Next Article in Journal
A Study on Tree Species Recognition in UAV Remote Sensing Imagery Based on an Improved YOLOv11 Model
Previous Article in Journal
Informational and Topological Characterization of CO and O3 Hourly Time Series in the Mexico City Metropolitan Area During the 2019–2023 Period: Insights into the Impact of the COVID-19 Pandemic
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Applied Sciences
Volume 15
Issue 16
10.3390/app15168781
applsci-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effects of Different Planting Environments on the Fragrance of Dalixiang (Oryza sativa L.)

by
Tao Que
1,*,
Yanlong Gong
2,
Qian Wang
2,3,
Zhongni Wang
2,
Wuhua Long
2,3,
Xian Wu
2 and
Susong Zhu
4,*
1
School of Life Sciences, Guizhou Normal University, Guiyang 550025, China
2
Rice Research Institute, Guizhou Academy of Agricultural Sciences, Guiyang 550006, China
3
Key Laboratory of Crop Genetic Resources and Germplasm Innovation in Karst Mountainous Areas, Ministry of Agriculture and Rural Affairs, Guiyang 550006, China
4
Institute of Crop Variety Resources, Guizhou Academy of Agricultural Sciences, Guiyang 550006, China
*
Authors to whom correspondence should be addressed.
Appl. Sci. 2025, 15(16), 8781; https://doi.org/10.3390/app15168781
Submission received: 19 June 2025 / Revised: 21 July 2025 / Accepted: 29 July 2025 / Published: 8 August 2025
Browse Figures
Review Reports Versions Notes

Abstract

In addition to being governed by genetic factors, environmental factors also play a crucial role in influencing the fragrance of rice. In this research, the high-quality rice variety Dalixiang was selected as the experimental material to investigate the impacts of soil nutrients in Guiyang and Meitan on its fragrance. The results indicated that the levels of ammonium nitrogen, organic matter, total nitrogen, available nitrogen, and the pH value in the soil of Meitan were lower compared to those in Guiyang. Conversely, the contents of total potassium, available phosphorus, and available potassium were higher in Meitan. Specifically, the concentrations of 2-acetyl-1-pyrroline (2AP) in the leaves of Dalixiang at the heading stage and in the grains at the maturity stage at the Meitan planting site were 0.13 mg/kg and 0.56 mg/kg, respectively. These values were significantly lower than the 0.17 mg/kg and 0.64 mg/kg measured at the Guiyang planting site. This phenomenon is associated with the higher expression levels of the betaine aldehyde dehydrogenase (OsBadh2) gene, enhanced enzyme activities, and a greater content of γ-aminobutyric acid (GABA) in the leaves of Dalixiang at the Meitan planting site. In contrast, the expression levels of genes related to triose phosphate isomerase (OsTPI), proline dehydrogenase (OsProDH), ornithine aminotransferase (OsOAT), and Delta1-pyrroline-5-carboxylic acid synthetase (OsP5CS), along with their corresponding enzyme activities, as well as the contents of methylglyoxal, proline, and ornithine, were lower. In conclusion, due to the influence of the Guiyang environment, the biosynthesis of Dalixiang 2AP was promoted, which made the Dalixiang planted in Guiyang stronger than that planted in Meitan. This study provides a theoretical basis for the selection of the best planting area of Dalixiang and the improvement of Dalixiang flavor through agronomic cultivation techniques.

1. Introduction

Rice is a staple food for nearly one-third of the global population. With consumers’ ever-increasing demands for rice quality, fragrant rice has been gradually gaining popularity in the worldwide rice trading market. Typically, its price is approximately twice that of ordinary rice [1,2]. Research indicates that 2-acetyl-1-pyrroline (2AP) is the primary compound conferring fragrance to rice [2,3]. Chen et al. [4] have demonstrated that when the betaine aldehyde dehydrogenase gene (OsBadh2) mutates, resulting in a non-functional truncated betaine aldehyde dehydrogenase (BADH2) protein, γ-aminobutyraldehyde (GAB-ald) cannot be converted into γ-aminobutyric acid (GABA). Instead, it spontaneously cyclizes to form delta1-pyrroline, which then gives rise to 2AP through a series of reactions. Moreover, methylglyoxal (MG), another key substrate in 2AP biosynthesis, is generated during the process where the enzyme encoded by the triose phosphate isomerase gene (OsTPI) catalyzes the conversion of glycerol-3-phosphate to dihydroxyacetone phosphate. MG provides an acetyl group to react with delta1-pyrroline via acetylation to form 2AP [5,6]. Meanwhile, the glycerol-3-phosphate dehydrogenase gene (OsGAPDH), its corresponding enzyme, and pyruvate are also significantly associated with the biosynthesis of MG [5]. Romanczyk et al. [7] and Schieberle et al. [8] have further discovered that proline, ornithine, and glutamic acid likely act as crucial precursor substances in the 2AP biosynthesis pathway. Through the catalysis of the respective enzymes encoded by the proline dehydrogenase (OsProDH), ornithine aminotransferase (OsOAT), and delta1-pyrroline-5-carboxylic acid synthetase (OsP5CS) genes, they are transformed into delta1-pyrroline-5-carboxylic acid (P5C), which is then further converted into 2AP.
Apart from genetic factors, the fragrance of fragrant rice is also influenced by cultivation environment, farming practices, and fertilization methods. Sansenya et al. [9] have found that in regions with low precipitation, the 2AP content in the grains of fragrant rice cultivars increases significantly, thereby enhancing the fragrance. Wang et al. [10] have also reported that the 2AP content in fragrant rice grown at high altitudes is relatively high. Within a certain range, higher levels of nitrogen, total potassium, available potassium, zinc, total phosphorus, available phosphorus, and organic matter in soil nutrients can effectively boost the 2AP content in fragrant rice, thus enhancing its aroma [11,12,13,14]. Soil nutrients exert a significant regulatory effect on the synthesis of 2-acetyl-1-pyrroline (2AP) in rice. The accumulation of 2AP in rice is comprehensively affected by key nutrients such as nitrogen, phosphorus, and potassium, as well as soil moisture conditions. Studies suggest that an appropriate amount of nitrogen fertilizer can promote 2AP synthesis, yet excessive nitrogen application inhibits its accumulation. This might be attributed to the enhanced protein synthesis and intensified metabolic competition induced by excessive nitrogen [15]. A proper ratio of phosphorus and potassium is equally vital. Phosphorus fertilizer plays a particularly prominent role in elevating the 2AP content, while potassium fertilizer indirectly promotes the formation of aroma precursor substances by regulating enzyme activity [16,17]. Additionally, there exists a positive correlation between soil organic matter content and 2AP. Returning straw to the field or applying organic fertilizers can increase soil active organic carbon and microbial activity, accelerating the conversion of precursor substances and thus increasing the 2AP content [18]. Trace elements such as zinc and iron also impact on the aroma synthesis pathway by participating in key enzymatic reactions [17,18,19].
Dalixiang is a high-quality rice variety developed by the Guizhou Rice Research Institute through indica-japonica hybridization. It claimed the top prize among the top ten gold awards at the National Rice Expo in 2003 and has continued to secure top ten gold awards at the China Rice Expo for five consecutive years thereafter [20]. The 7th exon of the OsBadh2 gene in this variety harbors an 8 bp deletion and three single-nucleotide polymorphisms (SNPs) [21]. As a result, Dalixiang exhibits excellent grain quality and a strong fragrance. Currently, there is a dearth of research on the impact of environmental factors on the fragrance of Dalixiang. The objective of this study is to comprehensively analyze the influence of planting environments on the 2AP content of Dalixiang, elucidate the underlying mechanisms by which planting environments affect its fragrance, and provide a scientific basis for identifying the optimal cultivation regions for Dalixiang and improving the fragrance of Dalixiang rice through cultivation techniques in the future.

