc. Pathol. 2014, 23, 298–305. [Google Scholar] [CrossRef] [PubMed]
- Zhang, R.; Su, H.; Ma, X.; Xu, X.; Liang, L.; Ma, G.; Shi, L. MiRNA let-7b promotes the development of hypoxic pulmonary hypertension by targeting ACE2. Am. J. Physiol. Lung Cell Mol. Physiol. 2019, 316, 547–557. [Google Scholar] [CrossRef] [PubMed]
- Matsuyama, S.; Nagata, N.; Shirato, K.; Kawase, M.; Takeda, M.; Taguchi, F. Efficient Activation of the Severe Acute Respiratory Syndrome Coronavirus Spike Protein by the Transmembrane Protease TMPRSS2. J. Virol. 2010, 84, 12658–12664. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chaipan, C.; Kobasa, D.; Bertram, S.; Glowacka, I.; Steffen, I.; Tsegaye, T.S.; Takeda, M.; Bugge, T.H.; Kim, S.; Park, Y.; et al. Proteolytic Activation of the 1918 Influenza Virus Hemagglutinin. J. Virol. 2009, 83, 3200–3211. [Google Scholar] [CrossRef] [Green Version]
- Hoffmann, M.; Kleine-Weber, H.; Schroeder, S.; Krüger, N.; Herrler, T.; Erichsen, S.; Schiergens, T.S.; Herrler, G.; Wu, N.; Nitsche, A.; et al. SARS-CoV-2 Cell Entry Depends on ACE2 and TMPRSS2 and Is Blocked by a Clinically Proven Protease Inhibitor. Cell 2020, 181, 271–280.e8. [Google Scholar] [CrossRef]
- Lucas, J.; True, L.; Hawley, S.; Matsumura, M.; Morrissey, C.; Vessella, R.; Nelson, P.S. The androgen-regulated type II serine protease TMPRSS2 is differentially expressed and mislocalized in prostate adenocarcinoma. J. Pathol. 2008, 215, 118–125. [Google Scholar] [CrossRef]
- Siddappa, M.; White, J.; Wang, H.; Sucheston-Campbell, L.E.; Yates, C.; Campbell, M.J. Abstract B016: MicroRNA drivers of TMPRSS2 fusion-negative prostate cancer in African Americans. Cancer Res. 2018, 78, B016. [Google Scholar]
- Helms, J.; Kremer, S.; Merdji, H.; Clere-Jehl, R.; Schenck, M.; Kummerlen, C.; Collange, O.; Boulay, C.; Fafi-Kremer, S.; Ohana, M.; et al. Neurologic features in severe SARS-COV-2 infection. N. Engl. J. Med. 2020, 382, 2268–2270. [Google Scholar] [CrossRef]
- Rinn, J.L.; Chang, H.Y. Genome regulation by long noncoding RNAs. Annu. Rev. Biochem. 2012, 81, 145–166. [Google Scholar] [CrossRef] [Green Version]
- Bakre, A.A.; Maleki, A.; Tripp, R.A. MicroRNA and Nonsense Transcripts as Putative Viral Evasion Mechanisms. Front. Cell. Infect. Microbiol. 2019, 9, 152. [Google Scholar] [CrossRef]
miRNA | Sequence (5′ to 3′) | |
---|---|---|
1 | hsa-miR-106b-5p | TAAAGTGCTGACAGTGCAGAT |
2 | hsa-miR-130a-3p | CAGTGCAATGTTAAAAGGGCAT |
3 | hsa-miR-141-3p | TAACACTGTCTGGTAAAGATGG |
4 | hsa-miR-148a-3p | TCAGTGCACTACAGAACTTTGT |
5 | hsa-miR-149-5p | TCTGGCTCCGTGTCTTCACTCCC |
6 | hsa-miR-200a-3p | TAACACTGTCTGGTAACGATGT |
7 | hsa-miR-200b-3p | TAATACTGCCTGGTAATGATGA |
8 | hsa-miR-200c-3p | TAATACTGCCGGGTAATGATGGA |
9 | hsa-miR-203a-3p | GTGAAATGTTTAGGACCACTAG |
10 | hsa-miR-300 | TATACAAGGGCAGACTCTCTCT |
11 | hsa-miR-326 | CCTCTGGGCCCTTCCTCCAG |
12 | hsa-miR-329-3p | AACACACCTGGTTAACCTCTTT |
13 | hsa-miR-330-3p | GCAAAGCACACGGCCTGCAGAGA |
14 | hsa-miR-362-3p | AACACACCTATTCAAGGATTCA |
15 | hsa-miR-371a-5p | AAGTGCCGCCATCTTTTGAGTGT |
16 | hsa-miR-376a-3p | AAGTGCCGCCATCTTTTGAGTGT |
17 | hsa-miR-376b-3p | ATCATAGAGGAAAATCCACGT |
18 | hsa-miR-376c-3p | AACATAGAGGAAATTCCACGT |
19 | hsa-miR-381-3p | TATACAAGGGCAAGCTCTCTGT |
20 | hsa-miR-421 | ATCAACAGACATTAATTGGGCGC |
21 | hsa-miR-429 | TAATACTGTCTGGTAAAACCGT |
22 | hsa-miR-494-3p | TGAAACATACACGGGAAACCTC |
23 | hsa-miR-495-3p | AAACAAACATGGTGCACTTCTT |
24 | hsa-miR-511-3p | AATGTGTAGCAAAAGACAGA |
25 | hsa-miR-543 | AAACATTCGCGGTGCACTTCTT |
26 | hsa-miR-548m | CAAAGGTATTTGTGGTTTTTG |
27 | hsa-miR-2113 | ATTTGTGCTTGGCTCTGTCAC |
28 | hsa-miR-3611 | TTGTGAAGAAAGAAATTCTTA |
29 | hsa-miR-3976 | TATAGAGAGCAGGAAGATTAATGT |
30 | hsa-miR-4778-3p | TCTTCTTCCTTTGCAGAGTTGA |
31 | hsa-miR-5197-3p | AAGAAGAGACTGAGTCATCGAAT |
miRNA | Sequence | |
---|---|---|
1 | hsa-let7a-5p | TGAGGTAGTAGGTTGTATAGTT |
2 | hsa-let7b-5p | TGAGGTAGTAGGTTGTGTGGTT |
3 | hsa-let7c-5p | TGAGGTAGTAGGTTGTATGGTT |
4 | hsa-let7d-5p | AGAGGTAGTAGGTTGCATAGTT |
5 | hsa-let7e-5p | TGAGGTAGGAGGTTGTATAGTT |
6 | hsa-let7f-5p | TGAGGTAGTAGATTGTATAGTT |
7 | hsa-let7g-5p | TGAGGTAGTAGTTTGTACAGTT |
8 | hsa-let7i-5p | TGAGGTAGTAGTTTGTGCTGTT |
9 | hsa-miR-7-5p | TGGAAGACTAGTGATTTTGTTGTT |
10 | hsa-miR-25-3p | CATTGCACTTGTCTCGGTCTGA |
11 | hsa-miR-32-5p | TATTGCACATTACTAAGTTGCA |
12 | hsa-miR-92a-3p | TATTGCACTTGTCCCGGCCTGT |
13 | hsa-miR-92b-3p | TATTGCACTCGTCCCGGCCTCC |
14 | hsa-miR-98-3p | CTATACAACTTACTACTTTCCC |
15 | hsa-miR-153-5p | TTGCATAGTCACAAAAGTGATC |
16 | hsa-miR-182-5p | TTTGGCAATGGTAGAACTCACACT |
17 | hsa-miR-183-5p | TATGGCACTGGTAGAATTCACT |
18 | hsa-miR-214-3p | ACAGCAGGCACAGACAGGCAGT |
19 | hsa-miR-363-3p | AATTGCACGGTATCCATCTGTA |
20 | hsa-miR-367-3p | AATTGCACTTTAGCAATGGTGA |
21 | hsa-miR-448 | TTGCATATGTAGGATGTCCCAT |
22 | hsa-miR-494-3p | TGAAACATACACGGGAAACCTC |
23 | hsa-miR-511-3p | AATGTGTAGCAAAAGACAGA |
24 | hsa-miR-4458 | AGAGGTAGGTGTGGAAGAA |
25 | hsa-miR-4500 | TGAGGTAGTAGTTTCTT |
26 | hsa-miR-4778-3p | TCTTCTTCCTTTGCAGAGTTGA |
27 | hsa-miR-4796-5p | TGTCTATACTCTGTCACTTTAC |
28 | hsa-miR-5197-5p | CAATGGCACAAACTCATTCTTGA |
29 | hsa-miR-6864-3p | GTGAGACTTCTCTCCCTTCAG |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mukhopadhyay, D.; Mussa, B.M. Identification of Novel Hypothalamic MicroRNAs as Promising Therapeutics for SARS-CoV-2 by Regulating ACE2 and TMPRSS2 Expression: An In Silico Analysis. Brain Sci. 2020, 10, 666. https://doi.org/10.3390/brainsci10100666
Mukhopadhyay D, Mussa BM. Identification of Novel Hypothalamic MicroRNAs as Promising Therapeutics for SARS-CoV-2 by Regulating ACE2 and TMPRSS2 Expression: An In Silico Analysis. Brain Sciences. 2020; 10(10):666. https://doi.org/10.3390/brainsci10100666
Chicago/Turabian StyleMukhopadhyay, Debasmita, and Bashair M. Mussa. 2020. "Identification of Novel Hypothalamic MicroRNAs as Promising Therapeutics for SARS-CoV-2 by Regulating ACE2 and TMPRSS2 Expression: An In Silico Analysis" Brain Sciences 10, no. 10: 666. https://doi.org/10.3390/brainsci10100666