Immune-Enhancing Effects of Marine Algae Extracts: Modulation of Macrophage Activation by Sargassum horneri, Sargassum fusiforme, and Undaria pinnatifida
Abstract
:1. Introduction
2. Materials and Methods
2.1. SH, UP, and SF Extract Preparation
2.2. Cell Culture and Reagents
2.3. Cell Viability Assay
2.4. NO Assay
2.5. RNA Isolation and Real-Time Reverse Transcription Polymerase Chain Reaction (RT-PCR)
2.6. Quantification of Cytokine Levels
2.7. Phagocytosis Assay
2.8. Statistical Analysis
3. Results
3.1. The Seaweed Extracts Induce RAW 264.7 Cell Proliferation
3.2. The Seaweed Extracts Induce Inflammation-Related Cytokine Expression in RAW 264.7 Cells
3.3. The Seaweed Extracts Induce NO, Ptgs2, and PGE2 Production in RAW 264.7 Cells
3.4. The Seaweed Extracts Influence the Phagocytosis Activity of Macrophages
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Frisch, M.; Biggar, R.J.; Engels, E.A.; Goedert, J.J.; AIDS-Cancer Match Registry Study Group. Association of cancer with AIDS-related immunosuppression in adults. JAMA 2001, 285, 1736–1745. [Google Scholar] [CrossRef]
- Tauber, A.I. Metchnikoff and the phagocytosis theory. Nat. Rev. Mol. Cell Biol. 2003, 4, 897–901. [Google Scholar] [CrossRef]
- Park, E.-J.; Lee, H.-J. Immunomodulatory effects of fermented Platycodon grandiflorum extract through NF-κB signaling in RAW 264.7 cells. Nutr. Res. Pract. 2020, 14, 453–462. [Google Scholar] [CrossRef] [PubMed]
- Sieweke, M.H.; Allen, J.E. Beyond stem cells: Self-renewal of differentiated macrophages. Science 2013, 342, 1242974. [Google Scholar] [CrossRef] [PubMed]
- Arango Duque, G.; Descoteaux, A. Macrophage cytokines: Involvement in immunity and infectious diseases. Front. Immunol. 2014, 5, 491. [Google Scholar] [CrossRef] [PubMed]
- Fiorentino, D.F.; Zlotnik, A.; Mosmann, T.R.; Howard, M.; O’Garra, A. IL-10 inhibits cytokine production by activated macrophages. J. Immunol. 1991, 147, 3815–3822. [Google Scholar] [CrossRef] [PubMed]
- Park, E.-J.; Lee, Y.-S.; Kim, S.M.; Jung, A.J.; Yoo, J.-H.; Lee, S.-H.; Jeong, H.C.; Lee, H.-J. Immune-enhancing effects of red Platycodon grandiflorus root extract via p38 MAPK-mediated NF-κB activation. Appl. Sci. 2020, 10, 5457. [Google Scholar] [CrossRef]
- Nathan, C. Nitric oxide as a secretory product of mammalian cells. FASEB J. 1992, 6, 3051–3064. [Google Scholar] [CrossRef]
- Palmieri, E.M.; McGinity, C.; Wink, D.A.; McVicar, D.W. Nitric oxide in macrophage immunometabolism: Hiding in plain sight. Metabolites 2020, 10, 429. [Google Scholar] [CrossRef]
- Murakami, A.; Ohigashi, H. Targeting NOX, INOS and COX-2 in inflammatory cells: Chemoprevention using food phytochemicals. Int. J. Cancer 2007, 121, 2357–2363. [Google Scholar] [CrossRef]
- Hu, Z.-Q.; Asano, K.; Seki, H.; Shimamura, T. An essential role of prostaglandin E on mouse mast cell induction. J. Immunol. 1995, 155, 2134–2142. [Google Scholar] [CrossRef]
- Aronoff, D.M.; Canetti, C.; Peters-Golden, M. Prostaglandin E2 inhibits alveolar macrophage phagocytosis through an E-prostanoid 2 receptor-mediated increase in intracellular cyclic AMP. J. Immunol. 2004, 173, 559–565. [Google Scholar] [CrossRef]
- Serezani, C.H.; Chung, J.; Ballinger, M.N.; Moore, B.B.; Aronoff, D.M.; Peters-Golden, M. Prostaglandin E2 suppresses bacterial killing in alveolar macrophages by inhibiting NADPH oxidase. Am. J. Respir. Cell Mol. Biol. 2007, 37, 562–570. [Google Scholar] [CrossRef] [PubMed]
- Tabarzad, M.; Atabaki, V.; Hosseinabadi, T. Anti-inflammatory activity of bioactive compounds from microalgae and cyanobacteria by focusing on the mechanisms of action. Mol. Biol. Rep. 2020, 47, 6193–6205. [Google Scholar] [CrossRef]
- Dimova, V.; Sencheva-Petrevska, M.; Jankulovska-Petkovska, M. Vitamin C equivalent antioxidant capacity prediction for set of flavones which influence food quality. J. Agric. Food Environ. Sci. JAFES 2022, 76, 28–35. [Google Scholar] [CrossRef]
- Rahman, M.M.; Dhar, P.S.; Anika, F.; Ahmed, L.; Islam, M.R.; Sultana, N.A.; Cavalu, S.; Pop, O.; Rauf, A. Exploring the plant-derived bioactive substances as antidiabetic agent: An extensive review. Biomed. Pharmacother. 2022, 152, 113217. [Google Scholar] [CrossRef] [PubMed]
- Costa, M.; Cardoso, C.; Afonso, C.; Bandarra, N.M.; Prates, J.A. Current knowledge and future perspectives of the use of seaweeds for livestock production and meat quality: A systematic review. J. Anim. Physiol. Anim. Nutr. 2021, 105, 1075–1102. [Google Scholar] [CrossRef]
- Qiu, S.-M.; Aweya, J.J.; Liu, X.; Liu, Y.; Tang, S.; Zhang, W.; Cheong, K.-L. Bioactive polysaccharides from red seaweed as potent food supplements: A systematic review of their extraction, purification, and biological activities. Carbohydr. Polym. 2022, 275, 118696. [Google Scholar] [CrossRef]
- Admassu, H.; Gasmalla, M.A.; Yang, R.; Zhao, W. Identification of bioactive peptides with α-amylase inhibitory potential from enzymatic protein hydrolysates of red seaweed (Porphyra spp.). J. Agric. Food Chem. 2018, 66, 4872–4882. [Google Scholar] [CrossRef]
- Carson, M.A.; Clarke, S.A. Bioactive compounds from marine organisms: Potential for bone growth and healing. Mar. Drugs 2018, 16, 340. [Google Scholar] [CrossRef]
- Øverland, M.; Mydland, L.T.; Skrede, A. Marine macroalgae as sources of protein and bioactive compounds in feed for monogastric animals. J. Sci. Food Agric. 2019, 99, 13–24. [Google Scholar] [CrossRef]
- Khalid, S.; Abbas, M.; Saeed, F.; Bader-Ul-Ain, H.; Suleria, H.A.R. Therapeutic Potential of Seaweed Bioactive Compounds; IntechOpen: London, UK, 2018. [Google Scholar]
- Rai, S.K.; Smriti, B.; Gunaseelan, S.; Ashokkumar, B.; Varalakshmi, P. Polyphenolic Compound from Brown Macroalga padina tetrastromatica Imparts Oxidative Stress Tolerance in SH-SY5Y, RAW 264.7, HeLa Cell Lines and in Caenorhabditis elegans. ChemistrySelect 2019, 4, 6342–6347. [Google Scholar] [CrossRef]
- Ruan, B.-F.; Ge, W.-W.; Lin, M.-X.; Li, Q.-S. A review of the components of seaweeds as potential candidates in cancer therapy. Anti-Cancer Agents Med. Chem. 2018, 18, 354–366. [Google Scholar] [CrossRef]
- Ghannam, A.; Murad, H.; Jazzara, M.; Odeh, A.; Allaf, A.W. Isolation, Structural characterization, and antiproliferative activity of phycocolloids from the red seaweed Laurencia papillosa on MCF-7 human breast cancer cells. Int. J. Biol. Macromol. 2018, 108, 916–926. [Google Scholar] [CrossRef]
- Desamero, M.J.; Kakuta, S.; Chambers, J.K.; Uchida, K.; Hachimura, S.; Takamoto, M.; Nakayama, J.; Nakayama, H.; Kyuwa, S. Orally administered brown seaweed-derived β-glucan effectively restrained development of gastric dysplasia in A4gnt KO mice that spontaneously develop gastric adenocarcinoma. Int. Immunopharmacol. 2018, 60, 211–220. [Google Scholar] [CrossRef] [PubMed]
- Martins, R.M.; Nedel, F.; Guimarães, V.B.; Da Silva, A.F.; Colepicolo, P.; De Pereira, C.M.; Lund, R.G. Macroalgae extracts from Antarctica have antimicrobial and anticancer potential. Front. Microbiol. 2018, 9, 412. [Google Scholar] [CrossRef]
- Rocha, D.H.; Seca, A.M.; Pinto, D.C. Seaweed secondary metabolites in vitro and in vivo anticancer activity. Mar. Drugs 2018, 16, 410. [Google Scholar] [CrossRef] [PubMed]
- Sharifuddin, Y.; Chin, Y.-X.; Lim, P.-E.; Phang, S.-M. Potential bioactive compounds from seaweed for diabetes management. Mar. Drugs 2015, 13, 5447–5491. [Google Scholar] [CrossRef] [PubMed]
- Kim, D.-W.; Sapkota, K.; Choi, J.-H.; Kim, Y.-S.; Kim, S.; Kim, S.-J. Direct acting anti-thrombotic serine protease from brown seaweed Costaria costata. Process Biochem. 2013, 48, 340–350. [Google Scholar] [CrossRef]
- Kellogg, J.; Esposito, D.; Grace, M.H.; Komarnytsky, S.; Lila, M.A. Alaskan seaweeds lower inflammation in RAW 264.7 macrophages and decrease lipid accumulation in 3T3-L1 adipocytes. J. Funct. Foods 2015, 15, 396–407. [Google Scholar] [CrossRef]
- Yi, L.; Wang, Q.; Luo, H.; Lei, D.; Tang, Z.; Lei, S.; Xiao, H. Inhibitory effects of polyphenols-rich components from three edible seaweeds on inflammation and colon cancer in vitro. Front. Nutr. 2022, 9, 856273. [Google Scholar] [CrossRef]
- Olsthoorn, S.E.; Wang, X.; Tillema, B.; Vanmierlo, T.; Kraan, S.; Leenen, P.J.; Mulder, M.T. Brown seaweed food supplementation: Effects on allergy and inflammation and its consequences. Nutrients 2021, 13, 2613. [Google Scholar] [CrossRef]
- Lange, K.W.; Hauser, J.; Nakamura, Y.; Kanaya, S. Dietary seaweeds and obesity. Food Sci. Hum. Wellness 2015, 4, 87–96. [Google Scholar] [CrossRef]
- Cardoso, S.M.; Pereira, O.R.; Seca, A.M.; Pinto, D.C.; Silva, A.M. Seaweeds as preventive agents for cardiovascular diseases: From nutrients to functional foods. Mar. Drugs 2015, 13, 6838–6865. [Google Scholar] [CrossRef]
- Pereira, L. Edible Seaweeds of the World; CRC Press: Boca Raton, FL, USA, 2016. [Google Scholar]
- Craigie, J.S. Seaweed extract stimuli in plant science and agriculture. J. Appl. Phycol. 2011, 23, 371–393. [Google Scholar] [CrossRef]
- Pereira, L. Seaweeds as source of bioactive substances and skin care therapy—Cosmeceuticals, algotheraphy, and thalassotherapy. Cosmetics 2018, 5, 68. [Google Scholar] [CrossRef]
- Shannon, E.; Abu-Ghannam, N. Antibacterial derivatives of marine algae: An overview of pharmacological mechanisms and applications. Mar. Drugs 2016, 14, 81. [Google Scholar] [CrossRef]
- Li, B.; Lu, F.; Wei, X.; Zhao, R. Fucoidan: Structure and bioactivity. Molecules 2008, 13, 1671–1695. [Google Scholar] [CrossRef] [PubMed]
- Berteau, O.; Mulloy, B. Sulfated fucans, fresh perspectives: Structures, functions, and biological properties of sulfated fucans and an overview of enzymes active toward this class of polysaccharide. Glycobiology 2003, 13, 29R–40R. [Google Scholar] [CrossRef] [PubMed]
- Lu, J.; Shi, K.K.; Chen, S.; Wang, J.; Hassouna, A.; White, L.N.; Merien, F.; Xie, M.; Kong, Q.; Li, J. Fucoidan extracted from the New Zealand Undaria pinnatifida—Physicochemical comparison against five other fucoidans: Unique low molecular weight fraction bioactivity in breast cancer cell lines. Mar. Drugs 2018, 16, 461. [Google Scholar] [CrossRef]
- Mandal, P.; Mateu, C.G.; Chattopadhyay, K.; Pujol, C.A.; Damonte, E.B.; Ray, B. Structural features and antiviral activity of sulphated fucans from the brown seaweed Cystoseira indica. Antivir. Chem. Chemother. 2007, 18, 153–162. [Google Scholar] [CrossRef] [PubMed]
- Xu, Y.; Xu, J.; Ge, K.; Tian, Q.; Zhao, P.; Guo, Y. Anti-inflammatory effect of low molecular weight fucoidan from Saccharina japonica on atherosclerosis in apoE-knockout mice. Int. J. Biol. Macromol. 2018, 118, 365–374. [Google Scholar] [CrossRef] [PubMed]
- Decharneux, T.; Dubois, F.; Beauloye, C.; De Coninck, S.W.; Wattiaux, R. Effect of various flavonoids on lysosomes subjected to an oxidative or an osmotic stress. Biochem. Pharmacol. 1992, 44, 1243–1248. [Google Scholar] [CrossRef]
- Sharma, A.; Jaiswal, V.; Park, M.; Lee, H.-J. Biogenic silver NPs alleviate LPS-induced neuroinflammation in a human fetal brain-derived cell line: Molecular switch to the M2 phenotype, modulation of TLR4/MyD88 and Nrf2/HO-1 signaling pathways, and molecular docking analysis. Biomater. Adv. 2023, 148, 213363. [Google Scholar] [CrossRef] [PubMed]
- Sanjay; Sharma, A.; Lee, H.-J. Honeyberry-derived carbon quantum dots ameliorate LPS-induced neuroinflammation and oxidative stress through Nrf2/HO-1 signalling in HMC3 cells. Artif. Cells Nanomed. Biotechnol. 2023, 51, 95–107. [Google Scholar]
- Mosser, D.M.; Zhang, X. Interleukin-10: New perspectives on an old cytokine. Immunol. Rev. 2008, 226, 205–218. [Google Scholar] [CrossRef] [PubMed]
- Oberley, R.E.; Ault, K.A.; Neff, T.L.; Khubchandani, K.R.; Crouch, E.C.; Snyder, J.M. Surfactant proteins A and D enhance the phagocytosis of Chlamydia into THP-1 cells. Am. J. Physiol. Lung Cell. Mol. Physiol. 2004, 287, L296–L306. [Google Scholar] [CrossRef] [PubMed]
- Monobe, M.; Ema, K.; Tokuda, Y.; Maeda-Yamamoto, M. Enhancement of phagocytic activity of macrophage-like cells by pyrogallol-type green tea polyphenols through caspase signaling pathways. Cytotechnology 2010, 62, 201–203. [Google Scholar] [CrossRef]
- Zheng, D.; Liwinski, T.; Elinav, E. Interaction between microbiota and immunity in health and disease. Cell Res. 2020, 30, 492–506. [Google Scholar] [CrossRef]
- Matsukawa, A.; Hogaboam, C.; Lukacs, N.; Kunkel, S. Chemokines and innate immunity. Rev. Immunogenet. 2000, 2, 339–358. [Google Scholar]
- Fitzgerald, K.A.; Kagan, J.C. Toll-like receptors and the control of immunity. Cell 2020, 180, 1044–1066. [Google Scholar] [CrossRef] [PubMed]
- Levin, R.; Grinstein, S.; Canton, J. The life cycle of phagosomes: Formation, maturation, and resolution. Immunol. Rev. 2016, 273, 156–179. [Google Scholar] [CrossRef] [PubMed]
- Zhuang, M.; Liu, J.; Ding, X.; He, J.; Zhao, S.; Wu, L.; Gao, S.; Zhao, C.; Liu, D.; Zhang, J. Sargassum blooms in the East China Sea and Yellow Sea: Formation and management. Mar. Pollut. Bull. 2021, 162, 111845. [Google Scholar] [CrossRef]
- Byeon, S.Y.; Cheon, K.-S.; Kim, S.; Yun, S.-H.; Oh, H.-J.; Park, S.R.; Kim, T.-H.; Kim, J.K.; Lee, H.J. Comparative analysis of sequence polymorphism in complete organelle genomes of the ‘Golden Tide’ seaweed Sargassum horneri between Korean and Chinese forms. Sustainability 2020, 12, 7280. [Google Scholar] [CrossRef]
- Liu, F.; Liu, X.; Wang, Y.; Jin, Z.; Moejes, F.W.; Sun, S. Insights on the Sargassum horneri golden tides in the Yellow Sea inferred from morphological and molecular data. Limnol. Oceanogr. 2018, 63, 1762–1773. [Google Scholar] [CrossRef]
- Lee, B.-J.; Lee, S.-M.; Hyun, J.-H.; Kim, Y.-Y. Durability Performances of Concrete Produced with Recycled Bio-Polymer Based on Sargassum honeri. J. Korean Recycl. Constr. Resour. Inst. 2019, 7, 445–451. [Google Scholar]
- Madhavaraj, L.; Lim, H.-D.; Kim, K.-M.; Kim, D.-H.; Han, G.H. Influence of Sargassum horneri Mitigating odorous gas emissions from swine manure storage facilities. Sustainability 2020, 12, 7587. [Google Scholar] [CrossRef]
- Sanjeewa, K.A.; Jayawardena, T.U.; Lee, H.G.; Herath, K.H.I.N.M.; Jee, Y.; Jeon, Y.-J. The protective effect of Sargassum horneri against particulate matter-induced inflammation in lung tissues of an in vivo mouse asthma model. Food Funct. 2019, 10, 7995–8004. [Google Scholar] [CrossRef]
- Dias, M.K.H.M.; Madusanka, D.M.D.; Han, E.J.; Kim, H.-S.; Jeon, Y.-J.; Jee, Y.; Kim, K.-N.; Lee, K.; Fernando, I.P.S.; Ahn, G. Sargassum horneri (Turner) C. Agardh ethanol extract attenuates fine dust-induced inflammatory responses and impaired skin barrier functions in HaCaT keratinocytes. J. Ethnopharmacol. 2021, 273, 114003. [Google Scholar] [CrossRef]
- Shao, P.; Chen, X.; Sun, P. Chemical characterization, antioxidant and antitumor activity of sulfated polysaccharide from Sargassum horneri. Carbohydr. Polym. 2014, 105, 260–269. [Google Scholar] [CrossRef]
- Ko, W.; Lee, H.; Kim, N.; Jo, H.G.; Woo, E.-R.; Lee, K.; Han, Y.S.; Park, S.R.; Ahn, G.; Cheong, S.H. The anti-oxidative and anti-neuroinflammatory effects of sargassum horneri by heme oxygenase-1 induction in BV2 and HT22 cells. Antioxidants 2021, 10, 859. [Google Scholar] [CrossRef]
- Herath, K.H.I.N.M.; Cho, J.; Kim, A.; Kim, H.-S.; Han, E.J.; Kim, H.J.; Kim, M.S.; Ahn, G.; Jeon, Y.-J.; Jee, Y. Differential modulation of immune response and cytokine profiles of Sargassum horneri ethanol extract in murine spleen with or without Concanavalin A stimulation. Biomed. Pharmacother. 2019, 110, 930–942. [Google Scholar] [CrossRef]
- South, P.M.; Floerl, O.; Forrest, B.M.; Thomsen, M.S. A review of three decades of research on the invasive kelp Undaria pinnatifida in Australasia: An assessment of its success, impacts and status as one of the world’s worst invaders. Mar. Environ. Res. 2017, 131, 243–257. [Google Scholar] [CrossRef]
- Khan, M.N.A.; Cho, J.-Y.; Lee, M.-C.; Kang, J.-Y.; Park, N.G.; Fujii, H.; Hong, Y.-K. Isolation of two anti-inflammatory and one pro-inflammatory polyunsaturated fatty acids from the brown seaweed Undaria pinnatifida. J. Agric. Food Chem. 2007, 55, 6984–6988. [Google Scholar] [CrossRef]
- Han, J.; Kang, S.; Choue, R.; Kim, H.; Leem, K.; Chung, S.; Kim, C.; Chung, J. Free radical scavenging effect of Diospyros kaki, Laminaria japonica and Undaria pinnatifida. Fitoterapia 2002, 73, 710–712. [Google Scholar] [CrossRef]
- Maruyama, H.; Tamauchi, H.; Hashimoto, M.; Nakano, T. Antitumor activity and immune response of Mekabu fucoidan extracted from Sporophyll of Undaria pinnatifida. In Vivo 2003, 17, 245–249. [Google Scholar] [PubMed]
- Lee, S.J.; Lee, H.S.; Kim, S.Y.; Shin, K.-S. Immunostimulatory and anti-metastatic activity of polysaccharides isolated from byproducts of the corn starch industry. Carbohydr. Polym. 2018, 181, 911–917. [Google Scholar] [CrossRef] [PubMed]
- Kim, H.I.; Kim, D.-S.; Jung, Y.; Sung, N.-Y.; Kim, M.; Han, I.-J.; Nho, E.Y.; Hong, J.H.; Lee, J.-K.; Boo, M. Immune-Enhancing Effect of Sargassum horneri on Cyclophosphamide-Induced Immunosuppression in BALB/c Mice and Primary Cultured Splenocytes. Molecules 2022, 27, 8253. [Google Scholar] [CrossRef]
- Yu, Y.; Zhang, Y.; Hu, C.; Zou, X.; Lin, Y.; Xia, Y.; You, L. Chemistry and immunostimulatory activity of a polysaccharide from Undaria pinnatifida. Food Chem. Toxicol. 2019, 128, 119–128. [Google Scholar] [CrossRef] [PubMed]
- Stefaniak–Vidarsson, M.M.; Gudjónsdóttir, M.; Marteinsdottir, G.; Sigurjonsson, O.E.; Kristbergsson, K. Evaluation of bioactivity of fucoidan from laminaria with in vitro human cell cultures (THP-1). Funct. Foods Health Dis. 2017, 7, 688–701. [Google Scholar] [CrossRef]
- Park, C.; Cha, H.-J.; Lee, H.; Kim, G.-Y.; Choi, Y.H. The regulation of the TLR4/NF-κB and Nrf2/HO-1 signaling pathways is involved in the inhibition of lipopolysaccharide-induced inflammation and oxidative reactions by morroniside in RAW 264.7 macrophages. Arch. Biochem. Biophys. 2021, 706, 108926. [Google Scholar] [CrossRef] [PubMed]
- Alomar, S.Y.; Gheit, R.E.A.E.; Enan, E.T.; El-Bayoumi, K.S.; Shoaeir, M.Z.; Elkazaz, A.Y.; Al Thagfan, S.S.; Zaitone, S.A.; El-Sayed, R.M. Novel mechanism for memantine in attenuating diabetic neuropathic pain in mice via downregulating the spinal HMGB1/TRL4/NF-kB inflammatory axis. Pharmaceuticals 2021, 14, 307. [Google Scholar] [CrossRef]
- Azam, S.; Jakaria, M.; Kim, I.-S.; Kim, J.; Haque, M.E.; Choi, D.-K. Regulation of toll-like receptor (TLR) signaling pathway by polyphenols in the treatment of age-linked neurodegenerative diseases: Focus on TLR4 signaling. Front. Immunol. 2019, 10, 1000. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Xie, C.; Zhuang, J.; Li, H.; Yao, Y.; Shao, C.; Wang, H. Resveratrol attenuates inflammation in the rat heart subjected to ischemia-reperfusion: Role of the TLR4/NF-κB signaling pathway. Mol. Med. Rep. 2015, 11, 1120–1126. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Smith, W.; Hao, D.; He, B.; Kong, L. M1 and M2 macrophage polarization and potentially therapeutic naturally occurring compounds. Int. Immunopharmacol. 2019, 70, 459–466. [Google Scholar] [CrossRef] [PubMed]
- Bogdan, C. Nitric oxide and the immune response. Nat. Immunol. 2001, 2, 907–916. [Google Scholar] [CrossRef]
- Takeda, K.; Tomimori, K.; Kimura, R.; Ishikawa, C.; Nowling, T.K.; Mori, N. Anti-tumor activity of fucoidan is mediated by nitric oxide released from macrophages. Int. J. Oncol. 2012, 40, 251–260. [Google Scholar]
- Fajriah, S.; Handayani, S.; Sinurat, E.; Megawati, M.; Darmawan, A.; Hariyanti, H.; Dewi, R.T.; Septama, A.W. In vitro Immunomodulatory Effect from Edible Green Seaweed of Caulerpa lentillifera Extracts on Nitric Oxide Production and Phagocytosis Activity of RAW 264.7 Murine Macrophage Cells. J. Young Pharm. 2020, 12, 334. [Google Scholar] [CrossRef]
No | Gene | Primer Sequences (5′-3′) |
---|---|---|
1. | IL-1β | GGGCCTCAAAGGAAAGAATC |
TACCAGTTGGGGAACTCTGC | ||
2. | TNF-α | ATGAGCACAGAAAGCATGATC |
TACAGGCTTGTCACTCGAATT | ||
3. | IL-6 | AGTTGCCTTCTTGGGACTGA |
CAGAATTGCCATTGCACAAC | ||
4. | iNOS (Nos2) | TTCCAGAATCCCTGGACAAG |
TGGTCAAACTCTTGGGGTTC | ||
5. | COX-2 (Ptgs2) | AGAAGGAAATGGCTGCAGAA |
GCTCGGCTTCCAGTATTGAG | ||
6. | IL-12 | GGAAGCACGGCAGCAGAATA |
AACTTGAGGGAGAAGTAGGAATGG | ||
7. | IL-10 | AGAAGCATGGCCCAGAAATC |
CCAAGGAGTTGTTTCCGTTAGC | ||
8. | β-actin (Actb) | CATTGCTGACAGGATGCAGAAGG |
TGCTGGAAGGTGGACAGTGAGG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sanjay; Yoon, N.Y.; Park, E.-J.; Lee, H.-J. Immune-Enhancing Effects of Marine Algae Extracts: Modulation of Macrophage Activation by Sargassum horneri, Sargassum fusiforme, and Undaria pinnatifida. Appl. Sci. 2024, 14, 1794. https://doi.org/10.3390/app14051794
Sanjay, Yoon NY, Park E-J, Lee H-J. Immune-Enhancing Effects of Marine Algae Extracts: Modulation of Macrophage Activation by Sargassum horneri, Sargassum fusiforme, and Undaria pinnatifida. Applied Sciences. 2024; 14(5):1794. https://doi.org/10.3390/app14051794
Chicago/Turabian StyleSanjay, Na Young Yoon, Eun-Jung Park, and Hae-Jeung Lee. 2024. "Immune-Enhancing Effects of Marine Algae Extracts: Modulation of Macrophage Activation by Sargassum horneri, Sargassum fusiforme, and Undaria pinnatifida" Applied Sciences 14, no. 5: 1794. https://doi.org/10.3390/app14051794