2. Materials and Methods

2.1. Materials and Cultivation

The Rice Research Institute of Guizhou Province provided the Dalixiang rice variety. The cultivation experiments were conducted in Guiyang, Guizhou (GY) and Meitan, Guizhou (MT) from April to November 2024. Sowing was carried out on April 28th, and transplantation occurred on June 4th. The experimental site in Guiyang was located within the experimental field of the Rice Research Institute of Guizhou Province, at coordinates 106°68′ E, 26°51′ N, with an altitude of 1074.3 m and an average temperature of 21.07 °C. The experimental site in Meitan was situated in the experimental field of Maogong Rice Industry Company in Meitan County, Guizhou Province, at 107°35′ E, 27°54′ N, with an altitude of 780 m, and an average temperature of 25.5 °C. In both locations, cultivation was implemented using plastic turnover boxes (measuring 830 mm × 570 mm × 505 mm) filled with soil, where the soil layer thickness exceeded 40 cm. Six plants were planted per box, and three replicates were set up. The materials were uniformly cultivated in Guiyang until 35 days after sowing, and then were, respectively, transplanted into the plastic turnover boxes in the two sites. Fertilization and irrigation management followed the local field-management practices.

2.2. DNA Extraction, PCR Amplification, and Electrophoresis Detection

The cetyltrimethylammonium bromide (CTAB) method [10] was employed to extract total DNA from the young leaves of Dalixiang 30 days after sowing. The quality and concentration of the DNA were assayed by 1% agarose gel electrophoresis and an ultramicro spectrophotometer (Kaiao Technology, K5800/C/H/T, V2.0, Beijing, China). Finally, the functional molecular markers developed by Deng et al. [22] were utilized to detect the mutation status of the OsBadh2 gene in Dalixiang, ensuring that all Dalixiang plants used in the experiment harbored the OsBadh2 gene.

2.3. Testing of Gene Expression Levels

Young leaves at the heading stage were sampled, and total RNA was extracted following the instructions of the plant RNA extraction kit (DNase I) (CWBIO Company, Taizhou, China). The quality and concentration of the RNA were detected by 1% agarose gel electrophoresis and an ultramicro spectrophotometer (Kaiao Technology, K5800/C/H/T, V2.0, Beijing, China). One microgram of total RNA sample was taken, and reverse transcription for cDNA amplification was carried out according to the protocol of the GoldenstarTM RT6 cDNA Synthesis Kit Ver.2 reverse-transcriptase kit from Qingke Biotechnology Company (Tianjin, China). Referring to the method of Khandagale et al. [3], gene-specific primers (listed in Appendix A Table A1) were used for qRT-PCR to detect the gene expression levels of OsBadh2, OsP5CS, OsTPI, OsGAPDH, OsProDH, and OsOAT in the cDNA of Dalixiang leaves. qRT-PCR was performed using a fluorescence-quantitative PCR instrument, ABI 7500 (Thermo ScientificTM, Waltham, MA, USA). With EF1α as the reference, the relative expression of the selected genes was calculated using the 2−ΔΔCT method. At the same location, three similarly growing Dalixiang plants were selected from each of the three planting boxes for experimentation. The average data obtained from each planting box served as a replicate for the corresponding indicator at that location. The three average values obtained were used as the final presentation data for the experimental results.

2.4. Determination of Enzyme Activity

Referring to the method of Khandagale et al. [3], the Elisa kits for corresponding enzyme-activity detection from Nanjing Ruiyuan Biotechnology Co., Ltd. (Nanjing, China) were used to determine the enzyme activities of BADH2, TPI, ProDH, OAT, P5CS, and GAPDH in the leaves of Dalixiang at the heading stage. The experimental materials were derived from the plants selected in 1.3, and the enzyme activity units were expressed in IU/g.

2.5. Measurement of 2AP Content and Contents of Related Substances

Referring to the method of Chen et al. [4], the content of 2AP was determined using the UPLC-MS/MS method in the leaves at the heading stage and the shelled grains at the mature stage. Referring to the methods of Khandagale et al. [3] and Schieberle et al. [8], the contents of GABA, ornithine, and glutamic acid were determined by the HPLC-MS/MS method in the leaves at the heading stage. The MG content was determined using the MG determination kit from Solarbio Company (Beijing, China), and the proline content was determined by the ninhydrin colorimetric method. The unit for 2AP content is expressed in mg/kg, while the units for pyruvic acid and MG content are expressed in μmol/g, and the units for proline, ornithine, glutamic acid, and γ-aminobutyric acid content are expressed in μg/g.

