Next Article in Journal
The Relationship between Genetic Variability and Seasonal Changes in Vertical Jump Performance in Amateur Soccer Players
Previous Article in Journal
Study of Slope Stability of the Mining Wall in an Open-Pit Coal Mine by the Paste Cut-and-Backfill Method
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Biocontrol of Aflatoxin-Producing Aspergillus flavus ATCC 22546 by a Non-Aflatoxigenic Aspergillus flavus ATCC 9643

1
Department of Applied Biosciences, Kyungpook National University, Daegu 41566, Republic of Korea
2
Department of Integrative Biology, Kyungpook National University, Daegu 41566, Republic of Korea
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Appl. Sci. 2024, 14(14), 6142; https://doi.org/10.3390/app14146142
Submission received: 6 June 2024 / Revised: 11 July 2024 / Accepted: 11 July 2024 / Published: 15 July 2024
(This article belongs to the Section Agricultural Science and Technology)

Abstract

Featured Application

Biocontrol of aflatoxin-producing Aspergillus flavus ATCC 22546 and the inhibitory effect on aflatoxin biosynthesis of a non-aflatoxigenic Aspergillus flavus ATCC 9643.

Abstract

The biological control of Aspergillus flavus and A. parasiticus by non-aflatoxigenic strains has been introduced in cotton- and peanut-cultivating fields and proven successful at reducing aflatoxin (AFB) contamination of crops and agricultural soils. In this study, a non-aflatoxigenic strain, A. flavus ATCC 9643 (ATCC 9643), was evaluated for its ability to competitively inhibit the growth of an aflatoxigenic strain, A. flavus ATCC 22546 (ATCC 22546), and mitigate AFB production in ATCC 22546 during competitive growth. To comparatively analyze the suppressive effect of ATCC 9643 on ATCC 22546, a non-aflatoxigenic strain (A. flavus ATCC 96045, known as AF36) was used as a positive control in some experiments. The two non-aflatoxigenic strains did not produce AFB1 or AFB2 owing to the absence of several AFB biosynthesis-related genes, especially aflK and aflL, which encode versicolorin B synthase and desaturase, respectively. To create a competitive growth environment, ATCC 9643 and ATCC 22546 were co-inoculated into a solid agar medium, and they grew at similar rates when added at a 1:1 ratio. Increasing the inoculum rate of ATCC 9643 (1:1, 1:3, 1:5) dramatically inhibited ATCC 22546 growth, and AFB production was effectively decreased by about 84%, 95%, and 97% by treatment with ATCC 9643. On rice, ATCC 22546 attenuated ATCC 9643 growth only when the rice was submerged in distilled water, whereas agar addition enhanced it. Taken together, ATCC 9643 is a promising candidate biological agent for suppressing aflatoxigenic A. flavus strain growth and alleviating AFB contamination. Further studies on AFB reduction in crop fields, including cotton-cultivation and maize-cultivation fields, are warranted.

1. Introduction

Aflatoxins, mycotoxins mainly produced by fungi of the genus Aspergillus, exert liver cancer-causing effects in humans and are classified as International Agency for Research on Cancer Group IA and 2B carcinogens [1,2,3]. Therefore, several countries set maximum residue levels for aflatoxins in agricultural products and processed meat products, strictly enforce regulations, and conduct relevant risk assessments in foods [4,5]. Consumers are exposed to the mycotoxins through infection with fungal strains during the pre- or post-harvest process, and Hazard Analysis and Critical Control Points have been introduced to prevent mycotoxin contamination and mitigate its risk [3,6,7]. Nevertheless, contamination with mycotoxins, such as aflatoxin, is possible depending on the consumption habits and agricultural product storage practice of each ethnic group, including Koreans. As a representative example, Korean doenjang is a type of fermented soybean paste made from steamed soybeans that have been dried in sunlight for a long time and aged under natural conditions. Notwithstanding, it exhibits high aflatoxin contamination [8,9].
In this regard, various aflatoxin reduction methods, including ammoniation, are available, especially for agricultural products [10,11]. However, in numerous cases, the global average or permissible aflatoxin content has been exceeded, and more efficient reduction methods are urgently required [8,12,13]. As a control measure, chemical fungicides are being used to directly sterilize aflatoxin-producing Aspergillus spp. [14], and certain constituents of conventional fungicides are being developed for use as food additives [15,16]. Aflatoxin detoxification has been introduced in the agricultural industry to minimize or remove aflatoxins from agricultural products using microorganisms and enzymes [17]. The long-term viability of these approaches is a concern due to their incomplete effectiveness and environmental impact, especially with the use of fungicides to manage A. flavus potentially leading to fungicide-resistant mold strains, environmental pollution, and risks to food safety, highlighting the urgent need for environmentally friendly agricultural practices aligned with food safety standards [18,19]. Interestingly, biological control strategies have also been employed to control aflatoxin contamination in agricultural products.
A successful example of a biological control method for Aspergillus spp. is the fundamental blocking of infection by aflatoxin-producing Aspergillus spp. using non-aflatoxin-producing Aspergillus spp., as they become the dominant species during the cultivation of agricultural products in pistachio fields [20,21]. The non-aflatoxin-producing Aspergillus spp. used in previous studies is the A. flavus AF36 strain, which is registered with the United States Department of Agriculture and is the first known aflatoxin biocontrol agent to be formulated and used in cotton seed fields [22]. This strain originates from Yuma Valley, Arizona [23], and is registered in the United States (US) as a biocontrol agent for minimizing aflatoxin contamination in agricultural product-cultivation fields, especially almond, fig, and pistachio fields [20,24]. However, none of these studies have determined the extent of aflatoxin reduction via AF36 treatment in the field.
In addition, as important yeast-based biocontrol agents, Candida oleophila, Aureobasidium pullulans, Metschnikowia fructicola, Cryptococcus albidus, and Saccharomyces cerevisiae reportedly control diverse microbes owing to their excellent inhibitory effects, safety and registration issues, mass production requirements, ease of handling with various formulations, and applicability in the field [25,26,27]. Among them, A. pullulans has been tested for the control of A. flavus in vitro and on tomato plants, demonstrating a reduction in mycelial growth and the inhibition of spore germination [28]. However, the foregoing study did not consider reducing the aflatoxin itself. On the other hand, Metschnikowia aff. pulcherrima DN-HS exhibited a 100% reduction in the three-day growth of A. flavus; however, aflatoxin content was reduced from 536.74 to 333.01 ng/g in hazelnuts [29].
In this study, we examined one aflatoxigenic A. flavus isolate (designated A. flavus 9643) for its biological control of aflatoxin-producing A. flavus 22546 and inhibitory effect on aflatoxin production. A. flavus 9643’s inhibitory effects on mycelial growth and aflatoxin production were compared to those of A. flavus 96045 (known as AF36). Aflatoxin B1 and B2 production was also measured after co-cultivation with A. flavus 22546, and the reduction in A. flavus 22546’s mycelial growth area was also determined after co-culturing the aflatoxigenic strains of A. flavus.

