Glucocorticoid Receptor Polymorphism A3669G Is Associated with Airflow Obstruction in Mild-to-Severe Asthma
Abstract
:Featured Application
Abstract
1. Introduction
2. Materials and Methods
2.1. Patients
2.2. Collection of Clinical, Functional and Biological Data
2.3. DNA Extraction and PCR Amplification
- Red blood cell lysis with the cell lysis solution (1350 µL);
- Nuclei lysis with nuclei lysis solution (450 µL) and protein precipitation with protein precipitation solution (150 µL);
- DNA precipitation with isopropanol and 70% ethanol (450 µL);
- DNA rehydration with rehydration solution (40–50 µL) for 1 h at 65 °C or overnight at 4 °C.
2.4. Statistical Analysis
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Ricciardolo, F.L.M.; Guida, G.; Bertolini, F.; Di Stefano, A.; Carriero, V. Phenotype overlap in the natural history of asthma. Eur. Respir. Rev. 2023, 32, 220201. [Google Scholar] [CrossRef] [PubMed]
- Ricciardolo, F.L.M.; Sprio, A.E.; Baroso, A.; Gallo, F.; Riccardi, E.; Bertolini, F.; Carriero, V.; Arrigo, E.; Ciprandi, G. Characterization of T2-Low and T2-High Asthma Phenotypes in Real-Life. Biomedicines 2021, 9, 1684. [Google Scholar] [CrossRef]
- Wadhwa, R.; Dua, K.; Adcock, I.M.; Horvat, J.C.; Kim, R.Y.; Hansbro, P.M. Cellular mechanisms underlying steroid-resistant asthma. Eur. Respir. Rev. 2019, 28, 190096. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Barnes, P.J.; Adcock, I.M. Glucocorticoid resistance in inflammatory diseases. Lancet 2009, 373, 1905–1917. [Google Scholar] [CrossRef] [PubMed]
- Hansbro, P.M.; Kim, R.Y.; Starkey, M.R.; Donovan, C.; Dua, K.; Mayall, J.R.; Liu, G.; Hansbro, N.G.; Simpson, J.L.; Wood, L.G.; et al. Mechanisms and treatments for severe, steroid-resistant allergic airway disease and asthma. Immunol. Rev. 2017, 278, 41–62. [Google Scholar] [CrossRef]
- Sivapalan, P.; Borresen, S.W.; Eklof, J.; Klose, M.; Holm, F.S.; Feldt-Rasmussen, U.; Rossing, M.; Jørgensen, N.R.; Marvig, R.L.; Saeed, M.I.; et al. Adrenal suppression in patients with chronic obstructive pulmonary disease treated with glucocorticoids: Role of specific glucocorticoid receptor polymorphisms. PLoS ONE 2022, 17, e0262898. [Google Scholar] [CrossRef]
- Online Mendelian Inheritance in Man, OMIM®; MIM Number: {#615962}; Johns Hopkins University: Baltimore, MD, USA. 2022. Available online: https://omim.org/ (accessed on 23 August 2022).
- Fu, G.; Fu, L.; Cai, Y.; Zhao, H.; Fu, W. Association between polymorphisms of glucocorticoid receptor genes and asthma: A meta-analysis. Cell. Mol. Biol. 2018, 64, 13–23. [Google Scholar] [CrossRef]
- Sevilla, L.M.; Jiménez-Panizo, A.; Alegre-Martí, A.; Estébanez-Perpiñá, E.; Caelles, C.; Pérez, P. Glucocorticoid Resistance: Interference between the Glucocorticoid Receptor and the MAPK Signalling Pathways. Int. J. Mol. Sci. 2021, 22, 10049. [Google Scholar] [CrossRef]
- Ramos-Ramírez, P.; Tliba, O. Glucocorticoid Receptor β (GRβ): Beyond Its Dominant-Negative Function. Int. J. Mol. Sci. 2021, 22, 3649. [Google Scholar] [CrossRef]
- Stevens, A.; Ray, D.W.; Zeggini, E.; John, S.; Richards, H.L.; Griffiths, C.E.; Donn, R. Glucocorticoid sensitivity is determined by a specific glucocorticoid receptor haplotype. J. Clin. Endocrinol. Metab. 2004, 89, 892–897. [Google Scholar] [CrossRef] [Green Version]
- Huang, H.; Wang, W. Molecular mechanisms of glucocorticoid resistance. Eur. J. Clin. Investig. 2023, 53, e13901. [Google Scholar] [CrossRef] [PubMed]
- Russo, P.; Tomino, C.; Santoro, A.; Prinzi, G.; Proietti, S.; Kisialiou, A.; Cardaci, V.; Fini, M.; Magnani, M.; Collacchi, F.; et al. FKBP5 rs4713916: A Potential Genetic Predictor of Interindividual Different Response to Inhaled Corticosteroids in Patients with Chronic Obstructive Pulmonary Disease in a Real-Life Setting. Int. J. Mol. Sci. 2019, 20, 2024. [Google Scholar] [CrossRef] [Green Version]
- Derijk, R.H.; Schaaf, M.J.; Turner, G.; Datson, N.A.; Vreugdenhil, E.; Cidlowski, J.; de Kloet, E.R.; Emery, P.; Sternberg, E.M.; Detera-Wadleigh, S.D. A human glucocorticoid receptor gene variant that increases the stability of the glucocorticoid receptor beta-isoform mRNA is associated with rheumatoid arthritis. J. Rheumatol. 2001, 28, 2383–2388. [Google Scholar] [PubMed]
- Syed, A.A.; Irving, J.A.; Redfern, C.P.; Hall, A.G.; Unwin, N.C.; White, M.; Bhopal, R.S.; Weaver, J.U. Association of glucocorticoid receptor polymorphism A3669G in exon 9beta with reduced central adiposity in women. Obesity 2006, 14, 759–764. [Google Scholar] [CrossRef]
- Global Initiative for Asthma. Global Strategy for Asthma Management and Prevention. 2020. Available online: www.ginasthmaorg (accessed on 15 March 2023).
- Chung, K.F.; Wenzel, S.E.; Brozek, J.L.; Bush, A.; Castro, M.; Sterk, P.J.; Adcock, I.M.; Bateman, E.D.; Bel, E.H.; Bleecker, E.R.; et al. International ERS/ATS guidelines on definition, evaluation and treatment of severe asthma. Eur. Respir. J. 2014, 43, 343–373. [Google Scholar] [CrossRef] [Green Version]
- Muraro, A.; Roberts, G.; Halken, S.; Agache, I.; Angier, E.; Fernandez-Rivas, M.; Gerth van Wijk, R.; Jutel, M.; Lau, S.; Pajno, G.; et al. EAACI guidelines on allergen immunotherapy: Executive statement. Allergy 2018, 73, 739–743. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hellings, P.W.; Fokkens, W.J.; Bachert, C.; Akdis, C.A.; Bieber, T.; Agache, I.; Bernal-Sprekelsen, M.; Canonica, G.W.; Gevaert, P.; Joos, G.; et al. Positioning the principles of precision medicine in care pathways for allergic rhinitis and chronic rhinosinusitis: A EUFOREA-ARIA-EPOS-AIRWAYS ICP statement. Allergy 2017, 72, 1297–1305. [Google Scholar] [CrossRef] [Green Version]
- Carriero, V.; Bertolini, F.; Sprio, A.E.; Bullone, M.; Ciprandi, G.; Ricciardolo, F.L.M. High levels of plasma fibrinogen could predict frequent asthma exacerbations. J. Allergy Clin. Immunol. Pract. 2020, 8, 2392–2395.e7. [Google Scholar] [CrossRef]
- Sprio, A.E.; Carriero, V.; Levra, S.; Botto, C.; Bertolini, F.; Di Stefano, A.; Maniscalco, M.; Ciprandi, G.; Ricciardolo, F.L.M. Clinical characterization of the frequent exacerbator phenotype in asthma. J. Clin. Med. 2020, 9, 2226. [Google Scholar] [CrossRef]
- Reimondo, G.; Chiodini, I.; Puglisi, S.; Pia, A.; Morelli, V.; Kastelan, D.; Cannavo, S.; Berchialla, P.; Giachino, D.; Perotti, P.; et al. Analysis of BCLI, N363S and ER22/23EK Polymorphisms of the Glucocorticoid Receptor Gene in Adrenal Incidentalomas. PLoS ONE 2016, 11, e0162437. [Google Scholar] [CrossRef] [Green Version]
- Shan, G.; Gerstenberger, S. Fisher’s exact approach for post hoc analysis of a chi-squared test. PLoS ONE 2017, 12, e0188709. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Motulsky, H.J.; Brown, R.E. Detecting outliers when fitting data with nonlinear regression: A new method based on robust nonlinear regression and the false discovery rate. BMC Bioinform. 2006, 7, 123. [Google Scholar] [CrossRef] [Green Version]
- The Genome Aggregation Database. GnomAD. Available online: https://gnomad.broadinstitute.org (accessed on 14 April 2023).
- Oakley, R.H.; Cidlowski, J.A. The biology of the glucocorticoid receptor: New signaling mechanisms in health and disease. J. Allergy Clin. Immunol. 2013, 132, 1033–1044. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Panek, M.; Pietras, T.; Antczak, A.; Fabijan, A.; Przemęcka, M.; Górski, P.; Kuna, P.; Szemraj, J. The N363S and I559N single nucleotide polymorphisms of the h-GR/NR3C1 gene in patients with bronchial asthma. Int. J. Mol. Med. 2012, 30, 142–150. [Google Scholar] [PubMed] [Green Version]
- Mohamed, N.A.; Abdel-Rehim, A.S.; Farres, M.N.; Muhammed, H.S. Influence of glucocorticoid receptor gene NR3C1 646 C>G polymorphism on glucocorticoid resistance in asthmatics: A preliminary study. Cent. Eur. J. Immunol. 2015, 40, 325–330. [Google Scholar] [CrossRef] [Green Version]
- Van Rossum, E.F.; Koper, J.W.; van den Beld, A.W.; Uitterlinden, A.G.; Arp, P.; Ester, W.; Janssen, J.A.; Brinkmann, A.O.; de Jong, F.H.; Grobbee, D.E.; et al. Identification of the Bcl I polymorphism in the glucocorticoid receptor gene: Association with sensitivity to glucocorticoids in vivo and body mass index. Clin. Endocrinol. 2003, 59, 585–592. [Google Scholar] [CrossRef]
- Keskin, O.; Farzan, N.; Birben, E.; Akel, H.; Karaaslan, C.; Maitland-van der Zee, A.H.; Wechsler, M.E.; Vijverberg, S.J.; Kalayci, O. Genetic associations of the response to inhaled corticosteroids in asthma: A systematic review. Clin. Transl. Allergy 2019, 9, 2. [Google Scholar] [CrossRef] [Green Version]
- Keskin, O.; Uluca, U.; Birben, E.; Coşkun, Y.; Ozkars, M.Y.; Keskin, M.; Kucukosmanoglu, E.; Kalayci, O. Genetic associations of the response to inhaled corticosteroids in children during an asthma exacerbation. Pediatr. Allergy Immunol. 2016, 27, 507–513. [Google Scholar] [CrossRef]
- Hawkins, G.A.; Amelung, P.J.; Smith, R.S.; Jongepier, H.; Howard, T.D.; Koppelman, G.H.; Meyers, D.A.; Bleecker, E.R.; Postma, D.S. Identification of Polymorphisms in the Human Glucocorticoid Receptor Gene (NR3C1) in a Multi-racial Asthma Case and Control Screening Panel. DNA Seq. 2004, 15, 167–173. [Google Scholar] [CrossRef]
- Zayed, H. Novel Comprehensive Bioinformatics Approaches to Determine the Molecular Genetic Susceptibility Profile of Moderate and Severe Asthma. Int. J. Mol. Sci. 2020, 21, 4022. [Google Scholar] [CrossRef]
- Ricciardolo, F.L.; Sorbello, V.; Silvestri, M.; Giacomelli, M.; Debenedetti, V.M.; Malerba, M.; Ciprandi, G.; Rossi, G.A.; Rossi, A.; Bontempelli, M. TNF-alpha, IL-4R-alpha and IL-4 polymorphisms in mild to severe asthma from Italian Caucasians. Int. J. Immunopathol. Pharmacol. 2013, 26, 75–84. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Salhi, M.; Lahmar, O.; Salah, M.O.; Banić, I.; Binghao, B.; Malik, W.; Hamzaoui, K.; Turkalj, M.; Hamzaoui, A. GLCCI1 and STIP1 variants are associated with asthma susceptibility and inhaled corticosteroid response in a Tunisian population. J. Asthma 2021, 58, 197–206. [Google Scholar] [CrossRef] [PubMed]
- Bertalan, R.; Patocs, A.; Vasarhelyi, B.; Treszl, A.; Varga, I.; Szabo, E.; Tamas, J.; Toke, J.; Boyle, B.; Nobilis, A.; et al. Association between birth weight in preterm neonates and the BclI polymorphism of the glucocorticoid receptor gene. J. Steroid Biochem. Mol. Biol. 2008, 111, 91–94. [Google Scholar] [CrossRef] [PubMed]
NR3C1 SNPs | Forward Primer | Reverse Primer | Pyrosequencing Primer | TA PCR | Amplicon Length |
---|---|---|---|---|---|
rs41423247 | 5′-GGTCTTGCTCACAGGGTTCTTG-3′ | Bio 5′- GAACTTGCAGGAACATTGAACG -3′ | 5′-AAGTAGACAAGTTATGTCTG -3′ | 58 °C | 128 bp |
rs6198 | Bio 5′- ATGTCTTTTTACCTACGCAGTGA-3′ | 5′-CAATTCGGTAAAATGTGTGGTT-3′ | 5′-AATACCAGAACAGCAAATT-3′ | 58 °C | 125 bp |
refSNP | Alias | Change at the DNA Level | Sequence Ontology Term | Ref Allele | Alt Allele | Genotype Frequencies (N) | Allelic Frequencies | |||
---|---|---|---|---|---|---|---|---|---|---|
rs41423247 | BclI | c.1184+646C>G | Intron Variant | G | C | GG 0.10 (18) | GC 0.44 (75) | CC 0.46 (79) | G 0.54 | C 0.46 |
rs6198 | A3669G | c.*3833A>G | 3′ UTR Variant | A | G | GG 0.06 (11) | AG 0.40 (68) | AA 0.54 (93) | G 0.29 | A 0.71 |
All Population (N = 172) | Mild Asthma (N = 87) | Moderate-Severe Asthma † (N = 85) | |
---|---|---|---|
Age (years) | 58.4 ± 14.0 | 55.7 ± 14.4 | 61.1 ± 13.1 * |
Gender (F) | 109/172 (63.4%) | 54/86 (62.8%) | 55/86 (63.9%) |
BMI (Kg/m2) | 26.7 ± 5.4 | 26.2 ± 5.8 | 27.3 ± 5.0 |
Current smokers (≥10 PY) | 42/172 (24.4%) | 17/87 (19.5%) | 25/85 (29.4%) |
Former smokers (≥10 PY) | 1/172 (0.6%) | 0/86 (0.0%) | 1/85 (1.2%) |
Atopy | 100/172 (58.1%) | 53/87 (60.9%) | 47/85 (55.3%) |
Poly-sensitization | 81/100 (81.0%) | 45/53 (84.9%) | 36/47 (76.6%) |
Asthma exacerbations/year | 1.3 ± 1.5 | 0.7 ± 0.9 | 1.9 ± 1.7 **** |
FE Phenotype | 54/172 (31.4%) | 12/87 (13.8%) | 42/85 (49.4%) *** |
Serum IgE (kU/L) | 275.3 ± 435.7 | 194.0 ± 206.8 | 342.4 ± 550.7 |
Serum IgE >100 kU/L | 78/135 (57.8%) | 35/61 (57.4%) | 43/74 (58.1%) |
FENO (ppb) | 38.8 ± 27.2 | 36.5 ± 27.3 | 41.1 ± 27.1 |
FENO > 30 ppb | 74/154 (48.0%) | 33/76 (43.4%) | 41/78(52.5%) |
Blood eosinophils (cells/µL) | 354.2 ± 287.5 | 300.5 ± 234.7 | 408.6 ± 325.0 * |
Blood eosinophils >300 cells/µL | 70/163 (42.9%) | 29/82 (35.4%) | 41/81 (50.6%) * |
ICS/day (μg BDP-HFA) | 330.2 ± 210.3 | 160.9 ± 81.2 | 503.5 ± 152.3 *** |
LABA | 127/172 (73.8%) | 44/87 (50.6%) | 83/85 (97.6%) *** |
LAMA | 23/172 (13.4%) | 0/87 (0.0%) | 23/85 (27.0%) *** |
OCS (≥6 months/year) | 5/173 (2.9%) | 0/87 (0.0%) | 5/85 (5.9%) * |
Omalizumab | 17/172 (9.9%) | 2/87 (2.3%) | 15/85 (17.6%) ** |
Mepolizumab | 4/172 (2.3%) | 1/87 (1.1%) | 3/85 (3.5%) |
Osteoporosis | 10/172 (5.8%) | 3/87 (3.4%) | 7/85 (8.2%) |
Obesity | 42/172 (24.4%) | 18/87 (20.7%) | 24/85 (28.2%) |
GERD | 47/172 (27.3%) | 20/87 (23.0%) | 23/85 (27.1%) |
AERD | 34/172 (19.8%) | 14/87 (16.1%) | 20/85 (23.5%) |
Persistent Rhinitis | 145/172 (84.3%) | 75/87 (86.2%) | 70/85 (82.3%) |
CRSsNP | 36/172 (20.9%) | 17/87 (19.5%) | 19/85 (22.3%) |
CRSwNP | 25/172 (14.5%) | 8/87 (9.2%) | 17/85 (20.0%) |
Cardiopathy | 14/172 (8.1%) | 4/88 (4.6%) | 10/85 (11.8%) |
CC (N = 79) | CG (N = 75) | GG (N = 18) | |
---|---|---|---|
Mild Asthma | 40/79 (50.6%) | 41/75 (54.7%) | 6/18 (33.3%) |
Moderate-to-severe asthma | 39/79 (49.4%) | 34/75 (45.3%) | 12/18 (66.7%) |
Age (years) | 58.4 ± 14.1 | 56.9 ± 14.4 | 64.3 ± 10.3 |
Gender (F) | 47/79 (59.5%) | 53/75 (70.7%) | 9/18 (50.0%) |
BMI (Kg/m2) | 26.7 ± 5.3 | 26.4 ± 5.7 | 28.2 ± 5.0 |
Current smokers (≥10 PY) | 24/79 (30.4%) | 14/75 (18.7%) | 4/18 (22.2%) |
Former smokers (≥10 PY) | 1/79 (1.3%) | 0/75 (0.0%) | 0/18 (0.0%) |
Atopy | 50/79 (63.3%) | 43/75 (57.3%) | 7/18 (61.1%) |
Poly-sensitization | 43/50 (86.0%) | 34/43 (79.1%) | 4/7 (57.1%) |
Asthma exacerbations per year | 1.3 ± 1.3 | 1.2 ± 1.6 | 1.8 ± 1.9 |
FE phenotype | 26/79 (32.9%) | 20/75 (26.7%) | 8/18 (44.4%) |
Serum IgE (kU/L) | 327.0 ± 515.0 | 252.9 ± 373.9 | 111.7 ± 96.3 |
Serum IgE >100 kU/L | 42/64 (65.6%) | 32/59 (54.2%) | 3/12 (25.0%) * |
FENO (ppb) | 35.9 ± 26.6 | 40.4 ± 27.0 | 42.5 ± 31.4 |
FENO > 30 ppb | 32/70 (45.7%) | 32/66 (48.5%) | 10/12 (83.3%) #* |
Blood eosinophils (cells/µL) | 359.5 ± 270.9 | 356.0 ± 302.3 | 325.8 ± 307.0 |
Blood eosinophils > 300 cells/µL | 32/73 (43.8%) | 32/72 (44.4%) | 6/18 (33.3%) |
ICS/day (μg BDP-HFA) | 325.3 ± 207.2 | 329.3 ± 222.9 | 355.6 ± 175.6 |
LABA | 58/79 (75.0%) | 54/75 (72.0%) | 14/18 (77.8%) |
LAMA | 15/79 (19.0%) | 6/75 (8.0%) | 2/18 (11.1%) |
OCS (≥6 months/year) | 3/79 (3.8%) | 1/75 (1.3%) | 1/18 (5.6%) |
Omalizumab | 10/79 (12.6%) | 5/75 (6.7%) | 2/18 (11.1%) |
Mepolizumab | 1/79 (1.3%) | 3/75 (4.0%) | 0/18 (0.0%) |
Osteoporosis | 6/79 (7.6%) | 3/75 (4.0%) | 1/18 (5.6%) |
GERD | 16/79 (20.2%) | 21/75 (28.0%) | 6/18 (33.3%) |
AERD | 15/79 (20.0%) | 16/75 (21.3%) | 3/18 (16.7%) |
Persistent Rhinitis | 67/79 (84.8%) | 64/75 (44.1%) | 14/18 (77.8%) |
CRSsNP | 14/79 (17.7%) | 17/75 (22.7%) | 5/18 (27.8%) |
CRSwNP | 10/79 (12.6%) | 13/75 (17.3%) | 2/18 (11.1%) |
Cardiopathy | 7/79 (8.9%) | 5/75 (6.7%) | 2/18 (11.1%) |
GG (N = 11) | AG (N = 68) | AA (N = 93) | |
---|---|---|---|
Mild asthma | 7/11 (63.6%) | 35/68 (51.5%) | 45/93 (48.4%) |
Moderate-to-severe asthma | 4/11 (36.4%) | 33/68 (48.5%) | 48/93 (51.6%) |
Age (years) | 61.9 ± 11.0 | 54.4 ± 14.6 § | 60.8 ± 13.3 |
Gender (F) | 9/11 (81.8%) | 41/68 (60.3%) | 59/93 (66.4%) |
BMI (kg/m2) | 29.9 ± 7.7 | 26.0 ± 4.7 * | 26.7 ± 5.1 |
Current smokers (≥10 PY) | 2/11 (18.2%) | 12/68 (17.6%) | 28/93 (30.1%) |
Former smokers (≥10 PY) | 0/11 (0.0%) | 1/68 (1.5%) | 0/93 (0.0%) |
Atopy | 5/11 (45.4%) | 49/68 (72.1%) §§ | 46/93 (49.5%) |
Poly-sensitization | 5/5 (100%) | 41/49 (83.7%) | 35/46 (76.1%) |
Asthma exacerbations/year | 0.9 ± 1.3 | 1.2 ± 1.3 | 1.4 ± 1.6 |
FE Phenotype | 3/11 (27.3%) | 20/68 (29.4%) | 31/93 (33.3%) |
Serum IgE (kU/L) | 273.3 ± 524.6 | 361.9 ± 519.4 § | 204.0 ± 328.9 |
Serum IgE > 100 kU/L | 5/9 (55.6%) | 41/57 (71.9%) §§ | 32/69 (46.4%) |
FeNO ppb | 31.2 ± 20.0 | 37.3 ± 27.3 | 40.8 ± 27.9 |
FeNO > 30 ppb | 4/10 (40.0%) | 26/60 (43.3%) | 44/84 (52.4%) |
Blood eosinophils (cells/µL) | 312.4 ± 268.1 | 359.4 ± 279.1 | 355.1 ± 298.2 |
Blood eosinophils > 300 cells/µL | 3/10 (30.0%) | 29/65 (44.6%) | 38/88 (43.2%) |
ICS/day (μg BDP-HFA) | 300.0 ± 279.3 | 322.1 ± 201.4 | 339.8 ± 209.6 |
LABA | 7/11 (63.6%) | 54/68 (79.4%) | 66/93 (71.0%) |
LAMA | 1/11 (9.1%) | 12/68 (17.6%) | 10/93 (10.8%) |
OCS (≥6 months/year) | 0/11 (0.0%) | 1/68 (1.5%) | 4/93 (4.3%) |
Omalizumab | 1/11 (9.1%) | 7/68 (10.3%) | 9/93 (9.7%) |
Mepolizumab | 0/11 (0.0% | 1/68 (1.5%) | 3/93 (3.2%) |
Osteoporosis | 1/11 (9.1%) | 3/68 (4.4%) | 6/93 (6.4%) |
GERD | 4/11 (36.7%) | 11/68 (16.3%) | 28/93 (30.1%) |
AERD | 2/11 (18.2%) | 15/68 (22.1%) | 17/93 (18.3%) |
Persistent Rhinitis | 10/11 (90.9%) | 57/68 (83.8%) | 78/93 (83.9%) |
CRSsNP | 2/11 (18.2%) | 15/68 (22.1%) | 19/93 (20.4%) |
CRSwNP | 1/11 (9.1%) | 9/68 (13.2%) | 14/93 (15.1%) |
Cardiopathy | 2/11 (18.2%) | 2/68 (2.9%) | 10/93 (10.8%) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mognetti, B.; Giachino, D.F.; Bertolini, F.; Carriero, V.; Sprio, A.E.; Ricciardolo, F.L.M. Glucocorticoid Receptor Polymorphism A3669G Is Associated with Airflow Obstruction in Mild-to-Severe Asthma. Appl. Sci. 2023, 13, 7450. https://doi.org/10.3390/app13137450
Mognetti B, Giachino DF, Bertolini F, Carriero V, Sprio AE, Ricciardolo FLM. Glucocorticoid Receptor Polymorphism A3669G Is Associated with Airflow Obstruction in Mild-to-Severe Asthma. Applied Sciences. 2023; 13(13):7450. https://doi.org/10.3390/app13137450
Chicago/Turabian StyleMognetti, Barbara, Daniela Francesca Giachino, Francesca Bertolini, Vitina Carriero, Andrea Elio Sprio, and Fabio Luigi Massimo Ricciardolo. 2023. "Glucocorticoid Receptor Polymorphism A3669G Is Associated with Airflow Obstruction in Mild-to-Severe Asthma" Applied Sciences 13, no. 13: 7450. https://doi.org/10.3390/app13137450
APA StyleMognetti, B., Giachino, D. F., Bertolini, F., Carriero, V., Sprio, A. E., & Ricciardolo, F. L. M. (2023). Glucocorticoid Receptor Polymorphism A3669G Is Associated with Airflow Obstruction in Mild-to-Severe Asthma. Applied Sciences, 13(13), 7450. https://doi.org/10.3390/app13137450