2.6. Inspection of Soil Nutrients

The determination of ammonium nitrogen, nitrate nitrogen, organic matter, pH, total nitrogen, total phosphorus, total potassium, available phosphorus, fast-acting potassium, and alkaline hydrolyzable nitrogen was carried out according to the method of Wang et al. [10]. The contents of ammonium nitrogen, nitrate nitrogen, available phosphorus, fast-acting potassium, and alkaline hydrolyzable nitrogen are all expressed in mg/kg, while the contents of organic matter, total nitrogen, total phosphorus, and total potassium are all expressed in g/kg.

2.7. Data Analysis

Excel 2019 was used for data statistics and organization, SPSS 22.0 was used for statistical analysis, and Prism 2.0 was used for plotting. In addition, by conducting one-way ANOVA and F-test, under the premise of determining significance, Duncan’s multiple range test was used to perform multiple comparative analyses between the two groups of data. Perform correlation analysis using the Pearson Correlation Coefficient. For all comparisons, p < 0.05 was considered statistically significant.

3. Results

3.1. Analysis of OsBadh2 Expression Level and 2AP Content

In order to study the influence of different ecological environments on the content of 2AP in Dalixiang, we first detected the expression level of OsBadh2 in Dalixiang. The results revealed that the expression level of OsBadh2 in the leaves of Dalixiang cultivated in Meitan was significantly higher than that in the leaves of Dalixiang grown in Guiyang (Figure 1A, p < 0.01). Subsequently, we analyzed the content of 2AP in Dalixiang. During the heading stage, it was found that the 2AP content in the leaves of Dalixiang planted in Meitan was 0.13 mg/kg, significantly lower than that (0.17 mg/kg) in the leaves of Dalixiang planted in Guiyang (Figure 1B, p < 0.01). During the maturity stage, the result showed that the 2AP content in the grains of Dalixiang cultivated in Meitan was 0.56 mg/kg, which was significantly lower than that (0.64 mg/kg) in the grains of Dalixiang grown in Guiyang (Figure 1C, p < 0.01). Correlation analysis indicated that there was an extremely significant positive correlation between the 2AP content in Dalixiang leaves during the heading stage and the 2AP content in grains during the maturity stage (Table 1, p < 0.01).

3.2. Analysis of BADH2 Enzyme Activity and GABA Content

During the heading stage, the activity of the BADH2 enzyme encoded by OsBadh2 in Dalixiang leaves was assayed. The results demonstrated that the BADH2 enzyme activity in the leaves of Dalixiang planted in Meitan was 1.64 IU/g, which was extremely significantly higher than that (1.34 IU/g) in the leaves of Dalixiang planted in Guiyang (Figure 2A, p < 0.01), consistent with the higher expression level of the OsBadh2 gene at the Meitan planting site. Additionally, the content of γ-aminobutyric acid (GABA) produced by the catalytic reaction of BADH2 enzyme (encoded by OsBadh2) on γ-aminobutyraldehyde (GAB-ald) in Dalixiang leaves was determined. The GABA content in the leaves of Dalixiang cultivated in Meitan was 42.36 μg/g, which was significantly higher than that (26.05 μg/g) in the leaves of Dalixiang grown in Guiyang (Figure 2B, p < 0.01).

3.3. Analysis of the Expression Levels of Genes Involved in 2AP Biosynthesis

The triosephosphate isomerase (TPI) encoded by the OsTPI gene catalyzes the conversion of glycerol-3-phosphate to dihydroxyacetone phosphate, generating methylglyoxal (MG), one of the direct precursor substances for 2AP biosynthesis. Therefore, during the heading stage, we detected the expression level of OsTPI gene in the leaves of Dalixiang. The results showed that the expression level of OsTPI in the leaves of Dalixiang planted in Meitan was extremely significantly lower than that in the leaves of Dalixiang planted in Guiyang (Figure 3A, p < 0.01). Moreover, enzymes encoded by OsProDH, OsOAT, and OsP5CS genes may catalyze the conversion of proline, glutamic acid, and ornithine into 1-pyrroline-5-carboxylic acid (P5C), which further contributes to 2AP formation. The enzyme encoded by the OsGAPDH gene catalyzes the conversion of glycerol-3-phosphate to pyruvate, affecting MG biosynthesis. Thus, we also examined the expression levels of these genes in the leaves of Dalixiang plants. The results indicated that the expression levels of OsProDH, OsOAT, and OsP5CS genes in the leaves of Dalixiang planted in Meitan were extremely significantly lower than those in the leaves of Dalixiang planted in Guiyang, respectively, while there was no significant difference in the expression level of the OsGAPDH gene between the two groups (Figure 3B–E, p < 0.01).

3.4. Analysis of the Enzyme Activities Involved in 2AP Biosynthesis

During the heading stage, the activity of TPI enzyme encoded by OsTPI in Dalixiang leaves was measured. The results showed that the TPI enzyme activity in the leaves of Dalixiang planted in Meitan was 2.23 IU/g, which was extremely significantly lower than that (3.11 IU/g) in the leaves of Dalixiang planted in Guiyang (Figure 4A, p < 0.01). Meanwhile, the activities of ProDH, OAT, P5CS, and GAPDH enzymes encoded by OsProDH, OsOAT, OsP5CS, and OsGAPDH genes, respectively, were determined. The results indicated that the ProDH enzyme activity in the leaves of Dalixiang planted in Meitan was 1.23 IU/g, the OAT enzyme activity was 0.30 IU/g, and the P5CS enzyme activity was 0.33 IU/g, all of which were extremely significantly lower than the activities of the corresponding enzymes in the leaves of Dalixiang planted in Guiyang (1.54 IU/g, 0.47 IU/g, and 0.65 IU/g, respectively). However, there was no significant difference in the GAPDH enzyme activity between the two groups, which were 1.24 IU/g and 1.21 IU/g, respectively (Figure 4B–E, p < 0.01).

3.5. Analysis of the Contents of Substances Involved in 2AP Biosynthesis

During the heading stage, the content of MG in Dalixiang leaves was further determined. The results showed that the MG content in the leaves of Dalixiang planted in Meitan was 4.04 μmol/g, which was extremely significantly lower than that (4.28 μmol/g) in the leaves of Dalixiang planted in Guiyang (Figure 5A, p < 0.01). The contents of proline, ornithine, glutamic acid, and pyruvate in Dalixiang leaves during the heading stage were also measured. The results indicated that the proline content in the leaves of Dalixiang planted in Meitan was 21.30 μg/g, and the ornithine content was 1.31 μg/g, both of which were extremely significantly lower than the contents of the corresponding substances in the leaves of Dalixiang planted in Guiyang (26.98 μg/g and 1.53 μg/g, respectively). The glutamic acid content was 836.88 μg/g, which was extremely significantly higher than that (691.26 μg/g) in the leaves of Dalixiang planted in Guiyang. However, there was no significant difference in the pyruvate content between the two groups, which were 9.17 μmol/g and 9.07 μmol/g, respectively (Figure 5B–E, p < 0.01).

3.6. Analysis of Soil Nutrients Under Different Ecological Environments

To study the effect of soil nutrients in Guiyang and Meitan on the content of 2AP in Dalixiang, the soil nutrients in these two regions were analyzed. The results showed that the ammonium nitrogen content, organic matter content, total nitrogen content, and alkaline hydrolyzable nitrogen content in Meitan soil were significantly lower than the corresponding soil nutrient content in Guiyang. The pH value of Meitan soil is significantly lower than that of Guiyang soil. The total potassium content, available phosphorus content, and fast-acting potassium content are significantly higher than the corresponding soil nutrient content in Guiyang soil. However, there was no significant difference in the content of nitrate nitrogen and total phosphorus in the soil between the two regions (Table 2, p < 0.05).

4. Discussion

Previous reports have firmly established that higher altitudes play a pivotal role in enhancing the 2AP content [9,10,23]. Moreover, during the heading stage, lower temperature conditions (22/16 °C) have been demonstrated to be far more conducive to 2AP accumulation compared to higher temperatures (32/26 °C) [24]. Similarly, at the ripening stage, rice grains cultivated under cooler temperatures (25/20 °C) exhibit significantly elevated 2AP levels than those grown under warmer conditions (35/30 °C) [25]. Research conducted by Wu et al. [26] and Zhong et al. [27] has revealed that Guiyang features a lower average annual temperature and a higher average altitude relative to Meitan. Our study corroborates these findings, as the Dalixiang rice planted in Guiyang consistently showed a higher 2AP content (Figure 1B,C). Additionally, the existing literature indicates that elevated levels of soil organic matter, total nitrogen, and available nitrogen are highly favorable for 2AP accumulation [13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28]. Our data further demonstrates that the soil at the Guiyang planting site is rich in ammonium nitrogen, organic matter, total nitrogen, and available nitrogen, which aligns with the significantly higher 2AP content detected in Dalixiang rice cultivated there (Table 2, Figure 1B,C). Therefore, in addition to altitude and temperature, these soil nitrogen-related components and organic matter are critical determinants of the 2AP content in Dalixiang.
The biosynthesis of 2AP is primarily attributed to mutations in the OsBadh2 gene. Such mutations lead to the production of truncated or non-functional betaine aldehyde dehydrogenase (BADH2), thereby preventing the conversion of GABA-ald to GABA. Consequently, GAB-ald spontaneously cyclizes into Delta1-pyrroline, which ultimately forms 2AP [29,30]. In our study, at the Guiyang planting site, both the expression of the OsBadh2 gene and the activity of the BADH2 enzyme during the heading stage of Dalixiang were significantly suppressed. Concurrently, there was a marked reduction in GABA content (Figure 1A and Figure 2A,B). We thus hypothesize that the environmental conditions in Guiyang downregulate OsBadh2 expression during the heading stage, inhibiting GABA accumulation. This, in turn, promotes an increase in 2AP content in the leaves, ultimately facilitating 2AP accumulation in mature grains.
MG, another direct precursor of 2AP synthesis (apart from Delta1-pyrroline), is generated during the conversion of glyceraldehyde-3-phosphate to dihydroxyacetone phosphate, a reaction catalyzed by TPI encoded by the OsTPI gene. MG primarily supplies the acetyl group required for the acetylation of Delta1-pyrroline to form 2AP [5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31]. Our findings show that Dalixiang rice grown in Guiyang exhibited significantly higher levels of MG, OsTPI gene expression, and TPI enzyme activity (Figure 3A, Figure 4A and Figure 5A). This strongly suggests that the Guiyang environment promotes MG biosynthesis, thereby enhancing 2AP accumulation.
Other studies have proposed alternative pathways for 2AP synthesis. Proline may be converted into 2AP through the action of proline dehydrogenase (ProDH), which is encoded by the OsProDH gene [32]. Similarly, ornithine can potentially be transformed into 2AP via the activity of ornithine aminotransferase (OAT), encoded by the OsOAT gene [33,34]. Our data reveal that Dalixiang rice from the Guiyang planting site had significantly higher levels of proline, ornithine, OsProDH and OsOAT gene expression, as well as ProDH and OAT enzyme activities compared to the Meitan site (Figure 3B,C, Figure 4B,C and Figure 5B,C). This indicates that the Guiyang environment is likely modulated to the levels of proline and ornithine, as well as the expression of associated genes and enzyme activities, contributing to increased 2AP production.
Notably, Renuka et al. [35] reported that ornithine can also be converted into 2AP through a pathway involving ornithine decarboxylase (ODC) and diamine oxidase (DAO), which successively convert ornithine to putrescine and then to γ-aminobutyraldehyde (GAB-ald). Li et al. [36] further demonstrated that mutations in the OsODC gene lead to a more pronounced increase in 2AP content, possibly by enhancing ornithine availability. Future research should explore whether similar mechanisms exist for the OsProDH and OsOAT genes.
Regarding glutamate, it can potentially be converted into 2AP through a pathway involving OsP5CS-encoded Delta1-pyrroline-5-carboxylic acid synthetase (P5CS), which forms Delta1-pyrroline-5-carboxylic acid (P5C), a precursor to 2AP. However, P5C can also be reduced back to glutamate by Delta1-pyrroline-5-carboxylic acid dehydrogenase (P5CDH) [37,38]. Our study showed that Dalixiang rice from Guiyang had significantly lower glutamate levels but higher OsP5CS gene expression and P5CS enzyme activity compared to Meitan (Figure 3D, Figure 4D and Figure 5D). We speculate that the Meitan environment promotes the conversion of P5C back to glutamate via P5CDH, which explains the higher glutamate levels in Dalixiang rice with lower 2AP content.

5. Conclusions

Compared with the Meitan planting area, the characteristics of the Guiyang planting area are a higher altitude, lower temperature, and richer soil nutrient content (total nitrogen, ammonium nitrogen, available nitrogen, and organic matter). These environmental factors affect the levels of 2AP-related precursors, gene expression, and enzyme activities, ultimately promoting the accumulation of 2AP and enhancing the aroma of Dalixiang. At the same time, when planting Dalixiang in Meitan, the fragrance can be enhanced by applying nitrogen and organic fertilizers.

Author Contributions

T.Q. designed and carried out experiments and was responsible for writing the paper and conducting data analysis. Y.G. and W.L. oversaw the fields’ planting and management of experimental materials. Z.W., Q.W. and X.W. contributed to paper revision. S.Z. conceived the project, took the lead in the project, and was involved in experimental design and paper revision. All authors have read and agreed to the published version of the manuscript.

Funding

This research was co-funded by multiple projects. These include the Guizhou Provincial Science and Technology Plan Project (Grant No. Qiankehe Jichu-ZK [2022] General 284), the Youth Fund Project of the Guizhou Academy of Agricultural Sciences (Grant No. Qiannongke Youth Fund (2023) 30), the R & D and Transformation of High-Quality and Characteristic Rice in Guizhou Province, along with the Capacity Building of Technical Services in Agricultural Parks (Grant No. Qiankehe Pingtai Rencai (2017) 5719), and the Construction of the Public Platform of the South—breeding Base for Rice Germplasm Innovation in Guizhou (Grant No. Qiankehe Fuqi (2014) 4005).

Data Availability Statement

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Acknowledgments

Special thanks to Guizhou MaoGong Rice Industry Co., Ltd. (Zunyi, China) for the guidance and support of cultivation technology.

Conflicts of Interest

The authors have no relevant financial or non-financial interests to disclose.

Appendix A

Table A1. Primer information for qRT-PCR.
Table A1. Primer information for qRT-PCR.
Primer NameSequence (5′-3′)References
OsBadh2-FTGTGCTAAACATAGTGACTGGA[6]
OsBadh2-FCTTAACCATAGGAGCAGCT
OsTPI-FATCAGATGAACTGAAAGTGCCGTT[39]
OsTPI-RGACTACGAAAACAAGTAATCAT
OsP5CS-FGCAATCTGAACCAAGGCATCAGG[40]
OsP5CS-RTTTAGCAGGACTGTTGGCACTGG
OsProDH-FTCATCAGACGAGCAGAGGAGAACAGG[41]
OsProDH-RCCCAGCATTGCAGCCTTGAACC
OsGAPDH-FATGGCGAAGATTAAGATCGGGAT[6]
OsGAPDH-RCACAGTGTCATACTTGAACA
OsOAT-FCTGGAGCTGAAGGAGTGGAAACAGC[40]
OsOAT-RGATGGCCAGGAACCAATGGG
EF1α-FTTTCACTCTTGGTGTGAAGCAGAT[3]
EF1α-RGACTTCCTTCACGATTTCATCGTAA

References

  1. Withana, W.V.E.; Kularathna, R.M.R.E.; Kottearachchi, N.S.; Kekulandara, D.S.; Weerasena, J.; Steele, K.A. In silico analysis of the fragrance gene (BADH2) in Asian rice (Oryza sativa L.) germplasm and validation of allele specific markers. Plant Genet. Resour. Charact. Util. 2020, 18, 71–80. [Google Scholar] [CrossRef]
  2. Yang, S. Effects of Nitrogen Application and Combined Application of Nitrogen and Zinc Fertilizers on 2AP Content, Yield and Quality of Japonica Fragrant Rice. Master’s Thesis, Yangzhou University, Yangzhou, China, 2023. [Google Scholar]
  3. Khandagale, K.S.; Zanan, R.L.; Mathure, S.V.; Nadaf, A.B. Haplotype variation of Badh2 gene, unearthing of a new fragrance allele and marker development for non-basmati fragrant rice ‘Velchi’ (Oryza sativa L.). Agri. Gene 2017, 6, 40–46. [Google Scholar] [CrossRef]
  4. Chen, S.H.; Yang, Y.; Shi, W.W.; Ji, Q.; He, F.; Zhang, Z.D.; Cheng, Z.K.; Liu, X.N.; Xu, M.L. Badh2, encoding betaine aldehyde dehydrogenase, inhibits the biosynthesis of 2-acetyl-1-pyrroline, a major component in rice fragrance. Plant Cell 2008, 20, 1850–1861. [Google Scholar] [CrossRef] [PubMed]
  5. Hofmann, T.; Schieberle, P. 2-Oxopropanal, hydroxy-2-propanone, and 1-pyrroline- important intermediates in the generation of the roast-smelling food flavor compounds 2-acetyl-1-pyrroline and 2-acetyltetrahydropyridine. J. Agric. Food Chem. 1998, 46, 2270–2277. [Google Scholar] [CrossRef]
  6. Hinge, V.R.; Patil, H.B.; Nadaf, A.B. Aroma volatile analyses and 2AP characterization at various developmental stages in Basmati and Non-Basmati scented rice (Oryza sativa L.) cultivars. Rice 2016, 9, 38. [Google Scholar] [CrossRef]
  7. Romanczyk, L.J.; Mcclelland, C.A.; Post, L.S.; Aitken, W.M. Formation of 2-acetyl-1-pyrroline by several bacillus cereus strains isolated from cocoa fermentation boxes. J. Agric. Food Chem. 1995, 43, 469–475. [Google Scholar] [CrossRef]
  8. Schieberle, P. The role of free amino acids presents in yeast as precursors of the odorants 2-acetyl-1-pyrroline and 2-acetyltetrahydropyridine in wheat bread crust. Z. Für Lebensm.-Unters. Und-Forsch. 1990, 191, 206–209. [Google Scholar] [CrossRef]
  9. Sansenya, S.; Wechakorn, K. Effect of rainfall and altitude on the 2-acetyl-1-pyrroline and volatile compounds profile of black glutinous rice (Thai upland rice). J. Sci. Food Agric. 2021, 101, 5784–5791. [Google Scholar] [CrossRef]
  10. Wang, X.L.; Wang, Z.N.; Li, Z.J.; Xu, H.F.; Gong, J.Y.; Pu, X.C.; Zheng, G.Y.; Zhang, Y.S.; Zhu, S.S. Study on the correlation between aroma components and soil properties of fragrant rice “Goudang 3”. Jiangsu Agric. Sci. 2023, 51, 168–173. [Google Scholar] [CrossRef]
  11. Sun, S.X.; Liu, S.C. Study of the effects of N and Zn fertilizers on the aroma of rice. Acta Agron. Sin. 1991, 6, 430–435. [Google Scholar]
  12. Hu, S.L.; Huang, Q.W.; Xu, Q.G. Relationship of sweet rice quality with the contents of microelements. Acta Agron. Sin. 2001, 4, 12–15. [Google Scholar] [CrossRef]
  13. Zheng, C.G.; Cai, G.Z.; Dai, H.Y. A report on the breeding improvement and farming of scented rice. Tillage Cultiv. 2005, 4, 7–9. [Google Scholar]
  14. Udovic, M.; Mcbride, M. Influence of compost addition on lead and arsenic bioavailability in reclaimed orchard soil assessed using Porcellio scaber bioaccumulation test. J. Hazard. Mater. 2012, 205–206, 144–149. [Google Scholar] [CrossRef] [PubMed]
  15. Mo, Z.W.; Li, Y.H.; Nie, J.; He, L.X.; Pan, S.G.; Duan, M.Y.; Tian, H.; Xiao, L.Z.; Zhong, K.Y.; Tang, X.R. Nitrogen application and different water regimes at booting stage improved yield and 2-acetyl-1-pyroline (2AP) formation in fragrant rice. Rice 2019, 12, 77. [Google Scholar] [CrossRef]
  16. Tian, S.C.; Ma, J.J. Effect of soil fertility on yield of rice and establishment of fertilization index system. Chin. Agric. Sci. Bull. 2015, 31, 1–4. [Google Scholar] [CrossRef]
  17. Hang, Y.J.; Wang, Q.S.; Xu, G.C.; Liu, X.; Yang, B.; Jin, M. Ecological response of nutrient properties of paddy field to different tillage practices. Chin. Agric. Sci. Bull. 2017, 33, 106–112. [Google Scholar] [CrossRef]
  18. Yan, C. Studies on Decomposition Regularity of Returning Rice Straw and Soil Nutrient Properties. Ph.D. Thesis, Northeast Agricultural University, Harbin, China, 2015. [Google Scholar] [CrossRef]
  19. Zhan, M.; Cao, C.G.; Jiang, Y.; Wang, J.P.; Le, L.X.; Cai, M.L. Dynamics of active organic carbon in a paddy soil under different rice farming modes. Chin. J. Appl. Ecol. 2010, 21, 2010–2016. [Google Scholar] [CrossRef]
  20. Luo, R.F.; Luo, J.; Mei, Y.X.; Li, T.H.; Chen, Y.X.; Lv, C.Z.; Tan, B. The Purification, Rejuvenation and Application of Good Quality Rice Dalixiang of Maogong Brand. Seed 2012, 31, 131–132. [Google Scholar] [CrossRef]
  21. Wang, L.L.; Peng, Q.; Li, J.L.; Zhang, D.S.; Wu, J.Q.; Jiang, X.; Zhu, S.S. The CDS variance analysis of OsBADH2 gene and aroma appraisal of 7 Guizhou HE (Oryza sativa). Mol. Plant Breed. 2018, 16, 4138–4142. [Google Scholar] [CrossRef]
  22. Deng, L.X.; Liu, D.; Chen, Y.H.; Feng, Z.L.; Long, Q.H. Development of molecular marker for fragrance gene of high quality rice ‘Dalixiang’ in Guizhou province. Mol. Plant Breed. 2021, 19, 6059–6063. [Google Scholar] [CrossRef]
  23. Yang, X.J.; Tang, X.R.; Wen, X.C.; Li, Y.H.; Zhou, X.J. Effects of sowing date on aroma formation, quality and yield of early season aromatic rice. Acta Agric. Boreali-Occident. Sin. 2014, 29, 128–135. [Google Scholar] [CrossRef]
  24. Okpala, N.E.; Potcho, M.P.; An, T.; Ahator, S.D.; Duan, L.X.; Tang, X.R. Low temperature increased the biosynthesis of 2-AP, cooked rice elongation percentage and amylose content percentage in rice. J. Cereal Sci. 2020, 93, 102980. [Google Scholar] [CrossRef]
  25. Itani, T.; Tamaki, M.; Hayata, Y.; Fushimi, T.; Hashizume, K. Variation of 2-acetyl-1-pyrroline concentration in aromatic rice grains collected in the same region in Japan and factors affecting its concentration. Plant Prod. Sci. 2004, 7, 178–183. [Google Scholar] [CrossRef]
  26. Wu, Y.F. Study on Suitability Evaluation of Ecological Geological Environment of Tea Planting Based on RS and GIS. Master’s Thesis, Guizhou University, Guiyang, China, 2019. [Google Scholar]
  27. Zhong, W.M.; Zhang, W.B.; Tang, D.M.; Yang, J.T.; Li, Z.C.; Qin, J. Climatic adaptability regionalization of actinidia deliciosain Guiyang area based on GIS. Guizhou Agric. Sci. 2022, 50, 125–131. [Google Scholar] [CrossRef]
  28. Huang, S.Z. Relationship between soil characteristics and rice quality in Hunan fragrant rice producing areas. Hunan Agric. Sci. 1990, 4, 37–40. [Google Scholar] [CrossRef]
  29. Bradbury, L.M.T.; Fitzgerald, T.L.; Henry, R.J.; Jin, Q.S.; Waters, D.L. The gene for fragrance in rice. Plant Biotechnol. J. 2005, 3, 363–370. [Google Scholar] [CrossRef] [PubMed]
  30. Imran, M.; Shafiq, S.; Ashraf, U.; Qi, J.Y.; Mo, Z.W.; Tang, X.R. Biosynthesis of 2-acetyl-1-pyrroline in fragrant rice: Recent insights into agro-management, environmental factors, and functional genomics. J. Agric. Food Chem. 2023, 71, 4201–4215. [Google Scholar] [CrossRef] [PubMed]
  31. Schieberle, P. Quantitation of important roast-smelling odorants in popcorn by stable isotope dilution assays and model studies on flavor formation during popping. J. Agric. Food Chem. 1995, 43, 2442–2448. [Google Scholar] [CrossRef]
  32. Huang, T.C.; Huang, Y.W.; Hung, H.J.; Ho, C.T.; Wu, M.L. Delta1-pyrroline-5-carboxylic acid formed by proline dehydrogenase from the Bacillus subtilis ssp. natto expressed in Escherichia coli as a precursor for 2-acetyl-1-pyrroline. J. Agric. Food Chem. 2007, 55, 5097–5102. [Google Scholar] [CrossRef]
  33. Huang, Z.L.; Tang, X.R.; Wang, Y.L.; Chen, M.J.; Zhao, Z.K.; Duan, M.Y.; Pan, S.G. Effects of increasing aroma cultivation on aroma and grain yield of aromatic rice and their mechanism. Sci. Agric. Sin. 2012, 45, 1054–1065. [Google Scholar]
  34. Li, M.J.; Ashraf, U.; Tian, H.; Mo, Z.W.; Pan, S.G.; Anjum, S.A.; Duan, M.Y.; Tang, X.R. Manganese-induced regulations in growth, yield formation, quality characters, rice aroma and enzyme involved in 2-acetyl-1-pyrroline biosynthesis in fragrant rice. Plant Physiol. Biochem. 2016, 103, 167–175. [Google Scholar] [CrossRef] [PubMed]
  35. Renuka, N.; Barvkar, V.T.; Ansari, Z.; Zhao, C.F.; Wang, C.L.; Zhang, Y.D.; Nadaf, A.B. Co-functioning of 2AP precursor amino acids enhances 2-acetyl-1-pyrroline under salt stress in aromatic rice (Oryza sativa L.) cultivars. Sci. Rep. 2022, 12, 3911. [Google Scholar] [CrossRef] [PubMed]
  36. Li, Y.; Zhang, W.T.; Li, M.Y.; Ling, X.T.; Guo, D.S.; Yang, Y.W.; Liu, Q.; Zhang, B.L.; Wang, J.Y. Discovery of OsODC as a key enhancer of aroma and development of highly fragrant rice. Plant Commun. 2025, 6, 101141. [Google Scholar] [CrossRef] [PubMed]
  37. Ghosh, P.; Roychoudhury, A. Differential levels of metabolites and enzymes related to aroma formation in aromatic indica rice varieties: Comparison with non-aromatic varieties. 3 Biotech 2018, 8, 25. [Google Scholar] [CrossRef]
  38. Banerjee, A.; Ghosh, P.; Roychoudhury, A. Differential regulation of genes co-involved in aroma production and stress amelioration during salt acclimation in indica rice cultivars. Biologia 2020, 75, 495–506. [Google Scholar] [CrossRef]
  39. Sharma, S.; Mustafiz, A.; Singla-Pareek, S.L.; Srivastava, P.S.; Sopry, S.K. Characterization of stress and methylglyoxal inducible triose phosphate isomerase (OscTPI) from rice. Plant Signal. Behav. 2012, 7, 1337–1345. [Google Scholar] [CrossRef]
  40. Huang, T.C.; Teng, C.S.; Chang, J.L.; Chang, H.S.; Ho, T.C.; Wu, M.L. Biosynthetic mechanism of 2-acetyl-1-pyrroline and its relationship with delta1-pyrroline-5-carboxylic acid and methylglyoxal in aromatic rice (Oryza sativa L.) callus. J. Agric. Food Chem. 2008, 56, 7399–7404. [Google Scholar] [CrossRef]
  41. Luo, H.W.; Zhang, Q.Q.; Lai, R.F.; Zhang, S.M.; Yi, W.T.; Tang, X.R. Regulation of 2-Acetyl-1-pyrroline Content in Fragrant Rice under Different Temperatures at the Grain-Filling Stage. J. Agric. Food Chem. 2024, 72, 10521–10530. [Google Scholar] [CrossRef]
Applsci 15 08781 g001
Figure 1. Differences in OsBadh2 expression levels and 2AP content of Dalixiang under different ecological environments. Note: (1) **. The difference is significant at the p < 0.01 level. (2) OsBadh2 gene expression level (A); 2AP content in leaves at heading stage (B); 2AP content in mature grains (C). (3) MT: Meitan planting point; GY: Guiyang planting point.
Figure 1. Differences in OsBadh2 expression levels and 2AP content of Dalixiang under different ecological environments. Note: (1) **. The difference is significant at the p < 0.01 level. (2) OsBadh2 gene expression level (A); 2AP content in leaves at heading stage (B); 2AP content in mature grains (C). (3) MT: Meitan planting point; GY: Guiyang planting point.
Applsci 15 08781 g001
Applsci 15 08781 g002
Figure 2. Differences in BADH2 enzyme activity and GABA content during the heading stage of Dalixiang under different ecological environments. Note: (1) **. The difference is significant at the p < 0.01 level. (2) BADH2 enzyme activity (A); GABA content (B). (3) MT: Meitan planting point; GY: Guiyang planting point.
Figure 2. Differences in BADH2 enzyme activity and GABA content during the heading stage of Dalixiang under different ecological environments. Note: (1) **. The difference is significant at the p < 0.01 level. (2) BADH2 enzyme activity (A); GABA content (B). (3) MT: Meitan planting point; GY: Guiyang planting point.
Applsci 15 08781 g002
Applsci 15 08781 g003
Figure 3. Differences in gene expression levels related to biosynthesis of 2AP during the heading stage of Dalixiang under different ecological environments. Note: (1) OsTPI gene expression level (A), OsProDH gene expression level (B), OsOAT gene expression level (C), OsP5CS gene expression level (D), OsGAPDH gene expression level (E). (2) **. There is a significant difference at the p < 0.01 level; ns. indicates no significant difference. (3) MT: Meitan planting site; GY: Guiyang planting site.
Figure 3. Differences in gene expression levels related to biosynthesis of 2AP during the heading stage of Dalixiang under different ecological environments. Note: (1) OsTPI gene expression level (A), OsProDH gene expression level (B), OsOAT gene expression level (C), OsP5CS gene expression level (D), OsGAPDH gene expression level (E). (2) **. There is a significant difference at the p < 0.01 level; ns. indicates no significant difference. (3) MT: Meitan planting site; GY: Guiyang planting site.
Applsci 15 08781 g003
Applsci 15 08781 g004
Figure 4. Differences in enzyme activity related to the biosynthesis of 2AP during the heading stage of Dalixiang under different ecological environments. Note: (1)TPI enzyme activity (A), ProDH enzyme activity (B), OAT enzyme activity (C), P5CS enzyme activity (D), GAPDH enzyme activity (E). (2) **. There is a significant difference at the p < 0.01 level; ns. indicates no significant difference. (3) MT: Meitan planting site; GY: Guiyang planting site.
Figure 4. Differences in enzyme activity related to the biosynthesis of 2AP during the heading stage of Dalixiang under different ecological environments. Note: (1)TPI enzyme activity (A), ProDH enzyme activity (B), OAT enzyme activity (C), P5CS enzyme activity (D), GAPDH enzyme activity (E). (2) **. There is a significant difference at the p < 0.01 level; ns. indicates no significant difference. (3) MT: Meitan planting site; GY: Guiyang planting site.
Applsci 15 08781 g004
Applsci 15 08781 g005
Figure 5. Differences in substrate content related to biosynthesis of 2AP during the heading stage in Dalixiang under different ecological environments. Note: (1) MG content (A), proline content (B), ornithine content (C), glutamic acid content (D), pyruvic acid content (E). (2) **. There is a significant difference at the p < 0.01 level; ns. indicates no significant difference. (3) MT: Meitan planting site; GY: Guiyang planting site.
Figure 5. Differences in substrate content related to biosynthesis of 2AP during the heading stage in Dalixiang under different ecological environments. Note: (1) MG content (A), proline content (B), ornithine content (C), glutamic acid content (D), pyruvic acid content (E). (2) **. There is a significant difference at the p < 0.01 level; ns. indicates no significant difference. (3) MT: Meitan planting site; GY: Guiyang planting site.
Applsci 15 08781 g005
Table 1. Correlation analysis of 2AP content in leaves at the heading stage and grains at the maturity stage of Dalixiang.
Table 1. Correlation analysis of 2AP content in leaves at the heading stage and grains at the maturity stage of Dalixiang.
2AP Content in Leaves at the
Heading Stage		2AP Content in Grain at Maturity
2AP content in leaves at the heading stage1.0000.667 **
Note: **. The correlation was significant at 0.01 tails (two-tailed).
Table 2. Differences in nutrient content of soil in different ecological environments.
Table 2. Differences in nutrient content of soil in different ecological environments.
Soil NutrientPlanting Point
MTGY
Ammonium nitrogen (mg/kg)9.42 ± 0.072 b10.73 ± 0.122 a
Nitrate nitrogen (mg/kg)0.118 ± 0.006 a0.125 ± 0.003 a
pH6.73 ± 0.017 b6.88 ± 0.039 a
Organic matter (g/kg)26.38 ± 0.167 b41.89 ± 0.163 a
Total nitrogen (g/kg)2.54 ± 0.109 b3.45 ± 0.062 a
Total phosphorus (g/kg)0.645 ± 0.011 a0.644 ± 0.029 a
Total potassium (g/kg)11.49 ± 0.129 a9.57 ± 0.052 b
Available phosphorus (mg/kg)31.75 ± 0.296 a15.42 ± 0.225 b
Fast-acting potassium (mg/kg)124.43 ± 3.766 a58.82 ± 0.513 b
Alkaline hydrolyzable nitrogen (mg/kg)128.19 ± 0.386 b212.52 ± 0.696 a
Note: (1) Different lowercase letters indicate significant differences at the p < 0.05 level. (2) MT: Meitan planting site; GY: Guiyang planting site.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Que, T.; Gong, Y.; Wang, Q.; Wang, Z.; Long, W.; Wu, X.; Zhu, S. Effects of Different Planting Environments on the Fragrance of Dalixiang (Oryza sativa L.). Appl. Sci. 2025, 15, 8781. https://doi.org/10.3390/app15168781

AMA Style

Que T, Gong Y, Wang Q, Wang Z, Long W, Wu X, Zhu S. Effects of Different Planting Environments on the Fragrance of Dalixiang (Oryza sativa L.). Applied Sciences. 2025; 15(16):8781. https://doi.org/10.3390/app15168781

Chicago/Turabian Style

Que, Tao, Yanlong Gong, Qian Wang, Zhongni Wang, Wuhua Long, Xian Wu, and Susong Zhu. 2025. "Effects of Different Planting Environments on the Fragrance of Dalixiang (Oryza sativa L.)" Applied Sciences 15, no. 16: 8781. https://doi.org/10.3390/app15168781

APA Style

Que, T., Gong, Y., Wang, Q., Wang, Z., Long, W., Wu, X., & Zhu, S. (2025). Effects of Different Planting Environments on the Fragrance of Dalixiang (Oryza sativa L.). Applied Sciences, 15(16), 8781. https://doi.org/10.3390/app15168781

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop