The Molecular Detection and Antimicrobial Profiles of Selected Bacterial Pathogens in Slaughterhouses in Riyadh City, Saudi Arabia
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Study Design
2.2. Collection and Preparation of Samples
2.2.1. Collection of Water Samples from Various Sources in the Abattoirs
2.2.2. Collection of Swab Samples from Carcasses and Tools from Abattoirs
2.3. Isolation Procedures for Major Food- and Water-Borne Bacteria Using Selective Media
2.3.1. Swab Samples Procedure
2.3.2. Water Sample Procedure
2.4. Bacterial Identification and Antibiotic Sensitivity Assessment of the Bacteria by VITEK 2 System
2.5. Molecular Detection of Virulence Genes
2.5.1. DNA Extraction
2.5.2. Detection of Virulence Genes of Recovered Isolates
Organism | Gene | Primer 5–3 | Annealing | Size | Reference |
---|---|---|---|---|---|
E. coli | Sfa/focDE (E1) | F: CTCCGGAGAACTGGGTGCATCTTAC R: CGGAGGAGTAATTACAAACCTGGCA | 60 °C | 410 bp | [36] |
papC (E2) | F: GACGGCTGTACTGCAGGGTGTGGCG R: ATATCCTTTCTGCAGGGATGCAATA | 328 bp | |||
fimH (E3) | F: AACAGCGATGATTTCCAGTTTGTGTG R: ATTGCGTACCAGCATTAGCAATGTCC | 465 bp | |||
K. pneumoniae | rmpA (K1) | F: CATAAGAGTATTGGTTGACAG R: CTTGCATGAGCCATCTTTCA | 60 °C | 461 bp | [43] |
ybtS (K2) | F: GACGGAAACAGCACGGTAAA R: GAGCATAATAAGGCGAAAGA | 242 bp | |||
mrkD (K3) | F: AAGCTATCGCTGTACTTCCGGCA R: GGCGTTGGCGCTCAGATAGG | 340 bp | |||
P. aeruginosa | exoS (P1) | F: CCTTCCCTCCTTCCCCCCGGCGATCTGGA R:AAAGAAATGCATCCTCAGGCGTACATCCT | 58 °C | 270 bp | [41] |
pclH (P2) | F: GAAGCCATGGGCTACTTCAA R: AGAGTGACGAGGAGCGGTAG | 307 bp | |||
toxA (P3) | F: ATGGTGTAGATCGGCGACAT R: AAGCCTTCGACCTCTGGAAC | 433 bp | |||
S. enterica | agfA (S1) | F: TCCGGCCCGGACTCAACG R: CAGCGCGGCGTTATACCG | 63 °C | 261 bp | [42] |
misL (S2) | F: GACGTTGATAGTCTGCCATCCAG R: CAATGCCGCCAGTCTCCGTGC | 986 bp | |||
invA (S3) | F: CTGCTTTCTCTACTTAACAGTGCTCG R: CGCATCAATAATACCGGCCTTC | 57 °C | 413 bp |
2.5.3. PCR for the Detection of Virulence Genes in Isolated Bacteria
3. Results
3.1. Phenotypic Identification of Bacterial Species
3.2. Positive Samples According to Period and Abattoirs
3.3. Antibiotic Sensitivity Test by Vitek 2 System
3.4. Detection of Virulence Genes
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Aljamali, N.M. Review on food poisoning (types, causes, symptoms, diagnosis, treatment). Glob. Acad. J. Pharm. Drug Res. 2021, 3, 54–61. [Google Scholar]
- Adeyemo, O.K. Unhygienic operation of a city abattoir in South Western Nigeria: Environmental implication. Afr. J. Environ. Assess. Manag. 2002, 4, 23–28. [Google Scholar]
- Nafarnda, W.; Yaji, A.; Kubkomawa, H. Impact of abattoir waste on aquatic life: A case study of Yola abattoir. Glob. J. Pure Appl. Sci. 2006, 12, 31–33. [Google Scholar] [CrossRef]
- Uzoigwe, N.E.; Nwufo, C.R.; Nwankwo, C.S.; Ibe, S.N.; Amadi, C.O.; Udujih, O.G. Assessment of bacterial contamination of beef in slaughterhouses in Owerri zone, Imo state, Nigeria. Sci. Afr. 2021, 12, e00769. [Google Scholar] [CrossRef]
- Cadmus, S.; Adesokan, H.; Awosanya, A. Public health issues and observations made during meat inspection at Bodija Municipal Abattoir, Ibadan, Oyo State, Nigeria. Niger. Vet. J. 2008, 29, 43–47. [Google Scholar] [CrossRef]
- Nwanta, J.A.; Onunkwo, J.; Ezenduka, E. Analysis of Nsukka metropolitan abattoir solid waste and its bacterial contents in south eastern Nigeria: Public health implication. Arch. Environ. Occup. Health 2010, 65, 21–26. [Google Scholar] [CrossRef] [PubMed]
- Njoga, E.O.; Ilo, S.U.; Nwobi, O.C.; Onwumere-Idolor, O.S.; Ajibo, F.E.; Okoli, C.E.; Jaja, I.F.; Oguttu, J.W. Pre-slaughter, slaughter and post-slaughter practices of slaughterhouse workers in Southeast, Nigeria: Animal welfare, meat quality, food safety and public health implications. PLoS ONE 2023, 18, e0282418. [Google Scholar] [CrossRef]
- Ovuru, K.F.; Izah, S.C.; Ogidi, O.I.; Imarhiagbe, O.; Ogwu, M.C. Slaughterhouse facilities in developing nations: Sanitation and hygiene practices, microbial contaminants and sustainable management system. Food Sci. Biotechnol. 2023, 1–19. [Google Scholar] [CrossRef]
- Silva, I.F.; de Rezende-Lago, N.C.M.; de Marchi, P.G.F.; Messias, C.T.; Silva, L.A. Microbiological Quality of Food. Seven Ed. 2023, 1501–1518. [Google Scholar] [CrossRef]
- Tafida, S.; Kabir, J.; Kwaga, J.; Bello, M.; Umoh, V.; Yakubu, S.; Nok, A.; Hendriksen, R. Occurrence of Salmonella in retail beef and related meat products in Zaria, Nigeria. Food Control 2013, 32, 119–124. [Google Scholar] [CrossRef]
- Vidyarthi, S.; Vaddella, V.; Cao, N.; Kuppu, S.; Pandey, P. Pathogens in animal carcasses and the efficacy of rendering for pathogen inactivation in rendered products: A review. Future Foods 2021, 3, 100010. [Google Scholar] [CrossRef]
- Oluwafemi, R.; Edugbo, O.; Solanke, E.; Akinyeye, A. Meat quality, nutrition, security and public health. A review of beef processing practices in Nigeria. Afr. J. Food Sci. Technol. 2013, 4, 96–99. [Google Scholar]
- Bersisa, A.; Tulu, D.; Negera, C. Investigation of bacteriological quality of meat from abattoir and butcher shops in Bishoftu, Central Ethiopia. Int. J. Microbiol. 2019, 2019, 6416803. [Google Scholar] [CrossRef] [PubMed]
- Sofos, J.N. Challenges to meat safety in the 21st century. Meat Sci. 2008, 78, 3–13. [Google Scholar] [CrossRef] [PubMed]
- Yu, Z.; Jung, D.; Park, S.; Hu, Y.; Huang, K.; Rasco, B.A.; Wang, S.; Ronholm, J.; Lu, X.; Chen, J. Smart traceability for food safety. Crit. Rev. Food Sci. Nutr. 2022, 62, 905–916. [Google Scholar] [CrossRef] [PubMed]
- Okoli, G.; Okoli, C.; Okorondu, V.; Opara, M. Environmental and public health issues of animal food products delivery system in Imo State, Nigeria. Online J. Health Allied Sci. 2006, 5, 1–10. [Google Scholar]
- Jouve, J.-L.; Aagaard-Hansen, J.; Aidara-Kane, A. Food safety: Equity and social determinants. In Equity, Social Determinants and Public Health Programmes; WHO: Geneve, Switzerland, 2010. [Google Scholar]
- García-Díez, J.; Saraiva, S.; Moura, D.; Grispoldi, L.; Cenci-Goga, B.T.; Saraiva, C. The Importance of the Slaughterhouse in Surveilling Animal and Public Health: A Systematic Review. Vet. Sci. 2023, 10, 167. [Google Scholar] [CrossRef]
- Rani, Z.T.; Mhlongo, L.C.; Hugo, A. Microbial Profiles of Meat at Different Stages of the Distribution Chain from the Abattoir to Retail Outlets. Int. J. Environ. Res. Public Health 2023, 20, 1986. [Google Scholar] [CrossRef] [PubMed]
- Hauge, S.J.; Johannessen, G.S.; Haverkamp, T.H.; Bjørkøy, S.; Llarena, A.K.; Spilsberg, B.; Leithaug, M.; Økland, M.; Holthe, J.; Røtterud, O.-J. Assessment of poultry process hygiene and bacterial dynamics along two broiler slaughter lines in Norway. Food Control 2023, 146, 109526. [Google Scholar] [CrossRef]
- Devleesschauwer, B.; Haagsma, J.A.; Mangen, M.-J.J.; Lake, R.J.; Havelaar, A.H. The global burden of foodborne disease. In Food Safety Economics: Incentives for a Safer Food Supply; Springer: Berlin/Heidelberg, Germany, 2018; pp. 107–122. [Google Scholar]
- Rasool, S.R.; Aljamali, N.M.; Al-Zuhairi, A.J. Guanine substituted heterocyclic derivatives as bioactive compounds. Biochem. Cell. Arch. 2020, 20, 3651–3655. [Google Scholar]
- Kumar, A. Food quality: Hygiene, contaminations and quality testing. J. Nutr. Food Sci. 2019, 2, 100008. [Google Scholar]
- Priyanka, P.; Meena, P.R.; Raj, D.; Rana, A.; Dhanokar, A.; Duggirala, K.S.; Singh, A.P. Urinary tract infection and sepsis causing potential of multidrug-resistant Extraintestinal pathogenic E. coli isolated from plant-origin foods. Int. J. Food Microbiol. 2023, 386, 110048. [Google Scholar] [CrossRef]
- Geresu, M.A.; Desta, W.Z. Carriage, risk factors, and antimicrobial resistance patterns of Salmonella isolates from raw beef in Jimma, Southwestern Ethiopia. Infect. Drug Resist. 2021, 14, 2349–2360. [Google Scholar] [CrossRef] [PubMed]
- Petruzzi, L.; Corbo, M.R.; Sinigaglia, M.; Bevilacqua, A. Microbial spoilage of foods: Fundamentals. In The Microbiological Quality of Food; Elsevier: Amsterdam, The Netherlands, 2017; pp. 1–21. [Google Scholar]
- Snyder, A.B.; Worobo, R.W. The incidence and impact of microbial spoilage in the production of fruit and vegetable juices as reported by juice manufacturers. Food Control 2018, 85, 144–150. [Google Scholar] [CrossRef]
- Ramírez-Castillo, F.Y.; Loera-Muro, A.; Jacques, M.; Garneau, P.; Avelar-González, F.J.; Harel, J.; Guerrero-Barrera, A.L. Waterborne pathogens: Detection methods and challenges. Pathogens 2015, 4, 307–334. [Google Scholar] [CrossRef] [PubMed]
- Huang, K.; Mao, Y.; Zhao, F.; Zhang, X.-X.; Ju, F.; Ye, L.; Wang, Y.; Li, B.; Ren, H.; Zhang, T. Free-living bacteria and potential bacterial pathogens in sewage treatment plants. Appl. Microbiol. Biotechnol. 2018, 102, 2455–2464. [Google Scholar] [CrossRef] [PubMed]
- Jondle, C.N.; Gupta, K.; Mishra, B.B.; Sharma, J. Klebsiella pneumoniae infection of murine neutrophils impairs their efferocytic clearance by modulating cell death machinery. PLoS Pathog. 2018, 14, e1007338. [Google Scholar] [CrossRef] [PubMed]
- Government Food Authority, E.S. A Guide to Method Selection and Consistent Technique; NSW Food Authority: Newington, Australia, 2013. [Google Scholar]
- Corry, J.E.; Curtis, G.; Baird, R.M. Handbook of Culture Media for Food Microbiology; Elsevier: Amsterdam, The Netherlands, 2003; Volume 37. [Google Scholar]
- Taniyasu, S.; Kannan, K.; Wu, Q.; Kwok, K.Y.; Yeung, L.W.; Lam, P.K.; Chittim, B.; Kida, T.; Takasuga, T.; Tsuchiya, Y. Inter-laboratory trials for analysis of perfluorooctanesulfonate and perfluorooctanoate in water samples: Performance and recommendations. Anal. Chim. Acta 2013, 770, 111–120. [Google Scholar] [CrossRef] [PubMed]
- Khalafalla, F.A.; Ali, F.H.; Hassan, A.-R.H.; El-Feky, K.A. Monitoring the bacterial contamination during different stages of beef carcass preparation at Beni-Suef abattoir, Egypt. Benha Vet. Med. J. 2016, 30, 51–58. [Google Scholar] [CrossRef]
- M100-S11; Performance Standards for Antimicrobial Susceptibility Testing: Ninth Informational Supplement. National Committee for Clinical Laboratory Standards: Wayne, PA, USA, 2001.
- Tarchouna, M.; Ferjani, A.; Ben-Selma, W.; Boukadida, J. Distribution of uropathogenic virulence genes in Escherichia coli isolated from patients with urinary tract infection. Int. J. Infect. Dis. 2013, 17, e450–e453. [Google Scholar] [CrossRef] [PubMed]
- Remya, P.; Shanthi, M.; Sekar, U. Characterisation of virulence genes associated with pathogenicity in Klebsiella pneumoniae. Indian J. Med. Microbiol. 2019, 37, 210–218. [Google Scholar] [CrossRef] [PubMed]
- Compain, F.; Babosan, A.; Brisse, S.; Genel, N.; Audo, J.; Ailloud, F.; Kassis-Chikhani, N.; Arlet, G.; Decré, D. Multiplex PCR for detection of seven virulence factors and K1/K2 capsular serotypes of Klebsiella pneumoniae. J. Clin. Microbiol. 2014, 52, 4377–4380. [Google Scholar] [CrossRef] [PubMed]
- Goehring, U.-M.; Schmidt, G.; Pederson, K.J.; Aktories, K.; Barbieri, J.T. The N-terminal domain of Pseudomonas aeruginosaexoenzyme S is a GTPase-activating protein for Rho GTPases. J. Biol. Chem. 1999, 274, 36369–36372. [Google Scholar] [CrossRef] [PubMed]
- Yahr, T.L.; Goranson, J.; Frank, D.W. Exoenzyme S of Pseudomonas aeruginosa is secreted by a type III pathway. Mol. Microbiol. 1996, 22, 991–1003. [Google Scholar] [CrossRef] [PubMed]
- Odumosu, B.T.; Adeniyi, B.A.; Chandra, R. First detection of OXA-10 extended-spectrum beta-lactamases and the occurrence of mexR and nfxB in clinical isolates of Pseudomonas aeruginosa from Nigeria. Chemotherapy 2016, 61, 87–92. [Google Scholar] [CrossRef] [PubMed]
- Mezal, E.H.; Sabol, A.; Khan, M.A.; Ali, N.; Stefanova, R.; Khan, A.A. Isolation and molecular characterization of Salmonella enterica serovar Enteritidis from poultry house and clinical samples during 2010. Food Microbiol. 2014, 38, 67–74. [Google Scholar] [CrossRef] [PubMed]
- Turton, J.F.; Payne, Z.; Micah, K.; Turton, J.A. Capsular type K54, clonal group 29 and virulence plasmids: An analysis of K54 and non-K54 closely related isolates of Klebsiella pneumoniae. Epidemiol. Infect. 2018, 146, 1813–1823. [Google Scholar] [CrossRef] [PubMed]
- Roberts, H.; de Jager, L.; Blight, G. Waste-handling practices at red meat abattoirs in South Africa. Waste Manag. Res. 2009, 27, 25–30. [Google Scholar] [CrossRef]
- Haileselassie, M.; Taddele, H.; Adhana, K.; Kalayou, S. Food safety knowledge and practices of abattoir and butchery shops and the microbial profile of meat in Mekelle City, Ethiopia. Asian Pac. J. Trop. Biomed. 2013, 3, 407–412. [Google Scholar] [CrossRef]
- Majumdar, A.; Pradhan, N.; Sadasivan, J.; Acharya, A.; Ojha, N.; Babu, S.; Bose, S. Food degradation and foodborne diseases: A microbial approach. In Microbial Contamination and Food Degradation; Elsevier: Amsterdam, The Netherlands, 2018; pp. 109–148. [Google Scholar]
- Andrade, A.A.; Paiva, A.D.; Machado, A.B.F. Microbiology of street food: Understanding risks to improve safety. J. Appl. Microbiol. 2023, 134, lxad167. [Google Scholar] [CrossRef] [PubMed]
- Alvseike, O.; Prieto, M.; Torkveen, K.; Ruud, C.; Nesbakken, T. Meat inspection and hygiene in a Meat Factory Cell—An alternative concept. Food Control 2018, 90, 32–39. [Google Scholar] [CrossRef]
- Manyi-Loh, C.E.; Lues, R. A South African Perspective on the Microbiological and Chemical Quality of Meat: Plausible Public Health Implications. Microorganisms 2023, 11, 2484. [Google Scholar] [CrossRef] [PubMed]
- Ogunnusi, T.; Dahunsi, O. Isolation and identification of microorganisms from abattoir effluents from Oyo, Oyo state, Nigeria. J. Appl. Sci. 2014, 2, 218–222. [Google Scholar]
- Pokharel, P.; Dhakal, S.; Dozois, C.M. The diversity of Escherichia coli pathotypes and vaccination strategies against this versatile bacterial pathogen. Microorganisms 2023, 11, 344. [Google Scholar] [CrossRef] [PubMed]
- Nychas, G.-J.E.; Skandamis, P.N.; Tassou, C.C.; Koutsoumanis, K.P. Meat spoilage during distribution. Meat Sci. 2008, 78, 77–89. [Google Scholar] [CrossRef] [PubMed]
- Doulgeraki, A.I.; Ercolini, D.; Villani, F.; Nychas, G.-J.E. Spoilage microbiota associated to the storage of raw meat in different conditions. Int. J. Food Microbiol. 2012, 157, 130–141. [Google Scholar] [CrossRef]
- Adzitey, F. Incidence and antimicrobial susceptibility of Escherichia coli isolated from beef (meat muscle, liver and kidney) samples in Wa Abattoir, Ghana. Cogent Food Agric. 2020, 6, 1718269. [Google Scholar] [CrossRef]
- Darwish, W.; Atia, A.; El-Ghareeb, W.; Elhelaly, A. Prevalence of multidrug resistant shiga toxin-producing Escherichia coli in cattle meat and its contact surfaces. J. Food Qual. Hazards Control 2018, 5, 146–153. [Google Scholar] [CrossRef]
- Tiba, M.R.; Yano, T.; Leite, D.d.S. Genotypic characterization of virulence factors in Escherichia coli strains from patients with cystitis. Rev. Inst. De Med. Trop. São Paulo 2008, 50, 255–260. [Google Scholar] [CrossRef] [PubMed]
- Nyeleti, C.; Hildebrandt, G.; Kleer, J.; Molla, B. Prevalence of Salmonella in Ethiopian cattle and minced beef. Berl. Und Munch. Tierarztl. Wochenschr. 2000, 113, 431–434. [Google Scholar]
- Tadesse, G.; Gebremedhin, E.Z. Prevalence of Salmonella in raw animal products in Ethiopia: A meta-analysis. BMC Res. Notes 2015, 8, 163. [Google Scholar] [CrossRef]
- Yue, M.; Schifferli, D.M. Allelic variation in Salmonella: An underappreciated driver of adaptation and virulence. Front. Microbiol. 2014, 4, 419. [Google Scholar] [CrossRef] [PubMed]
- Al-Hindi, R.R.; Alharbi, M.G.; Alotibi, I.A.; Azhari, S.A.; Ahmad, A.; Alseghayer, M.S.; Teklemariam, A.D.; Almaneea, A.M. MALDI-TOF MS-based identification and antibiotics profiling of Salmonella species isolated from retail chilled chicken in Saudi Arabia. J. King Saud. Univ. -Sci. 2023, 35, 102684. [Google Scholar] [CrossRef]
- Wang, Y.; Yang, B.; Wu, Y.; Zhang, Z.; Meng, X.; Xi, M.; Wang, X.; Xia, X.; Shi, X.; Wang, D. Molecular characterization of Salmonella enterica serovar Enteritidis on retail raw poultry in six provinces and two National cities in China. Food Microbiol. 2015, 46, 74–80. [Google Scholar] [CrossRef] [PubMed]
- Ibrahim, S.; Wei Hoong, L.; Lai Siong, Y.; Mustapha, Z.; CW Zalati, C.S.; Aklilu, E.; Mohamad, M.; Kamaruzzaman, N.F. Prevalence of antimicrobial resistance (AMR) Salmonella spp. and Escherichia coli isolated from broilers in the East Coast of Peninsular Malaysia. Antibiotics 2021, 10, 579. [Google Scholar] [CrossRef]
- Magill, S.S.; Edwards, J.R.; Bamberg, W.; Beldavs, Z.G.; Dumyati, G.; Kainer, M.A.; Lynfield, R.; Maloney, M.; McAllister-Hollod, L.; Nadle, J. Multistate point-prevalence survey of health care–associated infections. N. Engl. J. Med. 2014, 370, 1198–1208. [Google Scholar] [CrossRef]
- Gierczynski, R.; Jagielski, M.; Rastawicki, W.; Kaluzewski, S. Multiplex-PCR assay for identification of Klebsiella pneumoniae isolates carrying the cps loci for K1 and K2 capsule biosynthesis. Pol. J. Microbiol. 2007, 56, 153. [Google Scholar]
- Paczosa, M.K.; Mecsas, J. Klebsiella pneumoniae: Going on the offense with a strong defense. Microbiol. Mol. Biol. Rev. 2016, 80, 629–661. [Google Scholar] [CrossRef] [PubMed]
- Nakhaee, P.; Moghadam, H.Z.; Shokrpoor, S.; Razmyar, J. Klebsiella pneumoniae infection in canaries (Serinus canaria Domestica): A case report. Iran. J. Vet. Res. 2022, 23, 280. [Google Scholar] [PubMed]
- Razmyar, J.; Zamani, A.H. An outbreak of yolk sac infection and dead-in-shell mortality in common canary (Serinus canaria) caused by Klebsiella pneumoniae. Iran. J. Vet. Res. 2016, 17, 141. [Google Scholar] [PubMed]
- Lobanovska, M.; Pilla, G. Focus: Drug development: Penicillin’s discovery and antibiotic resistance: Lessons for the future? Yale J. Biol. Med. 2017, 90, 135. [Google Scholar]
- Brisse, S.; Fevre, C.; Passet, V.; Issenhuth-Jeanjean, S.; Tournebize, R.; Diancourt, L.; Grimont, P. Virulent clones of Klebsiella pneumoniae: Identification and evolutionary scenario based on genomic and phenotypic characterization. PLoS ONE 2009, 4, e4982. [Google Scholar] [CrossRef] [PubMed]
- Chou, H.-C.; Lee, C.-Z.; Ma, L.-C.; Fang, C.-T.; Chang, S.-C.; Wang, J.-T. Isolation of a chromosomal region of Klebsiella pneumoniae associated with allantoin metabolism and liver infection. Infect. Immun. 2004, 72, 3783–3792. [Google Scholar] [CrossRef]
- Yu, W.-L.; Ko, W.-C.; Cheng, K.-C.; Lee, C.-C.; Lai, C.-C.; Chuang, Y.-C. Comparison of prevalence of virulence factors for Klebsiella pneumoniae liver abscesses between isolates with capsular K1/K2 and non-K1/K2 serotypes. Diagn. Microbiol. Infect. Dis. 2008, 62, 1–6. [Google Scholar] [CrossRef] [PubMed]
- Igbinosa, E.O.; Obuekwe, I.S. Evaluation of antibiotic resistant gene in abattoir environment. J. Appl. Sci. Environ. Manag. 2014, 18, 165–170. [Google Scholar] [CrossRef][Green Version]
- Odjadjare, E.; Ebowemen, M. Antibiogram of Pseudomonas isolates and potential public health impact of an abattoir effluent in Benin City, Nigeria. Afr. J. Clin. Exp. Microbiol. 2020, 21, 240–249. [Google Scholar]
- Shariati, A.; Azimi, T.; Ardebili, A.; Chirani, A.; Bahramian, A.; Pormohammad, A.; Sadredinamin, M.; Erfanimanesh, S.; Bostanghadiri, N.; Shams, S. Insertional inactivation of oprD in carbapenem-resistant Pseudomonas aeruginosa strains isolated from burn patients in Tehran, Iran. New Microbes New Infect. 2018, 21, 75–80. [Google Scholar] [CrossRef]
- Bail, L.; Ito, C.A.S.; Arend, L.N.V.S.; da Silva Nogueira, K.; Tuon, F.F. Activity of imipenem-relebactam and ceftolozane-tazobactam against carbapenem-resistant Pseudomonas aeruginosa and KPC-producing Enterobacterales. Diagn. Microbiol. Infect. Dis. 2022, 102, 115568. [Google Scholar] [CrossRef]
- Aeschlimann, J.R. The role of multidrug efflux pumps in the antibiotic resistance of Pseudomonas aeruginosa and other gram-negative bacteria: Insights from the Society of Infectious Diseases Pharmacists. Pharmacother. J. Hum. Pharmacol. Drug Ther. 2003, 23, 916–924. [Google Scholar] [CrossRef] [PubMed]
- Lister, P.D.; Wolter, D.J.; Hanson, N.D. Antibacterial-resistant Pseudomonas aeruginosa: Clinical impact and complex regulation of chromosomally encoded resistance mechanisms. Clin. Microbiol. Rev. 2009, 22, 582–610. [Google Scholar] [CrossRef] [PubMed]
- Mitov, I.; Strateva, T.; Markova, B. Prevalence of virulence genes among Bulgarian nosocomial and cystic fibrosis isolates of Pseudomonas aeruginosa. Braz. J. Microbiol. 2010, 41, 588–595. [Google Scholar] [CrossRef] [PubMed]
- Badamchi, A.; Masoumi, H.; Javadinia, S.; Asgarian, R.; Tabatabaee, A. Molecular detection of six virulence genes in Pseudomonas aeruginosa isolates detected in children with urinary tract infection. Microb. Pathog. 2017, 107, 44–47. [Google Scholar] [CrossRef] [PubMed]
- Collobert, J.-F.; Dorey, F.; Dieuleveux, V.; Quillien, N. Qualité bactériologique de surface de carcasses de bovins. Sci. Des. Aliment. 2002, 22, 327–334. [Google Scholar] [CrossRef]
- Eisel, W.; Linton, R.; Muriana, P. A survey of microbial levels for incoming raw beef, environmental sources, and ground beef in a red meat processing plant. Food Microbiol. 1997, 14, 273–282. [Google Scholar] [CrossRef][Green Version]
- Bensid, A. Hygiène et Inspection des Viandes Rouges; Dar Djelfa Info for Publishing and Distribution: Djelfa Province, Algeria, 2018. [Google Scholar]
- Sulieman, A.M.E.; Abu Zeid, I.M.; Haddad, A. Contamination of Halal Beef Carcasses by Bacteria Grow or Survive During Cold Storage. In Halal and Kosher Food: Integration of Quality and Safety for Global Market Trends; Springer: Berlin/Heidelberg, Germany, 2023; pp. 201–214. [Google Scholar]
- Korkmaz, B.; Maaz, D.; Reich, F.; Gremse, C.; Haase, A.; Mateus-Vargas, R.H.; Mader, A.; Rottenberger, I.; Schafft, H.A.; Bandick, N. Cause and effect analysis between influencing factors related to environmental conditions, hunting and handling practices and the initial microbial load of game carcasses. Foods 2022, 11, 3726. [Google Scholar] [CrossRef] [PubMed]
- Nastasijevic, I.; Boskovic, M.; Glisic, M. Abattoir hygiene. In Present Knowledge in Food Safety; Elsevier: Amsterdam, The Netherlands, 2023; pp. 412–438. [Google Scholar]
- Kelbert, L.; Stephan, R. Knife Decontamination by Cold Water Treatment Supplemented with InspexxTM 210—A Validation Study in an Abattoir. Hygiene 2023, 3, 248–255. [Google Scholar] [CrossRef]
- Hauge, S.J.; Nafstad, O.; Røtterud, O.-J.; Nesbakken, T. The hygienic impact of categorisation of cattle by hide cleanliness in the abattoir. Food Control 2012, 27, 100–107. [Google Scholar] [CrossRef]
- Antic, D.; Houf, K.; Michalopoulou, E.; Blagojevic, B. Beef abattoir interventions in a risk-based meat safety assurance system. Meat Sci. 2021, 182, 108622. [Google Scholar] [CrossRef] [PubMed]
- Adebowale, O.; Alonge, D.; Agbede, S.; Adeyemo, O. Bacteriological assessment of quality of water used at the Bodija municipal abattoir, Ibadan, Nigeria. Sahel J. Vet. Sci. 2010, 9, 63–67. [Google Scholar]
Type of Specimens | No. of Specimens | E. coli | K. pneumoniae | S. enterica | P. aeruginosa |
---|---|---|---|---|---|
Swabs | 85 | 4 (4.7%) | 2 (2.3%) | 11 (12.9%) | 0 (0%) |
Water | 65 | 14 (21.5%) | 12 (18.4%) | 0 (0%) | 10 (15.3%) |
Total | 150 | 18 (12%) | 14 (9.3%) | 11 (7.3%) | 10 (6.6%) |
Period | Abattoir A | Abattoir B | Abattoir C | Abattoir D | Total | ||||
No. of Samples | No. of Positive E. coli | No. of Samples | No. of Positive E. coli | No. of Samples | No. of Positive E. coli | No. of Samples | No. of Positive E. coli | ||
November 2021 | 12 | 0 | 13 | 2 | 12 | 0 | 13 | 3 | 5 (10%) |
January 2022 | 12 | 2 | 13 | 3 | 12 | 1 | 13 | 3 | 9 (18%) |
March 2022 | 12 | 0 | 13 | 1 | 12 | 0 | 13 | 3 | 4 (8%) |
Total | 36 | 2 (5.5%) | 39 | 6 (15.3%) | 36 | 1 (2.5%) | 39 | 9 (25%) | 18 (12%) |
Period | Abattoir A | Abattoir B | Abattoir C | Abattoir D | Total | ||||
No. of Samples | No. of Positive K. pneumoniae | No. of Samples | No. of Positive K. pneumoniae | No. of Samples | No. of Positive K. pneumoniae | No. of Samples | No. of Positive K. pneumoniae | ||
November 2021 | 12 | 2 | 13 | 0 | 12 | 0 | 13 | 2 | 4 (8%) |
January 2022 | 12 | 2 | 13 | 0 | 12 | 2 | 13 | 2 | 6 (12%) |
March 2022 | 12 | 1 | 13 | 0 | 12 | 0 | 13 | 3 | 4 (8%) |
Total | 36 | 5 (13%) | 39 | 0 (0%) | 36 | 2 (5%) | 39 | 7 (18%) | 14 (9.3%) |
Period | Abattoir A | Abattoir B | Abattoir C | Abattoir D | Total | ||||
No. of Samples | No. of Positive S. enterica | No. of Samples | No. of Positive S. enterica | No. of Samples | No. of Positive S. enterica | No. of Samples | No. of Positive S. enterica | ||
November 2021 | 12 | 0 | 13 | 0 | 12 | 0 | 13 | 0 | 0 (0%) |
January 2022 | 12 | 0 | 13 | 0 | 12 | 3 | 13 | 5 | 8 (16%) |
March 2022 | 12 | 0 | 13 | 0 | 12 | 0 | 13 | 3 | 3 (6%) |
Total | 36 | 0 (0%) | 39 | 0 (0%) | 36 | 3 (7.6%) | 39 | 8 (22.2%) | 11 (7.3%) |
Period | Abattoir A | Abattoir B | Abattoir C | Abattoir D | Total | ||||
No. of Samples | No. of Positive P. aeruginosa | No. of Samples | No. of Positive P. aeruginosa | No. of Samples | No. of Positive P. aeruginosa | No. of Samples | No. of Positive P. aeruginosa | ||
November 2021 | 12 | 0 | 13 | 0 | 12 | 0 | 13 | 1 | 1 (2%) |
January 2022 | 12 | 1 | 13 | 0 | 12 | 0 | 13 | 2 | 3 (6%) |
March 2022 | 12 | 1 | 13 | 1 | 12 | 0 | 13 | 4 | 6 (12%) |
Total | 36 | 2 (5.5%) | 39 | 1 (2.5%) | 36 | 0 (0%) | 39 | 7 (19.4%) | 10 (6.6%) |
AST | E. coli (n = 18) | K. pneumoniae (n = 14) | S. enterica (n = 11) | P. aeruginosa (n = 10) | ||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Resistant | Susceptible | Resistant | Susceptible | Resistant | Susceptible | Resistant | Susceptible | |||||||||
No. of Isolates | % | No. of Isolates | % | No. of Isolates | % | No. of Isolates | % | No. of Isolates | % | No. of Isolates | % | No. of Isolates | % | No. of Isolates | % | |
Ampicillin | 0 | 0 | 18 | 100 | 14 | 100 | 0 | 0 | 11 | 100 | 0 | 0 | 10 | 100 | 0 | 0 |
Amoxicillin/Clavulanic Acid | 2 | 11.11 | 16 | 88.89 | 0 | 0 | 14 | 100 | 0 | 0 | 11 | 100 | 2 | 20 | 8 | 80 |
Piperacillin/Tazobactam | 0 | 0 | 18 | 100 | 0 | 0 | 14 | 100 | 0 | 0 | 11 | 100 | 0 | 0 | 10 | 100 |
Cefalotin | 0 | 0 | 18 | 100 | 0 | 0 | 14 | 100 | 0 | 0 | 11 | 100 | 0 | 0 | 10 | 100 |
Cefoxitin | 0 | 0 | 18 | 100 | 0 | 0 | 14 | 100 | 0 | 0 | 11 | 100 | 2 | 20 | 8 | 80 |
Ceftazidime | 0 | 0 | 18 | 100 | 3 | 21.43 | 11 | 78.57 | 0 | 0 | 11 | 100 | 0 | 0 | 10 | 100 |
Ceftriaxone | 0 | 0 | 18 | 100 | 0 | 0 | 14 | 100 | 0 | 0 | 11 | 100 | 0 | 0 | 10 | 100 |
Cefepime | 3 | 16.67 | 15 | 83.33 | 0 | 0 | 14 | 100 | 0 | 0 | 11 | 100 | 3 | 30 | 7 | 70 |
Imipenem | 0 | 0 | 18 | 100 | 0 | 0 | 14 | 100 | 0 | 0 | 11 | 100 | 0 | 0 | 10 | 100 |
Meropenem | 0 | 0 | 18 | 100 | 0 | 0 | 14 | 100 | 0 | 0 | 11 | 100 | 0 | 0 | 10 | 100 |
Amikacin | 0 | 0 | 18 | 100 | 0 | 0 | 14 | 100 | 0 | 0 | 11 | 100 | 0 | 0 | 10 | 100 |
Gentamicin | 2 | 11.11 | 16 | 88.89 | 0 | 0 | 14 | 100 | 11 | 100 | 0 | 0 | 0 | 0 | 10 | 100 |
Ciprofloxacin | 3 | 16.67 | 15 | 83.33 | 0 | 0 | 14 | 100 | 11 | 100 | 0 | 0 | 0 | 0 | 10 | 100 |
Tigecycline | 0 | 0 | 18 | 100 | 2 | 14.29 | 12 | 85.71 | 0 | 0 | 11 | 100 | 10 | 100 | 0 | 0 |
Nitrofurantoin | 0 | 0 | 18 | 100 | 0 | 0 | 14 | 100 | 0 | 0 | 11 | 100 | 0 | 0 | 10 | 100 |
Trimethoprim/Sulfamethoxazole | 0 | 0 | 18 | 100 | 3 | 21.43 | 11 | 78.57 | 11 | 100 | 0 | 0 | 0 | 0 | 10 | 100 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Albuqami, S.A.; Dawoud, T.M.; Moussa, I.M.; Elbehiry, A.; Alsubki, R.A.; Hemeg, H.A.; Qattan, M.Y.; Alhaji, J.H. The Molecular Detection and Antimicrobial Profiles of Selected Bacterial Pathogens in Slaughterhouses in Riyadh City, Saudi Arabia. Appl. Sci. 2023, 13, 13037. https://doi.org/10.3390/app132413037
Albuqami SA, Dawoud TM, Moussa IM, Elbehiry A, Alsubki RA, Hemeg HA, Qattan MY, Alhaji JH. The Molecular Detection and Antimicrobial Profiles of Selected Bacterial Pathogens in Slaughterhouses in Riyadh City, Saudi Arabia. Applied Sciences. 2023; 13(24):13037. https://doi.org/10.3390/app132413037
Chicago/Turabian StyleAlbuqami, Shujaa A., Turki M. Dawoud, Ihab Mohamed Moussa, Ayman Elbehiry, Roua A. Alsubki, Hassan A. Hemeg, Malak Yahia Qattan, and Jwaher H. Alhaji. 2023. "The Molecular Detection and Antimicrobial Profiles of Selected Bacterial Pathogens in Slaughterhouses in Riyadh City, Saudi Arabia" Applied Sciences 13, no. 24: 13037. https://doi.org/10.3390/app132413037
APA StyleAlbuqami, S. A., Dawoud, T. M., Moussa, I. M., Elbehiry, A., Alsubki, R. A., Hemeg, H. A., Qattan, M. Y., & Alhaji, J. H. (2023). The Molecular Detection and Antimicrobial Profiles of Selected Bacterial Pathogens in Slaughterhouses in Riyadh City, Saudi Arabia. Applied Sciences, 13(24), 13037. https://doi.org/10.3390/app132413037