2. Materials and Methods

2.1. Fungal Strains Used in This Study

The aflatoxin-producing strain of Aspergillus spp., A. flavus ATCC 22546, and non-aflatoxin-producing strains A. flavus ATCC 9643 and A. flavus ATCC 96045, previously known as the AF36 line mutant strain, were obtained from the American Type Culture Collection (ATCC, Manassas, VA, USA).

2.2. Culture Conditions of Fungal Strains

In this study, malt extract medium (Difco, Franklin Lake, NJ, USA) and potato dextrose medium (Difco, Franklin Lake, NJ, USA) were used to cultivate the fungal strains. Malt extract medium was used to culture the A. flavus ATCC 22546 and A. flavus ATCC 96045 strains, while potato dextrose medium was used to cultivate the A. flavus ATCC 9643 strain. All strains were cultivated at 25 °C and 80% humidity and subcultured three times within 15 days for proper activation. After activation, fungal strains were transferred to a fresh medium, cultivated for one week, and used in further experiments. Spore suspensions of the A. flavus strains were prepared by adding 3 mL of sterile 0.01% (v/v) Tween 80 solution to the formed spores. Direct fungal spore counting was performed using a Neubauer chamber (DHC-N01, 1NCYTO, Cheonan, Chungcheongnam-do, Republic of Korea), and the spores were subsequently inoculated onto a paper disk (diameter: 8 mm; ADVANTEC, Tokyo, Japan) at 1 × 106 spores/mL. In some experiments, the A. flavus ATCC 9643 strain was inoculated by transferring a piece (5 × 5 mm) of the fungus using a sterile cutting blade. A. flavus ATCC 22546 and A. flavus ATCC 96045 were co-cultivated in malt extract medium.

2.3. Anti-Aflatoxin Activity Measurement

2.3.1. Comparison of the Expression Levels of Genes Involved in Aflatoxin Synthesis

A. flavus ATCC 22546 and A. flavus ATCC 9643 were cultured in malt extract and potato dextrose agar media at 25 °C and 80% humidity in a growth chamber for one week. The A. flavus ATCC 96045 strain was cultured in malt extract agar medium at 31 °C and 80% humidity for 14 days. Subsequently, the strains were inoculated into a 25 mL liquid medium and incubated at 25 °C and 180 rpm for five days. After cultivation, fungal mycelia were collected using a strainer (pore diameter: 40 μm; SPL Life Sciences Co., Pocheon, Gyeonggi-do, Republic of Korea) and homogenized by adding liquid nitrogen. After homogenization, RNA was extracted using TRIzol reagent (Thermo Fisher Scientific Inc., Waltham, MA, USA). The concentration and purity of the extracted RNA were determined using a μDrop™ Plate (Thermo Fisher Scientific Inc., Waltham, MA, USA) and visualized via electrophoresis on 2% (w/v) agarose gel. Thereafter, 2 μg of complementary DNA (cDNA) was synthesized using the extracted RNA and Maxima First Strand cDNA Synthesis Kit (Thermo Fisher Scientific Inc.). The synthesized cDNA (100 ng) was subjected to quantitative reverse transcription polymerase chain reaction (qRT-PCR) analysis using the Rotor-Gene SYBR Green PCR Kit (Qiagen, Germany), 18S rRNA was used as a housekeeping gene, and the RNA amounts of aflC, aflD, aflE, aflG, aflK, aflL, aflO, aflP, aflQ, and aflR were quantified. The qRT-PCR was performed in triplicate, and the results were relatively quantified using the 2−ΔΔCt method. All the primers used in this experiment were synthesized by Genotech Co., Ltd. (Daejeon, Republic of Korea), and they were listed as previously reported in Table 1 [15,16].

2.3.2. Determination of In Vitro Anti-Aflatoxin Activity Using Dominance Difference

The aflatoxin-inhibition experiment was conducted using malt extract medium for the co-cultivation of A. flavus ATCC 22546 and A. flavus ATCC 96045 and a mixture (1:1) of the two above-mentioned media for the co-cultivation of ATCC 22546 and ATCC 9643, respectively. Spore suspensions of the A. flavus ATCC 22546 and A. flavus ATCC 96045 strains were inoculated onto a paper disk at 1 × 106 spores/mL, and the A. flavus ATCC 9643 strain was inoculated by transferring a piece (5 × 5 mm) using a sterile cutting blade. Co-cultures were incubated at 28 °C and 80% humidity for ten days. Additionally, the A. flavus ATCC 22546 and A. flavus ATCC 9643 strains were co-cultivated by inoculating their spore suspensions onto a paper disk at 1 × 106 spores/mL using a potato dextrose medium and incubating them at 25 °C for ten days.

2.3.3. Determination of In Vitro Anti-Aflatoxin Activity on Rice Using Dominance Difference

The A. flavus ATCC 22546 and A. flavus ATCC 9643 fungal strains were directly co-cultured on rice and an agar medium containing rice. Furthermore, fungal growth was compared between soaked and unsoaked rice. A 20 g rice sample was used in each experiment. The rice-containing agar medium was prepared by spreading 20 g of rice on a 1.5% (w/v) agar plate. Rice soaking was performed in two stages. In brief, 20 mL of distilled water was poured on 20 g of rice in a glass Petri dish and allowed to stand at room temperature. After 3 h, the first stage of soaking was performed at 80 °C for 1 h, followed by the second stage at 30 °C for 1 h, and each rice sample was subsequently subjected to experimentation. For the co-cultivation experiment, the A. flavus ATCC 22546 strain was inoculated onto a paper disk at 1 × 106 spores/mL, while the A. flavus ATCC 9643 strain was inoculated by transferring a piece (5 × 5 mm) using a sterile cutting blade and incubated at 25 °C and 80% humidity for one week. After incubation, the fungal growth area was measured using the ImageJ (version 1.52a) image-processing program. All experiments were performed in triplicate. Statistical analysis was performed via one-way analysis of variance with post hoc Tukey’s test to determine significant differences (p < 0.05) using IBM SPSS Statistics (version 26.0) software.

2.4. Aflatoxin Content Determination

To evaluate aflatoxin production by the aflatoxigenic strains, their spore suspensions were inoculated into a 25 mL mixture (1:1) of malt extract and potato dextrose media at 1 × 106 spores/mL. The non-aflatoxigenic strain, that is, the treatment group, was inoculated using a sterile cutting blade. After cultivation, 75 mL of ethyl acetate was added to each culture broth in a separatory funnel, and the resulting mixture was shaken for 5 min in a funnel shaker. After standing for 5 min, the medium layer (water layer) was subsequently removed, and the remaining ethyl acetate layer was transferred to the flask. The extract was concentrated using a rotary vacuum evaporator (RV10, IKA, Janke & Kunjkel-Str., Staufen, Germany). The resulting extract was dissolved in 2 mL of 50% (v/v) methanol and analyzed via high-performance liquid chromatography (HPLC). The HPLC analysis conditions for AFB1, AFB2, AFG1, and AFG2 were followed using the method previously reported [15]. All experiments were performed in triplicate. Statistical analysis was performed via one-way analysis of variance with post hoc Tukey’s test to determine significant differences (p < 0.05) using IBM SPSS Statistics (version 26.0) software.

3. Results

3.1. Gene Expression in AFB1-Producing and Non-AFB1-Producing A. flavus

Aflatoxin production has been well documented for Aspergillus sp., and the AFB1-producing genes in the AFB1 biosynthetic pathway have been identified. Therefore, this study compared gene expression levels between the AFB1-producing (the A. flavus ATCC 22546 strain) and non-AFB1-producing (the A. flavus ATCC 9643 strain) A. flavus strains. Subsequently, the latter strain’s suppressive effect was determined on the growth of the AFB1-producing strain and AFB1 production via the co-culturation of the two strains. In this regard, another non-AFB1-producing A. flavus strain (A. flavus ATCC 96045, known as AF36) was used as a positive control to elucidate the gene expression patterns in the A. flavus ATCC 9643 strain used in our study.
In the ATCC 9643 strain, several AFB1-producing genes, namely aflK, aflL, and aflR, which are responsible for expressing versicolorin B (verB) synthase, verb desaturase, and the aflatoxin pathway regulator, respectively, were not detected in our study (Figure 1). Other AFB1-producing genes, such as aflC, aflD, aflE, aflO, and aflQ, were significantly down-regulated in the ATCC 9643 strain compared with those in the AFB1-producing strain (ATCC 22546), as shown in Figure 1. These down-regulated genes are responsible for expressing polyketide synthase, acid ketoreductase, norsolorinic acid reductase, O-methyltransferase B, and oxidoreductase, respectively. Only two genes, aflG and aflP, were not differentially regulated between the ATCC 9643 and the ATCC 22546 strains. These two genes are responsible for expressing cytochrome P450 for the conversion of averantin (AVN) to hydroxyaverantin and O-methyltransferase A, respectively.
In another non-AFB1-producing strain, A. flavus ATCC 96045, five genes, namely aflE, aflK, aflL, aflO, and aflQ, were undetectable compared with those in ATCC 22546 (Figure 1). Among them, compared with those in ATCC 9643, two genes, aflE and aflQ, were significantly down-regulated in ATCC 96045. However, these two genes were also down-regulated in ATCC 9643, with a negligible difference in expression levels. In ATCC 96045, two genes, aflP and aflS, were not differentially expressed. As mentioned above, aflP is a O-methyltransferase A-expressing gene, whereas aflS is responsible for expressing a gene that regulates aflatoxin production. Therefore, the non-AFB1-producing A. flavus strains exhibited significant down-regulation of AFB biosynthesis.

3.2. Suppressive Effect of Non-AFB1-Producing A. flavus ATCC 9643 on ATCC 22546 Growth

Via ATCC 22546–ATCC 9643 co-culturation, a dominance diagram for the two strains’ competitive growth was generated, revealing a significant competitive effect on ATCC 22546 growth through ATCC 9643 addition (Figure 2).
In the ATCC 9643:ATCC 22546 (1:1) inoculation group on the tenth day of incubation (Figure 2), the growth of the non-aflatoxin-producing strain (ATCC 9643, one 5 × 5-mm piece of the corresponding fungi grown in solid medium) was apparently equal to that of the aflatoxin-producing strain (ATCC 22546, 1 × 106 cells). Moreover, the positive control, that is, the non-aflatoxin-producing strain (ATCC 96045, known as AF36, 1 × 106 cells), exhibited similar growth in the ATCC 96045:ATCC 22546 (1:1) inoculation group until the tenth day of incubation.
As shown in Figure 3a, the ATCC 9643 strain inhibited ATCC 22546 growth over six days of incubation, and elevated ATCC 9643 quantities increasingly suppressed ATCC 22546 growth. Conversely, higher ATCC 22546 levels inhibited ATCC 9643 growth. These findings remained consistent after ten days of incubation with the two strains (Figure 3a). In Figure 3b, the fungal growth area showed some similarity when ATCC 9643 and ATCC 22546 were co-cultured, indicating they were competitively grown when they were inoculated simultaneously.
The competitive growth of ATCC 9643 on rice was validated (Figure 4). Rice exhibited poor Aspergillus strain growth. Therefore, the rice was soaked in water, left on a solid Aspergillus growth medium, or both (Figure 4a–d). Water-submerged rice with or without the fungal growth medium was successfully located for the fungal growth of both strains as ATCC 9643 and ATCC 22546.
It was subsequently inoculated with Aspergillus strains, and their competitive growth was observed. After Aspergillus sp. inoculation, the competitive growth between ATCC 9643 and ATCC 22546 was observed until the seventh day (Figure 5a–f).
Both A. flavus ATCC 9643 and A. flavus ATCC 22546 did not grow at all in the soaked and agar-treated medium conditions after two days of incubation (Figure 5). However, after two days of incubation, ATCC 22546 and ATCC 9643 started growing under the other three conditions: exclusive soaking, exclusive agar treatment, and combined soaking and agar treatment (Figure 5a–f). Therefore, rice soaking in water sufficiently fostered the growth of the Aspergillus sp. strains, and after seven days of incubation, their growth filled the plates.
The competitive growth of the fungi was observed under the different conditions, and it was almost equal under exclusive agar treatment, regardless of submergence. The inoculation of ATCC 9643 with ATCC 22546 (1 piece: 1 × 106 cells) under four different growth conditions was observed on second, fifth, and seventh days of incubation (Figure 5a–c). Without agar medium, water-soaked (submerged) rice favored the growth of both Aspergillus strains; nevertheless, ATCC 22546 grew faster than ATCC 9643, exhibiting a two-fold difference (Figure 5b). With agar medium, non-soaked (non-submerged) rice could not facilitate the growth of both Aspergillus strains; nonetheless, these strains exhibited similar growth on water-soaked rice when the growth medium was supplied (Figure 5a–c).

3.3. Antiaflatoxigenic Effect of Non-AFB1-Producing A. flavus ATCC 9643 on ATCC 22546

After the co-cultivation of ATCC 9643 with ATCC 22546, AFB1 and AFB2 production was measured using HPLC combined with fluorescence detection. Both AFB1 and AFB2 production were significantly reduced (Figure 6a,b). The production of AFB1 showed 84.1% and 94.6% reductions at ATCC 22546/ATCC 9643 ratios of 1:1 and 1:3, respectively. Also, the production of AFB2 showed 94.3% and 98.9% reductions at ratios of 1:1 and 1:3, respectively. Furthermore, via ATCC 96045–ATCC 22546 co-culturation, ATCC 96045’s suppressive effect on AFB1 and AFB2 production was analyzed (Figure 6c,d). Since ATCC 96045 (AF36)’s suppressive effect on ATCC 22546 and aflatoxin production is well studied, we determined that aflatoxin production was increasing the ATCC 22546 ratio to ATCC 96045. After co-cultivation, production of AFB1 was suppressed 100% at both 1:1 and 1:2 ratios (Figure 6c). Our findings suggest that ATCC 9643–ATCC 22546 co-cultivation is a promising means of mitigating AFB1 and AFB2 production.

4. Discussion

4.1. Presence of Aflatoxin-Producing Genes in Wild Aspergillus sp. Isolates

Aflatoxin contamination is of great concern in several agricultural countries owing to its high toxicity to poultry, which potentially consume AFB-contaminated feeds via AFB-containing raw materials or grains. Recently, Md Fakruddin et al. [30] isolated 15 presumptive A. flavus strains from various feed and grain samples in Bangladesh and determined their AFB-producing capacities by measuring AFB-producing gene expression. In this study, only one isolate, designated isolate no. 41, possessed seven major AFB-producing genes, namely aflR, aflS, aflD (known as nor-1), aflM (known as ver-1), aflO (known as omtB), aflP (known as omtA), and aflQ (ordA), while the other 14 isolates did not express at least one major AFB-producing gene [30]. Interestingly, even if they did not express certain genes related to AFB production in isolated A. flavus, only one isolate (designated isolate no. 26) did not produce AFB1 but yielded a minute amount of AFB2 (up to 12.3 μg/g agar). Isolate no. 26 did not express aflM, which encodes the 28 kDa reduced nicotinamide adenine dinucleotide phosphate-dependent ketoreductase protein to bio-transform versicolorin A to demethylsterigmatocystin; thus, this gene potentially plays a crucial role in AFB production in Aspergilli. On the other hand, among the 15 isolates, 11 produced both AFB1 and AFB2 in a 3:2 ratio and in quantities exceeding 6.3 and 4.5 μg/g agar, respectively [30]. However, in addition to the aflM gene, other AFB-producing genes may also serve an essential role in AFB biosynthesis as a key component.
As AFB biosynthesis recruits various enzyme systems to produce four main AFBs, the first gene group involved in AFB biosynthesis comprises genes encoding two fatty acid synthases (FASs) and a polyketide synthase (PksA) [31]. These initial components play an important role in natural product formation, as they mediate a hexanoyl starter subunit to form corresponding polyketides, such as norsolorinic acid; however, they are also involved in various natural product biosynthesis systems in fungi apart from AFB biosynthesis [32]. Therefore, down-regulating FAS and PKS genes in the fungal community is considerably challenging owing to the production of diverse natural products, and the presence or status of other AFB-producing genes may be important to non-AFB-producing Aspergilli strains.
In our study, the AFB-producing capacities of three A. flavus strains, namely ATCC 9643, ATCC 22546, and ATCC 96045, with or without co-cultivation, were compared in the presence of non-AFB1-producing strains that suppress AFB1-producing strains, and two of them, ATCC 9643 and ATCC 96045, did not produce AFB1. Compared with ATCC 22546, ATCC 9643 did not express aflK and aflL, which encode versicolorin B synthase and desaturase, respectively. Recently, 4-hydroxy-7-methyl-3-phenylcoumarin was found to inhibit AFB1 production in ATCC 22546 by down-regulating aflK gene expression [15]. Moreover, 1,8-cineole also suppressed aflL gene expression in ATCC 22546, and 1,8-cineole-treated ATCC 22546 exhibited dramatically reduced AFB1 production [33]. Based on these results, Aspergilli may not produce AFB1 or potentially display suppressed AFB production with the down-regulation or absence of the aflK and aflL genes. Taken together, aflK, aflL, and aflM gene expression serves an important role in AFB production in Aspergilli.
Similarly, the ATCC 96045 strain neither expresses aflE, aflK, aflL, or aflO nor produces AFBs. It is already being used for the biocontrol of AFB-producing A. flavus strains in the US under the name AF36, and this biocontrol has proven successful in agricultural fields. As aflE encodes aryl alcohol dehydrogenases in the AFB-producing cluster, this strain might not have produced AFBs owing to the inhibition of norsolorinic acid bio-transformation to AVN [31]. However, the strain, as well as ATCC 9643, also exhibited down-regulated aflK and aflL expression.

4.2. Growth Competition between ATCC 22546 and ATCC 9643

The biocontrol of A. parasiticus by selected non-conventional yeast strains has recently been suggested. Two wild yeasts, Aureobasidium pullulans and Saitozyma podzolica, have demonstrated their potential to suppress the mycelial growth of A. flavus and A. parasiticus and reduce mycotoxin production [34]. S. podzolica produces chitinase, β-1,3-glucanase, and amylase, and these three enzymes play an important role in controlling fungal growth. In addition, A. pullulans generates protease and cellulase, as well as chitinase, β-1,3-glucanase, and amylase. The above two yeasts were found to reduce AFB production in A. parasiticus by approximately 20% in a bread model [34]. Chitinases mediate hydrolytic reactions that break down glycosidic bonds in chitin and are the chief components of fungal cell walls [35], while β-1,3-glucanase decomposes fungal β-1,3-glucans (Curdlan and laminarin) [36]. Amylases, proteases, and cellulases are all extracellular enzymes known to control fungal growth by breaking the a-1,4-linkages in starch, degrading the proteins in fungal cell walls, and breaking down celluloses in fungal cell walls, respectively [37,38,39].
A. pullulans has been used to control A. flavus in vitro and on tomato fruits, and it has been found to produce chitinase and β-1,3-glucanase after five days of cultivation, leading to a one-third decrease in lesion diameter on tomato fruits compared with that in the control [28]. Therefore, these extracellular enzymes secreted by microbes potentially contribute to A. flavus and A. parasiticus control for the safety of foods and feeds.
In a previous study using non-AFB-producing A. parasiticus as a biocontrol agent against AFB contamination, the co-inoculation of non-AFB-producing A. parasiticus strains inhibited AFB production in corn under laboratory conditions [40]. To further examine this finding, another study also employed non-AFB-producing A. flavus and found it to exhibit potential in controlling AFB contamination in cotton fields [41]. Both non-AFB-producing A. flavus and A. parasiticus strains were administered to peanuts fields in three different formulations, and they each yielded a large soil population of non-AFB-producing strains [42]. Similarly, in cotton fields, treatment with non-AFB-producing strains decreased AFB1 production from 75% to 99% [43,44].
When applying non-aflatoxigenic strains to fields, two major parameters, application time and inoculum rate, must be considered. Kabak and Dobson [45] recommended the simultaneous co-inoculation of non-aflatoxigenic and aflatoxigenic strains; however, a one-day difference in inoculation timing led to failed AFB reduction. Regarding the inoculation rate of non-AFB-producing strains, AFB contamination in peanuts significantly decreased with the increasing non-aflatoxigenic inoculum rate [46].
To use the ATCC 9643 strain as a biological agent against AFB contamination, the optimal application timing was employed based on simultaneous co-inoculation [45]. At this inoculation time, ATCC 9643 was co-inoculated with ATCC 22546 in five different ATCC 9643/ATCC 22546 inoculation ratios of 1:1, 1:2, 1:4, 4:1, and 2:1. In these treatments, ATCC 9643 displayed competitive growth against ATCC 22546, significantly reducing AFB1 and AFB2 production. However, this competitiveness was potentially attenuated when ATCC 9643 was applied to crop fields, as the co-inoculation of ATCC 9643 with ATCC 22546 on water-soaked rice exhibited different growth patterns between the two strains, with ATCC 22546 readily dominating ATCC 9643.

5. Conclusions

Traditional open-field and greenhouse agriculture are prone to contamination by fungal species, among which A. favus and A. parasiticus reportedly generate AFBs that contaminate agricultural products during crop cultivation. Therefore, target agricultural crops should be protected from fungal attack, and chemical control measures against fungal contamination using fungicides have generally been employed in the field. Notwithstanding, non-aflatoxigenic A. favus and A. parasiticus strains are considered effective controllers of fungal infection in crops when competitively grown together with aflatoxigenic strains in the field. Several researchers have reported that non-aflatoxigenic strains suppress aflatoxigenic A. favus and A. parasiticus survival and AFB contamination. In our study, a non-aflatoxigenic A. flavus strain, ATCC 9643, exhibited its potential to mitigate AFB production and aflatoxigenic A. flavus strain (ATCC 22546) growth. Increasing the inoculum rate of ATCC 9643 relative to ATCC 22546 on solid agar significantly suppressed the growth of ATCC 22546 and reduced AFB (aflatoxin B) production by approximately 84%, 95%, and 97%, with inoculum ratios of 1:1, 1:3, and 1:5, respectively. Therefore, ATCC 9643 may be an excellent candidate for the biocontrol of AFB contamination in target crops as a biological agent against aflatoxigenic A. favus and A. parasiticus strains. Further studies that validate the bioregulatory capacity of ATCC 9643 against aflatoxigenic strains in the target crop cultivation field are urgently required.

Author Contributions

Conceptualization, K.-S.J., H.-M.K. and S.-E.L.; methodology, K.-S.J., H.-M.K. and J.L.; software, K.-S.J., H.-M.K. and J.L.; validation, D.G. and S.-E.L.; formal analysis, K.-S.J., H.-M.K. and J.L.; investigation, K.-S.J., H.-M.K., J.L. and S.-E.L.; resources, D.G. and S.-E.L.; data curation, K.-S.J., H.-M.K., J.L., D.G. and S.-E.L.; writing—original draft preparation, K.-S.J., D.G. and S.-E.L.; writing—review and editing, K.-S.J., D.G. and S.-E.L.; visualization, K.-S.J., J.L., D.G. and S.-E.L.; supervision, S.-E.L.; project administration, S.-E.L.; funding acquisition, S.-E.L. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by the Biological Materials Specialized Graduate Program through the Korea Environmental Industry and Technology Institute (KEITI) funded by the Ministry of Environment (MOE). This research was also supported by the Korea Basic Science Institute (National Research Facilities and Equipment Center) through a grant funded by the Ministry of Education (2021R1A6C101A416), and quantitative PCR was carried out the at KNU NGS Center (Daegu, South Korea). This study was partially supported by a grant (15162MFDS044) from the Ministry of Food and Drug Safety.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data are contained within the article.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Kumar, P.; Mahato, D.K.; Kamle, M.; Mohanta, T.K.; Kang, S.G. Aflatoxins: A global concern for food safety, human health and their management. Front. Microbiol. 2017, 7, 2170. [Google Scholar] [CrossRef]
  2. Marchese, S.; Polo, A.; Ariano, A.; Velotto, S.; Costantini, S.; Severino, L. Aflatoxin B1 and M1: Biological properties and their involvement in cancer development. Toxins 2018, 10, 214. [Google Scholar] [CrossRef] [PubMed]
  3. Nazhand, A.; Durazzo, A.; Lucarini, M.; Souto, E.B.; Santini, A. Characteristics, occurrence, detection and detoxification of aflatoxins in foods and feeds. Foods 2020, 9, 644. [Google Scholar] [CrossRef] [PubMed]
  4. Ali, N. Aflatoxins in rice: Worldwide occurrence and public health perspectives. Toxicol. Rep. 2019, 6, 1188–1197. [Google Scholar] [CrossRef] [PubMed]
  5. Van de Perre, E.; Jacxsens, L.; Lachat, C.; Tahan, F.E.; De Meulenaer, B. Impact of maximum levels in European legislation on exposure of mycotoxins in dried products: Case of aflatoxin B1 and ochratoxin A in nuts and dried fruits. Food Chem. Toxicol. 2015, 75, 112–117. [Google Scholar] [CrossRef] [PubMed]
  6. Miklós, G.; Angeli, C.; Ambrus, A.; Nagy, A.; Kardos, V.; Zentai, A.; Kerekes, K.; Farkas, Z.; Jóźwiak, A.; Bartók, T. Detection of aflatoxins in different matrices and food-chain positions. Front. Microbiol. 2020, 11, 1916. [Google Scholar] [CrossRef] [PubMed]
  7. Toregeani-Mendes, K.A.; Arroteia, C.C.; Kemmelmeier, C.; Dalpasquale, V.A.; Bando, E.; Alves, A.F.; Marques, O.J.; Nishiyama, P.; Mossini, S.A.G.; Machinski, M., Jr. Application of hazard analysis critical control points system for the control of aflatoxins in the Brazilian groundnut-based food industry. Int. J. Food Sci. Technol. 2011, 46, 2611–2618. [Google Scholar] [CrossRef]
  8. Kang, S.Y.; Woo, S.Y.; Tian, F.; Lee, S.Y.; Chun, H.S. Comparison of aflatoxins and ochratoxin A contaminated in homemade and commercial doenjang manufactured by traditional and modified methods. Food Control 2023, 151, 109796. [Google Scholar] [CrossRef]
  9. Woo, S.Y.; Ok, H.E.; Lee, S.Y.; Jeong, A.Y.; Jeong, T.K.; Chun, H.S. Simple chromatographic determination of aflatoxins in Korean fermented soybean products doenjang, ganjang, and gochujang, with comparison of derivatization methods. Food Sci. Biotechnol. 2022, 31, 475–482. [Google Scholar] [CrossRef]
  10. Park, D.L.; Lee, S.L.; Price, R.L.; Pohland, A.E. Review of the decontamination of aflatoxins by ammoniation: Current status and regulation. J. Assoc. Off. Anal. Chem. 1988, 71, 685–703. [Google Scholar] [CrossRef]
  11. Schrenk, D.; Bignami, M.; Bodin, L.; Chipman, J.K.; del Mazo, J.; Grasl-Kraupp, B.; Hoogenboom, L.; Leblanc, J.C.; Nebbia, C.S.; Nielsen, E.; et al. Assessment of an application on a detoxification process of groundnut press cake for aflatoxins by ammoniation. EFSA J. 2021, 19, 7035. [Google Scholar]
  12. Mahato, D.K.; Lee, K.E.; Kamle, M.; Devi, S.; Dewangan, K.N.; Kumar, P.; Kang, S.G. Aflatoxins in food and feed: An overview on prevalence, detection and control strategies. Front. Microbiol. 2019, 10, 2266. [Google Scholar] [CrossRef] [PubMed]
  13. Srinivason, B.; Li, W.; Ruth, C.J.; Herrman, T.J.; Erickson, D.; Mehta, S. Rapid quantification of aflatoxin in food at the point of need: A monitoring tool for food systems dashboards. Curr. Res. Biotechnol. 2023, 6, 100153. [Google Scholar] [CrossRef]
  14. Masiello, M.; Somma, S.; Ghionna, V.; Logrieco, A.F.; Moretti, A. In vitro and in field response of different fungicides against Aspergillus flavus and Fusarium species causing for ear rot disease of maize. Toxins 2019, 11, 11. [Google Scholar] [CrossRef] [PubMed]
  15. Moon, Y.S.; Kim, H.M.; Chun, H.S.; Lee, S.E. Organic acids suppress aflatoxin production via lowering expression of aflatoxin biosynthesis-related genes in Aspergillus flavus. Food Control 2018, 88, 207–216. [Google Scholar] [CrossRef]
  16. Kim, G.; Lee, S.E. Antifungal and antiaflatoxigenic properties of naphthoquinones toward Aspergillus flavus and their mode of inhibitory action on aflatoxin biosynthesis. Food Control 2021, 119, 107506. [Google Scholar] [CrossRef]
  17. Guan, Y.; Chen, J.; Nepovimova, E.; Long, M.; Wu, W.; Kuca, K. Aflatoxin detoxification using microorganisms and enzymes. Toxins 2021, 13, 46. [Google Scholar] [CrossRef] [PubMed]
  18. Malik, M.T.; Rehman, A.U.; Naqvi, S.A.; Hasnain, A.; Umar, U.U.; Azeem, H.; Shahid, M.; Umair, M. Biological mediated management of bacterial diseases in crop plants: A review. Pak. J. Phytopathol. 2021, 33, 217. [Google Scholar] [CrossRef]
  19. Nguyen, Q.D.; Do, A.D. Biological control of Aspergillus flavus infection and growth promotion of peanut seedlings by Lactiplantibacillus plantarum and Levilactobacillus brevis. Egypt. J. Biol. Pest Control 2024, 34, 32. [Google Scholar] [CrossRef]
  20. Doster, M.A.; Cotty, P.J.; Michailides, T.J. Evaluation of the atoxigenic Aspergillus flavus strain AF36 in pistachio orchards. Plant Dis. 2014, 98, 948–956. [Google Scholar] [CrossRef]
  21. Garcia-Lopez, M.T.; Luo, Y.; Ortega-Beltran, A.; Jaime, R.; Moral, J.; Michailides, T.J. Quantification of the aflatoxin biocontrol strain Aspergillus flavus AF36 in soil and in nuts and leaves of pistachio by real-time PCR. Plant Dis. 2021, 105, 1657–1665. [Google Scholar] [CrossRef] [PubMed]
  22. Cotty, P.J.; Mellon, J. Ecology of aflatoxin producing fungi and biocontrol of aflatoxin contamination. Mycotox. Res. 2006, 22, 110–117. [Google Scholar] [CrossRef] [PubMed]
  23. Cotty, P.J. Virulence and cultural characteristics of two Aspergillus flavus strains pathogenic on cotton. Phytopathology 1989, 79, 808–814. [Google Scholar] [CrossRef]
  24. Ortega-Beltran, A.; Moral, J.; Picot, A.; Puckett, R.D.; Cotty, P.J.; Michailides, T.J. Atoxigenic Aspergillus flavus isolates endemic to almond, fig, and pistachio orchards in California with potential to reduce aflatoxin contamination in these crops. Plant Dis. 2019, 103, 905–912. [Google Scholar] [CrossRef] [PubMed]
  25. Freimoser, F.M.; Rueda-Mejia, M.P.; Tilocca, B.; Migheli, Q. Biocontrol yeasts: Mechanisms and applications. World J. Microbiol. Biotechnol. 2019, 35, 154. [Google Scholar] [CrossRef] [PubMed]
  26. Pandin, C.; Le Coq, D.; Canette, A.; Aymerich, S.; Briandet, R. Should the biofilm mode of life be taken into consideration for microbial biocontrol agents? Microb. Biotechnol. 2017, 10, 719–734. [Google Scholar] [CrossRef] [PubMed]
  27. Rossouw, D.; Meiring, S.P.; Bauer, F.F. Modifying Saccharomyces cerevisiae adhesion properties regulates yeast ecosystem dynamics. Appl. Environ. Sci. 2018, 3, e00383-18. [Google Scholar] [CrossRef] [PubMed]
  28. Podgórska-Kryszczuk, I. Biological control of Aspergillus flavus by the yeast Aureobasidium pullulans in vitro and on tomato fruit. Plants 2023, 12, 236. [Google Scholar] [CrossRef] [PubMed]
  29. Dikmetas, D.N.; Özer, H.; Karbancioglu-Guler, F. Biocontrol potential of antagonistic yeasts on in vitro and in vivo Aspergillus growth and its AFB1 production. Toxins 2023, 15, 402. [Google Scholar] [CrossRef]
  30. Fakruddin, M.; Chowdhury, A.; Hossain, M.N.; Ahmed, M.M. Characterization of aflatoxin producing Aspergillus flavus from food and feed samples. SpringerPlus 2015, 4, 159. [Google Scholar] [CrossRef]
  31. Yu, J. Current understanding on aflatoxin biosynthesis and future perspective in reducing aflatoxin contamination. Toxins 2012, 4, 1024–1057. [Google Scholar] [CrossRef] [PubMed]
  32. Crawford, J.M.; Korman, T.P.; Labonte, J.W.; Vagstad, A.L.; Hill, E.A.; Kamari-Bidkorpeh, O.; Tsai, S.C.; Townsend, C.A. Structural basis for biosynthesis programming of fungal aromatic polyketide cyclization. Nature 2009, 461, 1139–1143. [Google Scholar] [CrossRef] [PubMed][Green Version]
  33. Kim, H.M.; Kwon, H.; Kim, K.; Lee, S.E. Antifungal and antiaflatoxigenic activities of 1,8-cineole and t-cinnamaldehyde on Aspergillus flavus. Appl. Sci. 2018, 8, 1655. [Google Scholar] [CrossRef]
  34. Podgórska-Kryszczuk, I.; Pankiewicz, U.; Sas-Paszt, L. Biological control of Aspergillus parasiticus and Aspergillus ochraceus and reductions in the amount of ochratoxin A and aflatoxins in bread by selected non-conventional yeast. Foods 2023, 12, 3871. [Google Scholar] [CrossRef] [PubMed]
  35. Loc, N.H.; Huy, N.D.; Quang, H.T.; Lan, T.T.; Ha, T.T.T. Characterisation and antifungal activity of extracellular chitinase from a biocontrol fungus, Trichoderma asperellum PQ34. Mycology 2020, 11, 38–48. [Google Scholar] [CrossRef]
  36. Ueki, A.; Takehara, T.; Ishioka, G.; Kaku, N.; Ueki, K. β-1,3-glucanase production as an antifungal enzyme by phylogenetically different strains of the genus Clostridium isolated from anoxic soil that underwent biological disinfestation. Appl. Microbiol. Biotechnol. 2020, 104, 5563–5578. [Google Scholar] [CrossRef] [PubMed]
  37. Ling, L.; Cheng, W.; Jiang, K.; Jiao, Z.; Luo, H.; Yang, C.; Pang, M.; Lu, L. The antifungal activity of a serine protease and the enzyme production of characteristics of Bacillus licheniformis TG116. Arch. Microbiol. 2022, 204, 601. [Google Scholar] [CrossRef]
  38. Malik, M.S.; Rehman, A.; Khan, I.U.; Khan, T.A.; Jamil, M.; Rha, E.S.; Anees, M. Thermo-neutrophilic cellulases and chitinases characterized from a novel putative antifungal biocontrol agent: Bacillus subtilis TD11. PLoS ONE 2023, 18, e0281102. [Google Scholar] [CrossRef]
  39. Zhang, B.; Wang, D.F.; Wu, H.; Zhang, L.; Xu, Y. Inhibition of endogenous α-amylase and protease of Aspergillus flavus by trypsin inhibitor from cultivated and wild-type soybean. Ann. Microbiol. 2010, 60, 405–414. [Google Scholar] [CrossRef]
  40. Ehrlich, K. Effect on aflatoxin production of competition between wild type and mutant strains of Aspergillus parasiticus. Mycopathologia 1987, 97, 93–96. [Google Scholar] [CrossRef]
  41. Cotty, P.J. Aflatoxin-producing potential of communities of Aspergillus section flavi from cotton-producing areas in the United States. Mycol. Res. 1997, 101, 698–704. [Google Scholar] [CrossRef]
  42. Dorner, J.W.; Cole, R.J.; Connick, W.J.; Daigle, D.L.; McGuire, M.R.; Shasha, B.S. Evaluation of biological control formulations to reduce aflatoxin contamination in peanuts. Biol. Control 2003, 26, 318–324. [Google Scholar] [CrossRef]
  43. Cotty, P.J.; Bhatnagar, D. Variability among atoxigenic Aspergillus flavus strains in the ability to prevent aflatoxin contamination and production of aflatoxin biosynthetic pathway enzymes. Appl. Environ. Microbiol. 1994, 60, 2248–2251. [Google Scholar] [CrossRef] [PubMed]
  44. Abbas, H.K.; Accinelli, C.; Shier, W.T. Biological control of Aflatoxin Contamination in U.S crops and the use of bioplasticformulations of Aspergillus flavus biocontrol strains to optimize application strategies. J. Agric. Food Chem. 2017, 65, 7081–7087. [Google Scholar] [CrossRef] [PubMed]
  45. Kabak, B.; Dobson, A.D. Biological strategies to counteract the effects of mycotoxins. J. Food Prot. 2009, 72, 2006–2016. [Google Scholar] [CrossRef]
  46. Mamo, F.T.; Selvaraj, J.N.; Wang, Y.; Liu, Y. Recent developments in the screening of atoxigenic Aspergillus flavus towards aflatoxin biocontrol. J. Appl. Environ. Microbiol. 2017, 5, 20–30. [Google Scholar]
Figure 1. Aflatoxin biosynthesis gene expression for Aspergillus flavus 22546 (the aflatoxigenic strain) and for A. flavus 96045 and A. flavus 9643 (non-aflatoxigenic strains). A. flavus 96045 was used as a positive control. The experiment was performed in triplicate. Data analysis was conducted using one-way ANOVA, followed by post hoc Tukey’s test. (*, p < 0.1; **, p < 0.01; ***, p < 0.001; ****, p < 0.0001).
Figure 1. Aflatoxin biosynthesis gene expression for Aspergillus flavus 22546 (the aflatoxigenic strain) and for A. flavus 96045 and A. flavus 9643 (non-aflatoxigenic strains). A. flavus 96045 was used as a positive control. The experiment was performed in triplicate. Data analysis was conducted using one-way ANOVA, followed by post hoc Tukey’s test. (*, p < 0.1; **, p < 0.01; ***, p < 0.001; ****, p < 0.0001).
Applsci 14 06142 g001
Figure 2. In vitro co-cultivation of Aspergillus flavus ATCC 22546, an aflatoxin-producing strain, with two non-aflatoxin-producing A. flavus strains, ATCC 9643 and ATCC 96045, visualized under (a) visible light and (b) ultraviolet light. A. flavus 96045 was used as a positive control. The two non-aflatoxigenic strains of A. flavus competitively grew in the fungal growth medium containing an aflatoxigenic strain of A. flavus ATCC 22546.
Figure 2. In vitro co-cultivation of Aspergillus flavus ATCC 22546, an aflatoxin-producing strain, with two non-aflatoxin-producing A. flavus strains, ATCC 9643 and ATCC 96045, visualized under (a) visible light and (b) ultraviolet light. A. flavus 96045 was used as a positive control. The two non-aflatoxigenic strains of A. flavus competitively grew in the fungal growth medium containing an aflatoxigenic strain of A. flavus ATCC 22546.
Applsci 14 06142 g002
Figure 3. In vitro anti-aflatoxin activity using the dominance difference test between a non-aflatoxin-producing strain Aspergillus flavus ATCC 9643 and an aflatoxin-producing strain A. flavus ATCC 22546. (a) Colony morphology; (b,c) colony area (mm2). Spore suspensions (n × 106 spores/mL) were inoculated on a paper disk. The experiment was performed in triplicate. Data analysis was conducted using one-way ANOVA, followed by post hoc Tukey’s test. Lowercase letters denote significant differences among groups: a > b > c > d (p < 0.05).
Figure 3. In vitro anti-aflatoxin activity using the dominance difference test between a non-aflatoxin-producing strain Aspergillus flavus ATCC 9643 and an aflatoxin-producing strain A. flavus ATCC 22546. (a) Colony morphology; (b,c) colony area (mm2). Spore suspensions (n × 106 spores/mL) were inoculated on a paper disk. The experiment was performed in triplicate. Data analysis was conducted using one-way ANOVA, followed by post hoc Tukey’s test. Lowercase letters denote significant differences among groups: a > b > c > d (p < 0.05).
Applsci 14 06142 g003
Figure 4. Growth of the strains on the rice medium with and without soaking. (a,b) A non-aflatoxin-producing strain Aspergillus flavus ATCC 9643; (c,d) an aflatoxin-producing strain A. flavus ATCC 22546. The experiment was performed in triplicate. Data analysis was conducted using one-way ANOVA, followed by post hoc Tukey’s test. Lowercase letters denote significant differences among groups: a > b (p < 0.05).
Figure 4. Growth of the strains on the rice medium with and without soaking. (a,b) A non-aflatoxin-producing strain Aspergillus flavus ATCC 9643; (c,d) an aflatoxin-producing strain A. flavus ATCC 22546. The experiment was performed in triplicate. Data analysis was conducted using one-way ANOVA, followed by post hoc Tukey’s test. Lowercase letters denote significant differences among groups: a > b (p < 0.05).
Applsci 14 06142 g004
Figure 5. In vitro anti-aflatoxin activity of a non-aflatoxin-producing strain Aspergillus flavus ATCC 9643 and an aflatoxin-producing strain A. flavus ATCC 22546 using a dominance difference test on rice. (ac) A 1:1 ratio and (df) a 3:1 ratio, respectively. The experiment was performed in triplicate. Data analysis was conducted using one-way ANOVA, followed by post hoc Tukey’s test. Lowercase letters denote significant differences among groups: a > b (p < 0.05).
Figure 5. In vitro anti-aflatoxin activity of a non-aflatoxin-producing strain Aspergillus flavus ATCC 9643 and an aflatoxin-producing strain A. flavus ATCC 22546 using a dominance difference test on rice. (ac) A 1:1 ratio and (df) a 3:1 ratio, respectively. The experiment was performed in triplicate. Data analysis was conducted using one-way ANOVA, followed by post hoc Tukey’s test. Lowercase letters denote significant differences among groups: a > b (p < 0.05).
Applsci 14 06142 g005
Figure 6. Aflatoxin B1 and B2 production by Aspergillus flavus ATCC 22546 after co-cultivation with the non-aflatoxin-producing strains A. flavus ATCC 9643 and A. flavus ATCC 96045. (a,b) ATCC 22546: ATCC 9643; (c,d) ATCC 22546: ATCC 96045. The experiment was performed in triplicate. Data analysis was conducted using one-way ANOVA, followed by post hoc Tukey’s test. Lowercase letters denote significant differences among groups: a > b (p < 0.05). n.s: non-significant.
Figure 6. Aflatoxin B1 and B2 production by Aspergillus flavus ATCC 22546 after co-cultivation with the non-aflatoxin-producing strains A. flavus ATCC 9643 and A. flavus ATCC 96045. (a,b) ATCC 22546: ATCC 9643; (c,d) ATCC 22546: ATCC 96045. The experiment was performed in triplicate. Data analysis was conducted using one-way ANOVA, followed by post hoc Tukey’s test. Lowercase letters denote significant differences among groups: a > b (p < 0.05). n.s: non-significant.
Applsci 14 06142 g006
Table 1. List of primers used for qRT-PCR.
Table 1. List of primers used for qRT-PCR.
Gene
Symbol
Gene Function Primer Sequences (5′-3′)
18S rRNAHousekeeping geneFATGGCCGTTCTTAGTTGGTG
RGTACAAAGGGCAGGGACGTA
aflCPolyketide synthaseFACTGGCAACTGCAAACCCTA
RCCAGCCGTTTGATGAACACC
aflDReductaseFCCAACATGCACGACTATGCG
RGCCGTGAGCCATTTGTTCTC
aflENOR reductaseFCGTCTCTCAGTCAAGGCCAG
RTCGCATCACTTCCTCCACAC
aflGP450 monooxygenaseFGCATCTTCCACCCTTCCACA
RGAAAAGGCCAACAGTCGTCG
aflKVERB synthaseFATGCAGGGAAAGACCTTGGG
RAACTATCGTCGCCAACGTGA
aflLDesaturaseFGCAACAGTTTGTGGCCGATT
RATGAACTTGTCGGCGTGAGT
aflOO-methyltransferase FAATTCCCCGCTCCTGACAAG
RCGACCAGGAAGGTTGGGAAA
aflPO-methyltransferaseFCTTTCTCATTGGCATTTGCGC
RCGCGTTTGCGRCAACAACTTG
aflQOxidoreductaseFGATAACCCGGACGACCTTCG
RCTCATCTTTTCCATGCGGCG
aflRtranscription regulatorFTGCAGTCAATGGAACACGGA
RTGGGGGTCCCTACTTCCAAA
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Jung, K.-S.; Kim, H.-M.; Lee, J.; Ganbat, D.; Lee, S.-E. Biocontrol of Aflatoxin-Producing Aspergillus flavus ATCC 22546 by a Non-Aflatoxigenic Aspergillus flavus ATCC 9643. Appl. Sci. 2024, 14, 6142. https://doi.org/10.3390/app14146142

AMA Style

Jung K-S, Kim H-M, Lee J, Ganbat D, Lee S-E. Biocontrol of Aflatoxin-Producing Aspergillus flavus ATCC 22546 by a Non-Aflatoxigenic Aspergillus flavus ATCC 9643. Applied Sciences. 2024; 14(14):6142. https://doi.org/10.3390/app14146142

Chicago/Turabian Style

Jung, Kwang-Soo, Hyeong-Mi Kim, Jieun Lee, Dariimaa Ganbat, and Sung-Eun Lee. 2024. "Biocontrol of Aflatoxin-Producing Aspergillus flavus ATCC 22546 by a Non-Aflatoxigenic Aspergillus flavus ATCC 9643" Applied Sciences 14, no. 14: 6142. https://doi.org/10.3390/app14146142

APA Style

Jung, K.-S., Kim, H.-M., Lee, J., Ganbat, D., & Lee, S.-E. (2024). Biocontrol of Aflatoxin-Producing Aspergillus flavus ATCC 22546 by a Non-Aflatoxigenic Aspergillus flavus ATCC 9643. Applied Sciences, 14(14), 6142. https://doi.org/10.3390/app14146142

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop