Next Article in Journal
Model Predictive Control for Gliding Descent on Mars
Previous Article in Journal
Collective Dynamics in the Awakening of Sleeping Beauty Patents: A BERTopic Approach
Previous Article in Special Issue
Morphometrics of the Blue Crab Callinectes sapidus Rathbun, 1896 in a Northern Adriatic Saline Marsh Under Environmental Stress
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Applied Sciences
Volume 15
Issue 19
10.3390/app151910398
applsci-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Seasonal Chemical Composition and Related Gene Expression Profiles in Three Mullet Species, and Their Effect on Nutritional Value

by
Ioannis Georgoulis
1,
Maria V. Alvanou
2,
Ioannis A. Giantsis
2,*,
Antonia Giannouli
3,†,
Theoni Giannichroni
3,†,
Maria Ntousi
3,†,
Xanthippi Douvi
3 and
Konstantinos Feidantsis
3,*
1
Department of Ichthyology and Aquatic Environment, School of Agriculture Sciences, University of Thessaly, Fytokou Str., GR-38445 Volos, Greece
2
Laboratory of Ichthyology & Fisheries, Faculty of Agriculture, Forestry and Natural Environment, Aristotle University of Thessaloniki, GR-54124 Thessaloniki, Greece
3
Department of Fisheries & Aquaculture, School of Agricultural Sciences, University of Patras, GR-26504 Mesolonghi, Greece
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Appl. Sci. 2025, 15(19), 10398; https://doi.org/10.3390/app151910398
Submission received: 27 August 2025 / Revised: 20 September 2025 / Accepted: 24 September 2025 / Published: 25 September 2025
(This article belongs to the Special Issue New Insights into Marine Ecology and Fisheries Science)
Browse Figures
Versions Notes

Abstract

The Mugilidae family comprises several euryhaline species of significant ecological and economic value in global fisheries and aquaculture. Despite close taxonomic relationships, Chelon auratus, Chelon ramada and Mugil cephalus differ notably in physiological traits, seasonal energy allocation and tissue composition, influencing both ecological roles and commercial value. This study investigates the effect of seasonality on the fish flesh quality and metabolic gene expression of these three commercially important mullet species, collected from their natural habitat in Klisova Lagoon, Greece, by analyzing proximate composition (moisture, ash, protein, lipid), hepatosomatic index (HSI) and expression of lipid metabolism genes. M. cephalus showed lower protein and lipid content than C. ramada and C. auratus. In this context, expression of key lipid metabolism genes (fabp, pparg, cpt) reflected these differences not only between species but also revealed patterns which differed between examined tissues and seasons. Notably, this study provides the first characterization of these genes in the species examined. HSI data further indicated species-specific and seasonal strategies for energy storage. The results contribute to refining harvest timing strategies, enhancing post-harvest handling practices, in an effort to promote market differentiation and eventually to improve the economic viability of the mullet fishery sector.

1. Introduction

The Mugilidae family includes several euryhaline species of great ecological and economic importance for both fisheries and aquaculture throughout many regions of the world. They colonize coastal, marine and freshwater habitats in subtropical and temperate zones, including the Mediterranean Sea [1,2,3]. They are a diadromous species, with most adults tolerating a wide range of salinities, living near shore and often entering lagoons, estuaries, rivers and hypersaline environments to feed, seek refuge and complete development and growth before sexual maturation [4]. Particularly in Greek lagoon systems such as Mesolonghi–Aitoliko, one of the largest lagoon systems in the northern Mediterranean coast, they constitute an integral part of traditional fishing practices. Four distinct species of Mugilidae family are the most commonly exploited in the area: Chelon (Liza) saliens (Leaping mullet) (Risso, 1810), Chelon (Liza) auratus (Golden grey mullet) (Risso, 1810), Chelon (Liza) ramada (Thinlip mullet) (Risso, 1827) and Mugil cephalus (Flathead grey mullet) (Linnaeus, 1758). Along with Sparus aurata (Linnaeus, 1758), they represent over 92% of the total annual fishery landings in this region [5].
This percentage is reflected in the fact that seafood consistently enacts a vital role in human nutrition since aquatic edible products usually constitute a cost-effective, high-quality source of protein, composed of essential amino acids, fatty acids, vitamins and minerals [6,7,8]. The chemical composition of fish flesh is a reliable predictor of the fish quality, nutritional value and physiological state [9], and the evaluation of fish components (moisture, protein, fat and ash) is known as fish “proximate composition” [10], which can differ between species. Despite the taxonomic proximity of Mugilidae, each species can significantly differ in their physiological traits, seasonal energy allocation and consequently, muscle chemical composition [8,11,12]. These physiological and energetic differences can influence not only their ecological behaviour but also their nutritional value and commercial potential. Although M. cephalus presents the higher economic value in Greek market among the three examined species of the Mugilidae family, there is no available data referring to the nutritional value of C. auratus, C. ramada and M. cephalus. Consumer preferences and marketing trends of fish are frequently misleading since they are not strictly correlated with nutritional value, chemical composition, or taste; marketing could affect the final price due to historical reasons or the fish’s external appearance [13,14]. Furthermore, seasonality may play an additional role in the chemical composition and affect the above-mentioned parameters in these different fish species [15].
In this context, this study aims to investigate how seasonal variations affect the overall quality of three commercially important mullet species, collected from their natural habitat in Klisova Lagoon, Greece, by examining changes in their proximate composition (moisture, ash, protein and lipid content), hepatosomatic index (HSI) and the expression patterns of genes involved in lipid metabolism. Specifically, it seeks to understand whether fluctuations in environmental conditions and physiological demands across seasons are reflected in tissue quality, and how these relate to the regulation of lipid-related genes involved in lipid metabolism and fatty acid β-oxidation, relevant to fatty acid transport and storage. In this context we chose to analyze the Fatty Acid Binding Protein (fabp) gene, the Peroxisome Proliferator-Activated Receptor-γ (pparg) gene and the Carnitine Palmitoyltransferase (cpt) gene, all of which are related with fatty acid composition. Particularly, fabp is involved in the fatty acids transport and is regulated by pparg expression, whereas cpt enacts a critical role in fatty acid oxidation. It should be noted that all these three genes were characterized for the first time in the three examined species of Mugilidae family. We further hypothesize that seasonal variation leads to species-specific differences in flesh composition and lipid metabolism among the three species, which are reflected both in proximate composition and in the expression of key lipid metabolism genes. This research will provide a comprehensive assessment of fish quality and metabolic status with direct relevance to seasonality in genetically close fish species.

2. Materials and Methods

2.1. Fish Sampling

Fish sampling was carried out using fish nets with the help of local fishermen during the four seasons of the year in Klisova Lagoon, one of the most important wetland areas in Greece, which is part of a larger lagoon–marine complex. Sample collection took place on 2 November 2023, 18 January 2024, 24 April 2024 and 9 July 2024 (Figure 1), according to local fishing practices which align with traditional fisheries techniques. A total of 6 individuals from each sampling season were collected. Immediately after collection, C. auratus, C. ramada and M. cephalus individuals were placed in sea water containing MS-222 to a final concentration of 0.15 g/L for 2–3 min. When fish lost balance, they were considered anesthetized and could be removed from the water without struggling. The fish were then euthanized by spinal cord dissection. Fish were measured and weighed then dissected, and liver, white and red muscle samples and fillets were removed, weighed, frozen in liquid nitrogen, transported to the laboratory and maintained at −80 °C until further analytical processes. Seasonal variation in HSI = [liver weight (g)/total body weight (g)] × 100 was also recorded for all three species. For every biochemical analytical process of this study, tissues from 6 individuals of each sampling (n = 6 fish per group) were used. All animals received proper care in compliance with the “Guidelines for the Care and Use of Laboratory Animals” published by US National Institutes of Health (NIH publication No 85–23, revised in 1996) and the “Principles of laboratory animal care” published by the Greek Government (160/1991) based on EU regulations (86/609). The protocol as well as surgery and sacrifice were approved by the Research Ethics Committee (R.E.C.) of the University of Patras under license number 16825.
Sea water temperature variations were measured in the field using a Multiparameter Water Quality Meter (Model WQC-24, DKK-TOA Corporation, Tokyo, Japan). Parallel to the water temperature, the salinity, the concentration in oxygen and the pH were also recorded at 12 a.m. and 12 p.m. daily in a monthly basis. Figure 1B illustrates the annual cycle of the levels of sea water temperature, dissolved oxygen, salinity and pH. As depicted in Figure 1B, the temperature ranged from 14 to 31 °C, the levels of dissolved oxygen from 8 to 9 mg/L, salinity from 35 to 45 g/L and pH from 8 to 9 throughout the year.

2.2. Chemical Composition Analyses

The proximate composition of fish white and red muscle tissues, as well as fillet, were performed according to the Association of Official Analytical Chemists (AOAC) [16] (n = 6 fish per group). Moisture content in white and red muscle was measured by heating in an oven at 105 °C to constant weight. Protein content in white and red muscle was determined by Kjeldahl analysis (behr Labor-Technik, Flawil, Switzerland) using the value 6.25 as nitrogen-to-protein conversion factor. Ash content in white and red muscle was measured by incineration at 600 °C for 5 h in a muffle furnace (Nabertherm L9/12/C6, Lilienthal, Germany). Ash, moisture and protein contents were specifically measured in red and white muscle tissues to capture possible compositional differences between these muscle types. Red and white muscles are known to differ significantly in metabolic activity and biochemical composition [17]. Total fat in the fillet was extracted by petroleum ether using a Soxhlet apparatus (Sox-416 Macro, Gerhard, Germany). Fat content was determined in the whole fillet based on the importance of lipid deposition patterns in assessing the nutritional and commercial value of the fillet as a whole, which is often consumed in its entirety by consumers.

2.3. RNA Extraction and cDNA Synthesis

Total RNA in the liver and the white muscle (n = 6 fish per group) was isolated utilizing the NucleoZOL reagent (Macherey-Nagel, Düren, Germany, Cat: 740404.200) following the manufacturer’s instructions. For every pool, 50 mg of tissue was homogenized using a pestle in 500 µL of NucleoZOL, and RNAase-free water was subsequently added to the lysate. Following homogenization, the lysates were centrifuged, and RNA was precipitated by the addition of isopropanol. After a further centrifugation step, the RNA pellets were washed twice with ethanol. The final RNA pellets were resuspended in 100 µL of nuclease-free water. All extracted RNA samples were stored at −80 °C until cDNA synthesis. Prior to reverse transcription (RT), the RNA concentration and purity were assessed using a Quawell UV-Vis 5000 spectrophotometer (Quawell Technology, San Jose, CA, USA). cDNA synthesis was carried out with the PrimeScript kit (Takara, Shiga, Japan, Cat: RR014B), using approximately 500 ng of RNA per reaction, strictly adhering to the manufacturer’s protocol. After synthesis, the cDNA quantity and quality were again measured with the Quawell UV-Vis 5000 spectrophotometer. The cDNA samples were then normalized to equal concentrations (50 ng/µL) and stored at −20 °C until use in quantitative PCR (qPCR) experiments.

2.4. Primer Design for Gene Characterization

For gene expression analysis of the fabp, pparg and cpt genes in mullet species, degenerated primer sets were designed according to fabp, pparg and cpt sequences obtained from NCBI, respectively. Specifically, the sequences with GenBank accession numbers XM_047604934, KY484087, MF034870, OL830097, XM_038725022 were utilized for fabp primer set degeneration. The above accession numbers correspond to M. cephalus, Pagrus major (Temminck & Schlegel, 1843), Trachinotus ovatus (Linnaeus, 1758), Dicentrarchus labrax (Linnaeus, 1758) and Micropterus salmoides (Cuvier, 1828), respectively. The sequences with GenBank accession numbers AH015349, OP352269, KM052849, MH716033, XM_047583091 were utilized for pparg primer set degeneration. More specifically, the above accession numbers correspond to D. labrax, Platax teira (Forsskål, 1775), Epinephelus coioides (Hamilton, 1822), Mugil incilis (Hancock, 1830) and M. cephalus, respectively. Finally, for cpt primers the sequences GenBank accession numbers XM_047586465, OY741295, AP029387, LR537131, XM_038291722, XM_038716807 that correspond to M. cephalus, Chelon labrosus (A. Risso, 1827), P. major, S. aurata, Cyprinodon tularosa (R.R. Miller & A.A. Echelle, 1975) and Micropterus salmoides (Lacepède, 1802), respectively. Sequences were aligned using the MUSCLE algorithm implemented in the MEGAX software (version X). Conserved regions identified through this alignment were selected as targets for primer design using Primer3 software (Primer3_masker, Tartu, Estonia) (version GPL-3.0). These newly designed primer sets were then evaluated through conventional PCR and afterwards tested in 3 samples to estimate primer efficiency in real time PCR (details in Section 2.6) that was in all cases greater than 97 and lower than 103%.

2.5. Conventional PCR and Sequencing

One microliter of the reverse transcription (RT) product served as the cDNA template for amplification in conventional PCR, which was performed using with the FastGene Taq 2X Ready Mix (NIPPON Genetics, Düren, Germany, Cat: LS27) and the newly designed primer pairs (Table 1). The PCR protocol involved an initial denaturation at 95 °C for 3 min, followed by 35 cycles consisting of 30 s at 92 °C for denaturation, 40 s at melting temperature (Tm) for annealing and 40 s at 72 °C for extension. A final extension was carried out at 72 °C for 5 min. Each 20 µL PCR reaction contained 0.6 µL of each primer (10 µM concentration), 10 µL of FastGene Taq 2X Ready Mix and 1 µL of cDNA (50 ng/µL), with ultrapure water added to reach the final volume. After amplification, products were resolved on a 2% agarose gel by electrophoresis at 100 V for 20 min. Purification of the PCR products was conducted using the NucleoSpin Gel and PCR Clean-up Kit (Macherey-Nagel, Düren, Germany, Cat: 740609.50), and the purified products were subsequently sequenced in both directions using the Sanger method. Sequencing confirmed that the amplified fragments corresponded to the targeted gene regions.

2.6. Gene Expression Analysis

Expression levels of targeted genes and actin genes in the liver and the white muscle were measured via quantitative real-time PCR (qPCR) (n = 6 fish per group). Relative quantification of gene expression was performed using the comparative CT method (2−ΔΔCT), as described by Livak and Schmittgen [19]. Gene expression was normalized against actin as the reference gene. The levels of mRNA of actin traditionally used in salinity-based studies of gene expression in fish and are relatively constant in the different tissues of mullet species [20,21]. Real-time PCR assays were executed using a Thermocycler Eco 48 Real-Time PCR System (Illumina) with an average ramp rate of 5.5 °C/s and the KAPA SYBR® FAST qPCR Master Mix (Kapabiosystems, Cape Town, South Africa, Cat: KK5601). Reactions were prepared in a total volume of 10 µL, containing 10 ng of cDNA, 5 µL of 2X KAPA SYBR® FAST qPCR Master Mix, 2 µM of each primer (Table 1) and PCR-grade water. The thermal cycling conditions included an initial denaturation at 95 °C for 15 s, followed by 40 amplification cycles with denaturation at 95 °C for 15 s, annealing at 55 °C for 20 s and extension at 72 °C for 20 s. Fluorescence readings were taken at 55 °C to quantify the amplified products.

2.7. Statistical Analysis

General linear mixed model and repeated measures mixed-model ANOVA (GLM) (independent variables: season and species) (GraphPad Prism, version 5.0) as well as one-way ANOVA (GraphPad Instat, version 3.0) were performed to detect significant differences at 5% probability level (p < 0.05). Principal components analysis (PCA) was conducted using the FactoMineR package in R [22] (The R Project for Statistical Computing, version 4.3.2) in order to determine patterns of correlated variables.

3. Results

3.1. Fish Morphometric Parameters

Table 2 depicts fish weight and total length during the seasonal samplings. M. cephalus exhibited its highest measured weight and length in July when the highest sea water temperature was recorded, while both C. ramada and C. auratus depicted the highest values in January when the lowest sea water temperature was recorded. Among the three examined fish species, M. cephalus exhibited the highest weight and length compared to the other two species.

3.2. Proximate Composition

Figure 2 depicts seasonal variations in total fat in the three examined fish species. As shown in Figure 2, total fat content in C. auratus fillet was the highest throughout the year. More specifically, the fat content of C. auratus increased from January to July, showing a decrease from November to January. C. ramada fillet exhibited a significantly higher total fat content during November, which later decreased. M. cephalus fillet exhibited the highest fat content in January, which thereafter decreased in April, and slightly increased again in July. It should be highlighted that the fat content of M. cephalus remained at significantly lower levels compared to the other two species during November and April.
Figure 3 depicts seasonal variations in protein, ash and moisture content in the three examined fish species.
M. cephalus depicted the lowest protein content during November in white muscle and from April to November in red muscle, compared to C. auratus and C. ramada. The white muscle of C. auratus and C. ramada exhibited no differences in protein content during November and July, while it peaked during January and April in C. ramada (Figure 3A). On the other hand, C. auratus showed the lowest protein contents in white muscle during January and April, compared with the other two species. The red muscle exhibited similar protein contents between C. auratus and C. ramada during November and April, with the first depicting higher values during January, and the second during July (Figure 3B).
Ash content showed no significant differences between the three species in the white muscle throughout the year; nevertheless, it exhibited a seasonal increase from November to July (Figure 3C). A similar pattern with no differences between species was also observed in the red muscle, except from January and July, where C. auratus and M. cephalus exhibited the lower protein content, respectively. The same seasonal pattern was also depicted in red muscle (Figure 3D).
Moisture content in both white and red muscle varied significantly among species and across seasons (Figure 3E,F). In the white muscle, M. cephalus exhibited significantly higher moisture levels in November and January and then decreased, reaching the lowest levels during April and July. On the contrary, moisture levels in the in white muscle of C. ramada did not change in the samplings of November, January and April, but increased in July. C. auratus exhibited significantly higher moisture levels in January (Figure 3E). Across all species, the red muscle exhibited greater seasonal fluctuations compared to the white muscle. More specifically, all species exhibited their highest values in January, with C. auratus depicting the highest levels compared to M. cephalus and C. ramada, and the lowest values during November (Figure 3F).
Figure 4 depicts seasonal variations in HSI levels in the three examined fish species. As shown in Figure 4, across all sampling months, M. cephalus exhibited the highest HSI values during July (2.6 ± 0.3), significantly surpassing C. ramada and C. auratus. C. ramada also showed a summer increase, though to a lesser extent (2.1 ± 0.4), while C. auratus peaked its HSI values in November (1.8 ± 0.4) and April (1.8 ± 0.7) and displayed the lowest index later in January (0.4 ± 0.1).

3.3. Gene Expression

The gene sequences employed in the present study were designed by our research team, submitted to Genbank and given the accession numbers as depicted in Table 3.
Figure 5 depicts seasonal variations in protein, ash and moisture content in the three examined fish species.
In the liver of C. ramada, fabp gene expression exhibited distinct seasonal peaks, with the highest levels observed in November and April, while C. auratus showed a sharp increase in July. In contrast, M. cephalus maintained relatively stable fabp expression levels across all seasons (Figure 5A). In the white muscle, C. auratus displayed a significant peak in fabp gene expression in November, while C. ramada reached its highest levels in July. M. cephalus demonstrated consistently low levels of fabp expression, with a slight increase noted during July (Figure 5B).
In the liver of C. ramada, pparg gene expression levels peaked in November, and thereafter these levels decreased and remained moderate throughout the seasonal samplings. M. cephalus showed an increase in July, while C. auratus maintained its pparg gene expression levels which were generally low but slightly elevated in January (Figure 5C). In the white muscle, C. ramada showed a strong seasonal trend, with a sharp peak in pparg gene expression levels in July. C. auratus displayed high pparg gene expression levels mostly in July and November, while M. cephalus depicted slight but steady increases from April to November (Figure 5D).
Gene expression analysis of cpt revealed that in the liver, M. cephalus exhibited a peak in January which was set as a baseline value. C. ramada and C. auratus showed relatively moderate expression profiles, with a slight increase in July for the first, and in April and July for the second (Figure 5E). In the white muscle, cpt gene expression levels showed a peak for M. cephalus in January and for C. auratus in January and July. On the contrary, in C. ramada, cpt gene expression levels exhibited moderate increase in November and January, and thereafter these levels decreased in April and July (Figure 5F).

3.4. Multivariate Analysis

Figure 6 depicts PCA which revealed distinct seasonal clusters for the combined proximate and biochemical parameters of each species, as follows.
M. cephalus: fabp mRNA L, cpt mRNA WM, cpt mRNA L, protein RM and moisture RM were positively correlated with PC1, while fabp mRNA WM, pparg mRNA WM, length and weight were negatively correlated with PC1, representing increased gene expression. pparg mRNA L, protein WM, ash WM, ash RM, fat and HSI were positively correlated with PC2, while moisture WM was negatively correlated with PC2, representing overall macronutrients. 34.33% of the variance was attributed to PC1, while 31.55% was attributed to PC2. Cumulatively, PC1 and PC2 explain 65.88% of the total variance in the dataset (Figure 6).
C. ramada: fabp mRNA WM, pparg mRNA WM, cpt mRNA L, ash WM, ash RM, moisture WM, moisture RM and HSI were positively correlated with PC1, and cpt mRNA WM, protein WM and fat were negatively correlated with PC1, representing increased gene expression as well as macronutrients and lipid reserves. fabp mRNA L, pparg mRNA L were positively correlated with PC2, and protein RM, length and weight were negatively correlated with PC2, mainly representing gene expression in the liver. 36.78% of the variance was attributed to PC1, while 32.11% was attributed to PC2. Cumulatively, PC1 and PC2 explain 68.89% of the total variance in the dataset (Figure 6).
C. auratus: cpt mRNA WM, pparg mRNA L, moisture WM, moisture RM, length and weight were positively correlated with PC1, and fabp mRNA WM, pparg mRNA WM, protein WM, protein RM and HSI were negatively correlated with PC1, representing increased gene expression as well as macronutrients including lipid reserves. fabp mRNA L, cpt mRNA L, ash WM, ash RM and fat were positively correlated with PC2, representing increased hepatic gene expression, micronutrients and fat. Overall, 36.78% of the variance was attributed to PC1, while 33.48% was attributed to PC2. Cumulatively, PC1 and PC2 explain 70.26% of the total variance in the dataset (Figure 6).

4. Discussion

Although the nutritional value of fish is reasonably expected to influence their market price [23] in theory, this is not always proven true in practice. The market value reflects a blend of biological, cultural and economic factors—not solely proximate composition. Thus, M. cephalus’ higher market price is not governed solely by its protein or lipid content, but by tradition, consumer preference, roe value, larger size and availability—factors that may outweigh nutritional aspects in determining real-world economic value. According to our results, regarding the three examined Mugilidae members collected from their natural habitat in Klisova Lagoon, Greece, total lipids and protein content of the highest economically valued M. cephalus were significantly lower. Physiologically, this could be attributed to lipid metabolism based on the expression of related genes, which are presented in detail below.

4.1. Seasonal Proximate Composition

Fat, an important fish component, is a major source of metabolic energy and is involved in several functions, such the formation of cell and tissue membranes [8]. Most fats are located in the subcutaneous tissues, liver, muscle, mesenteric tissue, belly flap and head [24], and the fat quantity in fish bodies is considered a good index of future survival [25] and a strong indicator of reproductive potential [26].
In the present study, the total fat content exhibited significant seasonal and interspecific variations. Specifically, C. auratus consistently exhibited the highest lipid levels, varying starting at 10% and reaching values close to 20%, especially during July, likely due to its metabolic strategies adapted for reproductive cycles and environmental conditions, a fact which is in line with the increased HSI in the following months. HSI is often related to metabolic activity, dietary lipids, energetic reserves and vitellogenesis during the reproductive cycle in fish [27,28,29,30]. Indeed, C. auratus’ HSI peaked later during autumn (November), followed by a marked decline, potentially reflecting the mobilization of hepatic lipid reserves toward gonadal maturation, reflecting a reproductive strategy that prioritizes lipid accumulation during these months, a trend that is also observed in other mullet populations [31]. On the contrary, C. ramada and M. cephalus exhibited lower fat content, with the latter presenting the lowest in all seasons [32]. Similarly to C. auratus, C. ramada also increased its HSI primarily during January and July, following its fat accumulation in preceding months (November and April). However, this pattern is not followed by M. cephalus, which exhibited the highest HSI levels in summer (July), suggesting metabolic changes, probably related to preparation for reproductive development and seasonal metabolic shifts [33,34]. The overall HSI patterns observed between species correspond fully with differences in fat content, supporting HSI as a proxy for hepatic lipid storage, overall nutritional status and energy allocation strategies related to reproduction and physiological and environmental conditions. More specifically, C. auratus had a major spawning period between August and November [35], M. cephalus had a breeding season extending from July to October [36] and C. ramada spawning took place between September and January [37]. Therefore, HSI can serve as a practical and informative index for assessing fish condition and its energy allocation strategies that are closely tied to seasonal cycles of reproduction and environmental change. Furthermore, HSI indirectly affects fillet quality by altering lipid content and composition. In this context, it should also be highlighted that fish species sharing the same habitat can exhibit differential seasonal growth patterns largely due to variations in environmental factors, their thermal preferences and metabolic efficiency at different temperatures, but also due to reproductive periods which can divert energy from somatic growth to gonad development, leading to seasonal fluctuations in body condition and weight-length relationships [38,39]. The present results seem to go hand-in-hand with the above well-established knowledge. However, the effect of population dynamics on the body weight and length of wild fish species should not be neglected [40].
Categorizing the three species according to Ackman [41], C. auratus can be characterized as a high fat (>8% fat) fish, C. ramada as a medium fat (4–8% fat) fish and M. cephalus as a low fat (2–4% fat) fish. Fat content is a key determinant of fish quality and market value, especially for consumers interested in nutritional aspects. Omega-3 fatty acid intake and long-chain n-3 polyunsaturated fatty acids (n-3 PUFA) are important nutritional considerations. Among these, eicosapentaenoic acid (EPA, 20:5 n-3) and docosahexaenoic acid (DHA, 22:6 n-3) are particularly significant to human health [8]. Fish with higher lipid content, like C. auratus, are considered valuable for their richer fatty acid profile. However, higher fat levels may also be associated with a shorter shelf life due to increased lipid susceptibility, requiring appropriate storage and handling [42]. Therefore, understanding the seasonal fat dynamics is crucial not only for fishery management but also for processing and marketing strategies aimed at maximizing product quality and consumer satisfaction.
Apart from polyunsaturated fatty acids, seafood contains high levels of essential amino acids necessary for human nutrition [43,44]. These nutrients are recruited for the maintenance of metabolic activities, organs and tissues repairing and regulation of homeostasis [45]. Similarly to other fish species, protein content in the three examined Mugilidae members is between 15% and 25% [46]. In the present study, M. cephalus and C. ramada exhibited a lower protein content during summer and autumn, a fact that aligns with previous observations [12], and can be attributed to the sensitivity of some amino acids to high temperatures and low pH [47]. However, C. auratus exhibited its lowest protein content mostly in winter, similar to its fat content and its HSI. The latter reveals a lower metabolic activity during this period, compared to M. cephalus and C. ramada. These interspecific differences may be attributed to variations in metabolic rates, feeding strategy, or breeding capabilities [48]. Although M. cephalus demonstrated the lowest protein content among the three examined species, it is considered an excellent food source in terms of protein quality for human nutrition as indicated by the Digestible Indispensable Amino Acid Score (DIAAS) [47,49], meeting thresholds for essential amino acid provision. Nevertheless, future studies could provide direct quantification of DIAAS in these populations to validate these assumptions and permit more detailed critique of and interspecies differences. However, from a commercial perspective, C. auratus and C. ramada may appeal more to health-conscious consumers or industries requiring high protein.
Another vital component in establishing the fish nutritional profile is the ash content in fish muscle, which reflects the total mineral composition [10,50,51]. All three species examined in the present study exhibited relatively stable but slightly varied ash levels across seasons. The highest levels were depicted in July, indicating dietary changes, reproductive status, or environmental factors influencing mineral accumulation. According to Rahman et al. [52], different factors such as diet, species, environmental temperature, seasonality and salinity may affect mineral concentration. The consistently higher ash levels in the white muscle may be attributed to its relatively lower metabolic rate and different protein turnover relative to the red muscle, which is more involved in sustained swimming activity and oxidative metabolism, and thus it may allocate fewer resources to mineral deposition, especially under variable seasonal conditions. Besides their nutritional and physiological functions, minerals are essential components of fish muscle composition [53]. The total mineral content in wet fish muscle generally ranges from 0.6% to 1.5% of total fish body weight [8], making the three species prime candidates for nutrition regarding mineral consumption.
The moisture of fish muscle, as a direct influence on texture, freshness and shelf life, is another critical quality parameter [54], and is inversely proportional to protein, energy and fat levels [55,56]. The higher moisture levels in the white muscle compared to the red muscle across all three species and the seasons of the present study aligns with previous observations indicating that white muscle, with lower lipid and protein content, retains more water than red muscle, which is metabolically more active and has a higher fat content [57]. Among the species studied, C. auratus generally displayed higher moisture levels in both muscle types, particularly in January and April, suggesting possible physiological or ecological adaptations influencing water retention. Seasonal fluctuations in moisture content were also observed, with notably higher moisture levels in winter (January) across most species and muscle types. This may be associated with variations in water temperature, feeding activity and reproductive cycles, which can affect body composition and hydration status. These seasonal dynamics are essential when evaluating fish for market quality or processing suitability, as higher moisture can enhance juiciness and perceived freshness, but may also decrease shelf life, making fish more susceptible to microbial spoilage and oxidative degradation of polyunsaturated fatty acids [56,58], which can lead to faster quality deterioration, unpleasant off-flavours and reduced nutritional value.

4.2. Seasonal Gene Regulation of Lipid Metabolism

Fabp, ppar and cpt1 expression profiles provide further insights into lipid metabolism across species and seasons, complementing the observed biochemical patterns. FABPs possess a key role in intracellular fatty acid transport and storage, membrane synthesis, oxidation, and lipid-mediated transcriptional regulation metabolism [59]. Higher fabp relative mRNA levels in C. ramada during November and April and in C. auratus during April and July in the liver and during November and July in the white muscle, suggest an active role in lipid mobilization, likely supporting energy requirements for seasonal physiological processes such as growth or preparation for reproduction, as indicated by the elevated HSI levels in the following month. On the other hand, M. cephalus maintained relatively low fabp mRNA expression levels in both tissues across all seasons, consistent with its lower fat content and HSI, indicating a more conservative lipid management strategy. The similar seasonal pattern of pparg expression, a regulator of adipogenesis and lipid metabolism [60] in all three examined species suggests that both fabp and pparg play a central role in regulating seasonal fat storage, particularly in C. auratus and C. ramada, a fact which reinforces the relationship between transcriptional regulation and observed physiological and biochemical changes.
The expression levels of cpt1, a gene central to energy homeostasis in the context of mitochondrial fatty acid β-oxidation [61], also varied markedly between species, tissues and seasons. M. cephalus cpt1 relative mRNA levels displayed a peak in January, which was significantly higher compared to C. ramada and C. auratus, suggesting intensified hepatic lipid catabolism during winter, potentially reflecting increased energy mobilization [62]. The latter aligns with M. cephalus lower fat content during colder months, indicating a reliance on β-oxidation for energy production during colder months, in contrast to the other two species, which appear to favour storage over catabolism.

4.3. Study Limitations

(1) Sampling from a single lagoon limits broad ecological generalization; (2) sample size per species/season (n = 6 fish per group) is modest for some analyses; (3) lack of direct gonadal state or feeding ecology data to fully enlighten seasonal shifts, and (4) not all genes implicated in the lipid metabolism network were studied.

5. Conclusions

M. cephalus, C. ramada and C. auratus displayed clear species- and season-specific differences in their physiological profiles (as also indicated by the PCA), reflecting distinct metabolic strategies. Among them, C. auratus recorded the highest fat content, an elevated HSI, and lipogenic genes (fabp and pparg) upregulation throughout the year, suggesting active lipid deposition. Meanwhile, C. ramada’s moderate lipid levels and flexible seasonal fabp and pparg expression, indicate a capacity for dynamic lipid handling. In contrast, M. cephalus consistently demonstrated a lower fat content but higher cpt1 expression—especially in winter—pointing to a more oxidative phenotype that favours lipid catabolism over storage. Protein and ash content (an indicator of total mineral load), a key nutritional component influencing consumer perception and dietary value, remained relatively stable across seasons but varied slightly among species, with C. ramada and C. auratus confirming their characterization as protein-rich species. The present results hold direct implications for market value and consumer preference: C. auratus, with its high fat, protein and mineral content during summer, may be preferred for rich-flavoured, high-energy products; C. ramada offers a balanced profile that could suit versatile processing and year-round availability; and M. cephalus, with its lean muscle and elevated protein-to-fat ratio, may appeal in markets promoting lean, high-protein diets. Understanding these seasonal and species-specific traits not only aids in optimizing harvest timing and post-harvest handling but also enhances species-specific branding and economic potential in the mullet fishery sector. While the present findings—such as metabolic adaptation, nutrient composition and gene expression—are mainly relevant to sustainable exploitation and valorization of lagoon-based fishery resources, aspects of the present study may provide broader reference data for future research or nutritional profiling in aquaculture contexts and practical applications in farmed fish species.

Author Contributions

Conceptualization, I.A.G. and K.F.; methodology, I.G., M.V.A., A.G., T.G., M.N., X.D. and K.F.; software, I.G., M.V.A. and K.F.; validation, I.G., M.V.A., I.A.G. and K.F.; formal analysis, I.G., M.V.A., I.A.G. and K.F.; investigation, I.G., M.V.A., I.A.G. and K.F.; resources, K.F.; data curation I.G., M.V.A. and K.F.; writing—original draft preparation, I.G., M.V.A.; writing—review and editing, I.G., M.V.A., I.A.G., A.G., T.G., M.N., X.D. and K.F.; visualization, K.F.; supervision, K.F.; project administration, K.F.; funding acquisition, K.F. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

All animals received proper care in compliance with the “Guidelines for the Care and Use of Laboratory Animals” published by US National Institutes of Health (NIH publication No 85–23, revised in 1996) and the “Principles of laboratory animal care” published by the Greek Government (160/1991) based on EU regulations (86/609). The protocol as well as surgery and sacrifice were approved by the Research Ethics Committee (R.E.C.) of the University of Patras under the licence number 16825.

Data Availability Statement

The data presented in this study are openly available in Genbank database, accession numbers PV242891, PV242890, PV242889, PV242486, PV240344, PV240343, PV240341, PV240342 and PV242484.

Conflicts of Interest

The authors declare no conflicts of interest.

Abbreviations

The following abbreviations are used in this manuscript:
HSIHepatosomatic Index
TmMelting Temperature
RTReverse Transcription
DIAASDigestible Indispensable Amino Acid Score

References

  1. Crosetti, D. Current state of grey mullet fisheries and culture. In Biology, Ecology and Culture of Grey Mullets (Mugilidae); Crosetti, D., Blaber, S.J.M., Eds.; CRC: Boca Raton, FL, USA, 2016; pp. 398–450. ISBN 9780429174759. [Google Scholar]
  2. Crosetti, D.; Blaber, S.J.M. Biology, Ecology and Culture of Grey Mullets (Mugilidae); CRC: Boca Raton, FL, USA, 2016. [Google Scholar] [CrossRef]
  3. Whitfield, A.K.; Durand, J.D. An Overview of Grey Mullet (Mugilidae) Global Occurrence and Species-Rich Ecoregions, with Indications of Possible Past Dispersal Routes within the Family. J. Fish Biol. 2023, 103, 202–219. [Google Scholar] [CrossRef]
  4. González-Castro, M.; Minos, G. Sexuality and Reproduction of Mugilidae. In Biology, Ecology and Culture of Grey Mullets (Mugilidae); Crosetti, D., Blaber, S.J.M., Eds.; CRC Press: Boca Raton, FL, USA, 2016; pp. 227–263. ISBN 9780429174759. [Google Scholar]
  5. Katselis, G.; Koutsikopoulos, C.; Dimitriou, E.; Rogdakis, Y. Spatial Patterns and Temporal Trends in the Fisheries Landings of the Messolonghi–Etoliko Lagoons (Western Greek Coast). Sci. Mar. 2003, 67, 501–511. [Google Scholar] [CrossRef]
  6. Sahena, F.; Zaidul, I.S.M.; Jinap, S.; Saari, N.; Jahurul, H.A.; Abbas, K.A.; Norulaini, N.A. PUFAs in fish: Extraction, fractionation, importance in health. Compr. Rev. Food Sci. Food Saf. 2009, 8, 59–74. [Google Scholar] [CrossRef]
  7. Bezbaruah, G.; Deka, D.D. Variation of moisture and protein content in the muscle of three catfishes: A comparative study. Int. J. Fish. Aquat. Stud. 2021, 9, 223–226. [Google Scholar] [CrossRef]
  8. Ahmed, I.; Jan, K.; Fatma, S.; Dawood, M.A.O. Muscle proximate composition of various food fish species and their nutritional significance: A review. J. Anim. Physiol. Anim. Nutr. 2022, 106, 690–719. [Google Scholar] [CrossRef]
  9. Ravichandran, S.; Kumaravel, K.; Florence, E.P. Nutritive composition of some edible fin fishes. Int. J. Zool. Res. 2011, 7, 241–251. [Google Scholar] [CrossRef]
  10. Rani, P.S.C.H.P.D.; Kumar, P.V.; Rao, K.R.; Shameem, U. Seasonal variation of proximate composition of tuna fishes from Visakhapatnam fishing harbor, East coast of India. Int. J. Fish. Aquat. Stud. 2016, 4, 308–313. [Google Scholar]
  11. Quirós-Pozo, R.; Moyano, F.J.; Bainour, K.; Ramírez-Bolaños, S.; Ventura-Castellano, A.; Roo, J.; Robaina, L. Evaluation of the Effects of Two Different Feeding Frequencies on the Digestive Biochemistry of Two Mullet Species (Chelon labrosus and Liza aurata). Animals 2023, 13, 287. [Google Scholar] [CrossRef]
  12. Çankırılıgil, E.C.; Altuntaş, A. Chemical Composition of Two Grey Mullet Species (Chelon auratus, Mugil cephalus): A Comparative Study on Wild and Aquaculture-Adapted Species. Çanakkale Onsekiz Mart Univ. J. Mar. Sci. Fish. 2024, 7, 52–66. [Google Scholar] [CrossRef]
  13. Makri, V.; Feidantsis, K.; Papadopoulos, D.; Lattos, A.; Georgoulis, I.; Michaelidis, B.; Giantsis, I.A. Natural-like pigmentation in cultured fish stocks, not only a matter of nutrition. A review of Salmonidae and Sparidae families, with a particular focus on the red porgy Pagrus pagrus. Aquac. Res. 2021, 52, 2942–2953. [Google Scholar] [CrossRef]
  14. Giantsis, I.A.; Tokamani, M.; Triantaphyllidis, G.; Tzatzani, S.; Chatzinikolaou, E.; Toros, A.; Bouchorikou, A.; Chatzoglou, E.; Miliou, H.; Sarantopoulou, J.; et al. Development of multiplex PCR and melt–curve analysis for the molecular identification of four species of the mullidae family, available in the market. Genes 2023, 14, 960. [Google Scholar] [CrossRef]
  15. Tarricone, S.; Caputi Jambrenghi, A.; Cagnetta, P.; Ragni, M. Wild and farmed sea bass (Dicentrarchus labrax): Comparison of biometry traits, chemical and fatty acid composition of fillets. Fishes 2022, 7, 45. [Google Scholar] [CrossRef]
  16. AOAC (Association of Official Analytical Chemists). Official Methods of Analysis; Association of Official Analytical Chemists: Washington, DC, USA, 2005. [Google Scholar]
  17. Jabarsyah, A.; Tsuchimoto, M.; Yada, O.; Kozuru, Y.; Miyake, T.; Misima, T.; Wang, Q.; Tachibana, K. Comparison of biochemical and physiological characteristics among white, pink, and red muscle fibers in carp (cultured). Fish. Sci. 2000, 66, 586–593. [Google Scholar] [CrossRef]
  18. Abdel-Mageid, A.D.; Zaki, A.G.; El Senosi, Y.A.; Fahmy, H.A.; El Asely, A.M.; Abo-Al-Ela, H.G.; El-Kassas, S. Modulatory effect of lipopolysaccharide on immune-related gene expression and serum protein fractionation in grey mullet, Mugil cephalus. Aquac. Res. 2020, 51, 1643–1652. [Google Scholar] [CrossRef]
  19. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
  20. Nocillado, J.N.; Levavi-Sivan, B.; Carrick, F.; Elizur, A. Temporal expression of G-protein-coupled receptor 54 (GPR54), gonadotropinreleasing hormones (Gnrh), and dopamine receptor D2 (Drd2) in pubertal female grey mullet, M. cephalus. Gen. Comp. Endocrinol. 2007, 150, 278–287. [Google Scholar] [CrossRef]
  21. Tine, M.; de Lorgeril, J.; D’Cotta, H.; Pepey, E.; Bonhomme, F.; Baroiller, J.F.; Durand, J.D. Transcriptional responses of the black-chinned tilapia Sarotherodon melanotheron to salinity extremes. Mar. Genom. 2008, 1, 37–46. [Google Scholar] [CrossRef]
  22. Lê, S.; Josse, J.; Husson, F. FactoMineR: An R package for multivariate analysis. J. Stat. Softw. 2008, 25, 1–18. [Google Scholar] [CrossRef]
  23. Ali, A.; Wei, S.; Ali, A.; Khan, I.; Sun, Q.; Xia, Q.; Wang, Z.; Han, Z.; Liu, Y.; Liu, S. Research progress on nutritional value, preservation and processing of fish—A review. Foods 2022, 11, 3669. [Google Scholar] [CrossRef]
  24. Moradi, Y.; Bakar, J.; Motalebi, A.A.; Syed Muhamad, S.H.; Che Man, Y. A review on fish lipid: Composition and changes during cooking methods. J. Aquat. Food Prod. Technol. 2011, 20, 379–390. [Google Scholar] [CrossRef]
  25. Simpkins, D.G.; Hubert, W.A.; Del Rio, C.M.; Rule, D.C. Physiological responses of juvenile rainbow trout to fasting and swimming activity: Effects on body composition and condition indices. Trans. Am. Fish. Soc. 2003, 132, 576–589. [Google Scholar] [CrossRef]
  26. Mejri, S.C.; Tremblay, R.; Audet, C.; Wills, P.S.; Riche, M. Essential fatty acid requirements in tropical and cold-water marine fish larvae and juveniles. Front. Mar. Sci. 2021, 8, 680003. [Google Scholar] [CrossRef]
  27. Skjæraasen, J.E.; Nash, R.D.M.; Kennedy, J.; Thorsen, A.; Nilsen, T.; Kjesbu, O.S. Liver energy, atresia and oocyte stage influence fecundity regulation in Northeast Arctic cod. Mar. Ecol. Prog. Ser. 2010, 404, 173–183. [Google Scholar] [CrossRef]
  28. Hismayasari, B.I.; Marhendra, A.P.W.; Rahayu, S.; Saidin Supriyadi, D.S. Gonadosomatic index (GSI), Hepatosomatic index (HSI) and proportion of oocytes stadia as an indicator of rainbowfish Melanotaenia boesemani spawning season. Int. J. Fish. Aquat. Stud. 2015, 2, 359–362. [Google Scholar]
  29. Nunes, C.; Silva, A.; Soares, E. The use of hepatic and somatic indices and histological information to characterize the reproductive dynamics of Atlantic sardine Sardina pilchardus from the Portuguese coast. Mar. Coast. Fish. 2011, 3, 127–144. [Google Scholar] [CrossRef]
  30. Tarricone, S.; Ragni, M.; Carbonara, C.; Giannico, F.; Bozzo, F.; Petrontino, A.; Caputi Jambrenghi, A.; Colonna, M.A. Growth Performance and Flesh Quality of Sea Bass (Dicentrarchus labrax) Fed with Diets Containing Olive Oil in Partial Replacement of Fish Oil—With or Without Supplementation with Rosmarinus officinalis L. Essential Oil. Animals 2024, 14, 3237. [Google Scholar] [CrossRef]
  31. Ramadan, A.M.; El-Halfawy, M.M.; Mahmoud, W.F. Reproductive biology and histological studies of the grey mullet, Liza ramada (Risso, 1826) in Lake Timsah, Suez Canal. Egypt. J. Aquat. Res. 2007, 33, 434–454. [Google Scholar]
  32. Mohanty, B.P. Nutritional value of food fish. Conspec. Inland Fish. Manag. 2015, 4, 15–21. [Google Scholar]
  33. Barr, E.E.; Cabello, M.G.; Gomez, M.P.; Boa, A.G. Reproduction of Mugil cephalus (Percoidei: Mugilidae) off the Central Mexican Pacific Coast. Fish. Aquac. J. 2016, 7, age1. [Google Scholar] [CrossRef]
  34. Pham, H.Q.; Nguyen, A.V. Seasonal changes in hepatosomatic index, gonadosomatic index and plasma estradiol-17β level in captively reared female rabbit fish (Siganus guttatus). Aquac. Res. 2019, 50, 2191–2199. [Google Scholar] [CrossRef]
  35. Kesiktaş, M.; Yemişken, E.; Yildiz, T.; Eryilmaz, L. Age, growth and reproduction of the golden grey mullet, Chelon auratus (Risso, 1810) in the Golden Horn Estuary, Istanbul. JMBA 2020, 100, 989–995. [Google Scholar] [CrossRef]
  36. Ibrahem, A.; Elwani, M.; El-Mor, M.; Soliman, A. Some aspects of the reproductive physiology of the Flathead grey mullet Mugil cephalus (Linnaeus, 1758) in Benghazi coast, eastern—Libya. Int. J. Bioassays 2016, 5, 4996–4999. [Google Scholar] [CrossRef]
  37. Pereira, E.; Mateus, C.S.; Alves, M.J.; Almeida, R.; Pereira, J.; Quintella, B.R.; Almeida, P.R. Connectivity patterns and gene flow among Chelon ramada populations. Estuar. Coast. Shelf Sci. 2023, 281, 108209. [Google Scholar] [CrossRef]
  38. Tyagi, L.K.; Gupta, B.K.; Pandey, A.; Bisht, A.S.; Lal, K.K.; Punia, P.; Singh, R.K.; Mohindra, V.; Jena, J.K. Length–weight relationships and condition factor of snow trout, Schizothorax richardsonii (Gray, 1832) from different rivers of the Himalayan region in India. Proc. Natl. Acad. Sci. India Sect. B Biol. Sci. 2014, 84, 299–304. [Google Scholar] [CrossRef]
  39. Myrvold, K.M.; Kennedy, B.P. Seasonal variation in growth, consumption and growth efficiency in overwintering juvenile steelhead. Ecol. Freshw. Fish. 2020, 29, 450–464. [Google Scholar] [CrossRef]
  40. Allen, M.S.; Hightower, J.E. Fish population dynamics: Mortality, growth, and recruitment. Inland Fish. Manag. N. Am. 2010, 3, 43–79. [Google Scholar] [CrossRef]
  41. Ackman, R.G. Seafood lipids. In Seafoods: Chemistry, Processing, Technology and Quality; Shahidi, F., Botta, J.R., Eds.; Blackie Academic & Professional: Glasgow, UK, 1994; pp. 34–48. [Google Scholar] [CrossRef]
  42. Secci, G.; Parisi, G. From farm to fork: Lipid oxidation in fish products. A review. Ital. J. Anim. Sci. 2016, 15, 124–136. [Google Scholar] [CrossRef]
  43. Özden, Ö.; Erkan, N. A preliminary study of amino acid and mineral profiles of important and estimable 21 seafood species. Br. Food J. 2008, 113, 457–469. [Google Scholar] [CrossRef]
  44. Ragni, M.; Colonna, M.A.; Di Turi, L.; Carbonara, C.; Giannico, F.; Cariglia, M.; Palma, G.; Tarricone, S. Partial Replacement of Fishmeal with Seafood Discards for Juvenile Penaeus japonicus: Effects on Growth, Flesh Quality, Chemical and Fatty Acid Composition. Fishes 2024, 9, 195. [Google Scholar] [CrossRef]
  45. Ballantyne, J.S. Amino acid metabolism. Fish Physiol. 2011, 20, 77–107. [Google Scholar] [CrossRef]
  46. Ryu, B.; Shin, K.H.; Kim, S.K. Muscle protein hydrolysates and amino acid composition in fish. Mar. Drugs 2021, 19, 377. [Google Scholar] [CrossRef]
  47. Çankırılıgil, E.C.; Berik, N.; Erbay, E.A. Optimization of hydrolyzation procedure for amino acid analysis in fish meat with HPLC-DAD by Response Surface Methodology (RSM). Ege J. Fish. Aquat. Sci. 2020, 37, 113–123. [Google Scholar] [CrossRef]
  48. Islam, M.N.; Joadder, M.A.R. Seasonal variation of the proximate composition of freshwater Gobi, Glossoqibius giuris (Hamilton) for river Padma. Pakistan J. Biol. Sci. 2005, 8, 532–536. [Google Scholar] [CrossRef]
  49. FAO. Dietary protein quality evaluation in human nutrition. Report of an FAQ Expert Consultation. In FAO Food and Nutrition Paper; FAO: Rome, Italy, 2013; p. 92. [Google Scholar]
  50. Alvanou, M.V.; Kyriakoudi, A.; Makri, V.; Lattos, A.; Feidantsis, K.; Papadopoulos, D.K.; Georgoulis, I.; Apostolidis, A.P.; Michaelidis, B.; Mourtzinos, I.; et al. Effects of dietary substitution of fishmeal by black soldier fly (Hermetia illucens) meal on growth performance, whole-body chemical composition, and fatty acid profile of Pontastacus leptodactylus juveniles. Front. Physiol. 2023, 14, 1156394. [Google Scholar] [CrossRef] [PubMed]
  51. Tarricone, S.; Iaffaldano, N.; Colonna, M.A.; Giannico, F.; Selvaggi, M.; Caputi Jambrenghi, A.; Cariglia, M.; Ragni, M. Effects of dietary red grape extract on the quality traits in juvenile European sea bass (Dicentrarchus labrax L.). Animals 2023, 13, 254. [Google Scholar] [CrossRef] [PubMed]
  52. Rahman, M.M.; Hajar, S.; Yunus, K.B. Comparative analysis of chemical composition of some commercially important fishes with an emphasis on various Malaysian diets. Open Chem. 2020, 18, 1323–1333. [Google Scholar] [CrossRef]
  53. Ersoy, B.; Celik, M. The essential and toxic elements in tissues of six commercial demersal fish from Eastern Mediterranean Sea. Food Chem. Toxicol. 2010, 48, 1377–1382. [Google Scholar] [CrossRef]
  54. Cheng, J.-H.; Sun, D.-W.; Zeng, X.-A.; Liu, D. Recent Advances in Methods and Techniques for Freshness Quality Determination and Evaluation of Fish and Fish Fillets: A Review. Crit. Rev. Food Sci. Nutr. 2015, 55, 1012–1225. [Google Scholar] [CrossRef] [PubMed]
  55. Jolaoso, A.O.; Njoku, K.L.; Akinola, M.O.; Adesuyi, A.A.; Adedokun, A.H. Heavy metal analyses and nutritional composition of raw and smoked fishes from Ologe and Lagos Lagoon, Lagos, Nigeria. J. Appl. Sci. Environ. Manag. 2016, 20, 277–285. [Google Scholar] [CrossRef]
  56. Aberoumand, A. Preliminary studies on nutritive and organoleptic properties in processed fish fillets obtained from Iran. Food Sci. Technol. 2014, 34, 287–291. [Google Scholar] [CrossRef]
  57. Huss, H.H. Quality and Quality Changes in Fresh Fish. In FAO Fisheries Technical Paper No. 348; FAO: Rome, Italy, 1995. [Google Scholar]
  58. Allen, J.C. Industrial Aspects of Lipid Oxidation. In Recent Advances in Chemistry and Technology of Fats and Oils; Hamilton, R.J., Bhati, A., Eds.; Springer: Dordrecht, The Netherlands, 1987; pp. 31–39. [Google Scholar] [CrossRef]
  59. Furuhashi, M.; Hotamisligil, G.S. Fatty acid-binding proteins: Role in metabolic diseases and potential as drug targets. Nat. Rev. Drug Discov. 2008, 7, 489–503. [Google Scholar] [CrossRef] [PubMed]
  60. Ahmadian, M.; Suh, J.M.; Hah, N.; Liddle, C.; Atkins, A.R.; Downes, M.; Evans, R.M. PPARγ signaling and metabolism: The good, the bad and the future. Nat. Med. 2013, 19, 557–566. [Google Scholar] [CrossRef]
  61. Lopes-Marques, M.; Delgado, I.L.S.; Ruivo, R.; Torres, Y.; Sainath, S.B.; Rocha, E.; Cunha, I.; Santos, M.M.; Castro, L.F.C. The Origin and Diversity of Cpt1 Genes in Vertebrate Species. PLoS ONE 2015, 10, e0138447. [Google Scholar] [CrossRef] [PubMed]
  62. González-Garoz, R.; Cabezas, A.; Fernández-Muela, M.; Martínez Villalba, A.; González de Chávarri, E.; Villarroel, M.; De la Llave-Propín, Á.; De la Fuente, J.; Bermejo-Poza, R.; Díaz, M.T. Rainbow trout welfare: Comparing stunning methods in winter and summer. Fish Physiol. Biochem. 2025, 51, 110. [Google Scholar] [CrossRef] [PubMed]
Applsci 15 10398 g001
Figure 1. (A) Study area in Klisova Lagoon, Mesolonghi, Greece, and (B) annual variations in sea water temperatures, salinity, dissolved oxygen and pH (red arrows represent the dates when samplings were carried out).
Figure 1. (A) Study area in Klisova Lagoon, Mesolonghi, Greece, and (B) annual variations in sea water temperatures, salinity, dissolved oxygen and pH (red arrows represent the dates when samplings were carried out).
Applsci 15 10398 g001
Applsci 15 10398 g002
Figure 2. Seasonal changes (2 November, 18 January, 24 April, 9 July) in total fat content in the fillet of Mugil cephalus, Chelon ramada and Chelon auratus sampled in Klisova Lagoon, Greece. Data are presented as mean ± standard deviation (SD) of n = 6 fish per group (lower case letters = significant (p < 0.05) seasonal differences within species; * = significant (p < 0.05) differences vs. M. cephalus; # = significant (p < 0.05) differences vs. C. ramada; and ^ = significant (p < 0.05) differences vs. C. auratus within season).
Figure 2. Seasonal changes (2 November, 18 January, 24 April, 9 July) in total fat content in the fillet of Mugil cephalus, Chelon ramada and Chelon auratus sampled in Klisova Lagoon, Greece. Data are presented as mean ± standard deviation (SD) of n = 6 fish per group (lower case letters = significant (p < 0.05) seasonal differences within species; * = significant (p < 0.05) differences vs. M. cephalus; # = significant (p < 0.05) differences vs. C. ramada; and ^ = significant (p < 0.05) differences vs. C. auratus within season).
Applsci 15 10398 g002
Applsci 15 10398 g003
Figure 3. Seasonal changes (2 November, 18 January, 24 April, 9 July) in protein content (A,B), ash content (C,D) and moisture (E,F) in the white and red muscle of Mugil cephalus, Chelon ramada and Chelon auratus sampled in Klisova Lagoon, Greece. Data are presented as mean ± standard deviation (SD) of n = 6 fish per group (lower case letters = significant (p < 0.05) seasonal differences within species; * = significant (p < 0.05) differences vs. M. cephalus; # = significant (p < 0.05) differences vs. C. ramada; and ^ = significant (p < 0.05) differences vs. C. auratus within season).
Figure 3. Seasonal changes (2 November, 18 January, 24 April, 9 July) in protein content (A,B), ash content (C,D) and moisture (E,F) in the white and red muscle of Mugil cephalus, Chelon ramada and Chelon auratus sampled in Klisova Lagoon, Greece. Data are presented as mean ± standard deviation (SD) of n = 6 fish per group (lower case letters = significant (p < 0.05) seasonal differences within species; * = significant (p < 0.05) differences vs. M. cephalus; # = significant (p < 0.05) differences vs. C. ramada; and ^ = significant (p < 0.05) differences vs. C. auratus within season).
Applsci 15 10398 g003
Applsci 15 10398 g004
Figure 4. Seasonal changes (2 November, 18 January, 24 April, 9 July) in the hepatosomatic index (HSI) of Mugil cephalus, Chelon ramada and Chelon auratus sampled in Klisova Lagoon, Greece. Data are presented as mean ± standard deviation (SD) of n = 6 fish per group (lower case letters = significant (p < 0.05) seasonal differences within species; * = significant (p < 0.05) differences vs. M. cephalus; # = significant (p < 0.05) differences vs. C. ramada; and ^ = significant (p < 0.05) differences vs. C. auratus within season).
Figure 4. Seasonal changes (2 November, 18 January, 24 April, 9 July) in the hepatosomatic index (HSI) of Mugil cephalus, Chelon ramada and Chelon auratus sampled in Klisova Lagoon, Greece. Data are presented as mean ± standard deviation (SD) of n = 6 fish per group (lower case letters = significant (p < 0.05) seasonal differences within species; * = significant (p < 0.05) differences vs. M. cephalus; # = significant (p < 0.05) differences vs. C. ramada; and ^ = significant (p < 0.05) differences vs. C. auratus within season).
Applsci 15 10398 g004
Applsci 15 10398 g005
Figure 5. Seasonal changes (2 November, 18 January, 24 April, 9 July) in fabp (A,B), pparg (C,D) and cpt (E,F) relative mRNA expression levels in the liver and white muscle of Mugil cephalus, Chelon ramada and Chelon auratus sampled in Klisova Lagoon, Greece. Data are presented as mean ± standard deviation (SD) of n = 6 fish per group (lower case letters = significant (p < 0.05) seasonal differences within species; * = significant (p < 0.05) differences vs. M. cephalus; # = significant (p < 0.05) differences vs. C. ramada; and ^ = significant (p < 0.05) differences vs. C. auratus within season).
Figure 5. Seasonal changes (2 November, 18 January, 24 April, 9 July) in fabp (A,B), pparg (C,D) and cpt (E,F) relative mRNA expression levels in the liver and white muscle of Mugil cephalus, Chelon ramada and Chelon auratus sampled in Klisova Lagoon, Greece. Data are presented as mean ± standard deviation (SD) of n = 6 fish per group (lower case letters = significant (p < 0.05) seasonal differences within species; * = significant (p < 0.05) differences vs. M. cephalus; # = significant (p < 0.05) differences vs. C. ramada; and ^ = significant (p < 0.05) differences vs. C. auratus within season).
Applsci 15 10398 g005
Applsci 15 10398 g006
Figure 6. Variable correlations with each of the first two principal components (PCs) in the multivariate analysis and analytical table of the contribution of proximate composition parameters and variables according to factor loadings. The PCA was generated from the complete variables dataset. Variables with red vector arrows were included as predictors in constructing the PCA. (WM: white muscle, RM: red muscle, L: liver).
Figure 6. Variable correlations with each of the first two principal components (PCs) in the multivariate analysis and analytical table of the contribution of proximate composition parameters and variables according to factor loadings. The PCA was generated from the complete variables dataset. Variables with red vector arrows were included as predictors in constructing the PCA. (WM: white muscle, RM: red muscle, L: liver).
Applsci 15 10398 g006
Table 1. Primer pairs designed and used for genes amplification in M. cephalus, C. ramada and C. aurata.
Table 1. Primer pairs designed and used for genes amplification in M. cephalus, C. ramada and C. aurata.
TargetSequence (5′ → 3′)Product Length (bp)Tm (°C)Reference
fabpF: AACCCCTTCATGTCCTTCAA
R: TTCACCATGTAGGCTCCRTA		22951Present study
ppargF: TTAGACTACGCCTCCATYT
R: TCCTGTAGCTATGCATGTT		14850Present study
cptF: TGACGGTGAAGACCCAGA
R: TCTGTATGTGCACCANCTT		14053Present study
actinF: TGCAGTCAACATCTGGAATC
R: ATTTTTGGCGCTTGACTCAG		19153[18]
Table 2. Seasonal changes (2 November, 18 January, 24 April, 9 July) in total length (cm) and body weight (g) of Mugil cephalus, Chelon ramada and Chelon auratus sampled in Klisova Lagoon, Greece.
Table 2. Seasonal changes (2 November, 18 January, 24 April, 9 July) in total length (cm) and body weight (g) of Mugil cephalus, Chelon ramada and Chelon auratus sampled in Klisova Lagoon, Greece.
M. cephalus
NovemberJanuaryAprilJuly
Total Length (cm)39.06 ± 4.59 ab#^35.63 ± 1.05 a#^37.97 ± 4.51 ab#^40.93 ± 1.61 b#^
Body Weight (g)577.91 ± 65.27 a#^417.67 ± 49.34 b#^590.63 ± 144.47 a#^718.91 ± 37.79 c#^
C. ramada
NovemberJanuaryAprilJuly
Total Length (cm)32.57 ± 0.54 a*^43.43 ± 2.28 b*32.33 ± 0.93 a*^32.53 ± 1.46 a*^
Body Weight (g)377.53 ± 40.27 a*^881.43 ± 72.21 b*^388.13 ± 56.43 a*^353.52 ± 48.87 a*^
C. auratus
NovemberJanuaryAprilJuly
Total Length (cm)29.03 ± 1.15 a*#42.36 ± 0.19 b*27.97 ± 1.13 a*#27.64 ± 1.03 a*#
Body Weight (g)251.03 ± 6.74 a*#741.23 ± 34.55 b*#207.53 ± 35.52 ac*#203.03 ± 27.81 c*#
(n = 6 fish per group, lower case letters = significant (p < 0.05) seasonal differences within species; * = significant (p < 0.05) differences vs. M. cephalus; # = significant (p < 0.05) differences vs. C. ramada; and ^ = significant (p < 0.05) differences vs. C. auratus within season).
Table 3. Accession numbers for the different genes characterized in the present study for the species C. ramada, C. auratus and M. cephalus.
Table 3. Accession numbers for the different genes characterized in the present study for the species C. ramada, C. auratus and M. cephalus.
SpeciesGeneAccession Number
C. ramadafabpPV242891
C. auratusPV242890
M. cephalusPV242889
C. ramadappargPV242486
C. auratusPV240344
M. cephalusPV240343
C. ramadacptPV240341
C. auratusPV240342
M. cephalusPV242484
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Georgoulis, I.; Alvanou, M.V.; Giantsis, I.A.; Giannouli, A.; Giannichroni, T.; Ntousi, M.; Douvi, X.; Feidantsis, K. Seasonal Chemical Composition and Related Gene Expression Profiles in Three Mullet Species, and Their Effect on Nutritional Value. Appl. Sci. 2025, 15, 10398. https://doi.org/10.3390/app151910398

AMA Style

Georgoulis I, Alvanou MV, Giantsis IA, Giannouli A, Giannichroni T, Ntousi M, Douvi X, Feidantsis K. Seasonal Chemical Composition and Related Gene Expression Profiles in Three Mullet Species, and Their Effect on Nutritional Value. Applied Sciences. 2025; 15(19):10398. https://doi.org/10.3390/app151910398

Chicago/Turabian Style

Georgoulis, Ioannis, Maria V. Alvanou, Ioannis A. Giantsis, Antonia Giannouli, Theoni Giannichroni, Maria Ntousi, Xanthippi Douvi, and Konstantinos Feidantsis. 2025. "Seasonal Chemical Composition and Related Gene Expression Profiles in Three Mullet Species, and Their Effect on Nutritional Value" Applied Sciences 15, no. 19: 10398. https://doi.org/10.3390/app151910398

APA Style

Georgoulis, I., Alvanou, M. V., Giantsis, I. A., Giannouli, A., Giannichroni, T., Ntousi, M., Douvi, X., & Feidantsis, K. (2025). Seasonal Chemical Composition and Related Gene Expression Profiles in Three Mullet Species, and Their Effect on Nutritional Value. Applied Sciences, 15(19), 10398. https://doi.org/10.3390/app151910398

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop