Hair Regeneration Effects of Lespedeza bicolor Extract In Vivo and In Vitro

Abstract

Alopecia is a chronic inflammatory skin disease with various causes. Lespedeza bicolor extract (LBE) has been reported to have anti-inflammatory and antioxidative effects. In this study, the activity and mechanisms of LBE as a hair growth agent were investigated. Effects of cell proliferation, cytotoxicity, and cell cycle regulation of LBE and its active component protocatechuic acid (PCA) were evaluated in human dermal papilla cells (DPCs). Hair regeneration effects of LBE in 6-week-old C57BL/6 male mice were also determined using positive control 5% minoxidil. The dose-dependent proliferation of DPCs was estimated in response to LBE treatment (0.8–20 µg/mL). Additionally, significant extension of the anagen phase during the hair cell cycle upon LBE treatment was observed histologically and morphologically. Cell cycle arrest gene expression was determined by quantitative real-time polymerase chain reaction. Lespedeza bicolor could be a potent treatment against alopecia through enhancing DPC proliferation and hair regrowth via anagen phase arrest.

1. Introduction

Alopecia, also known as hair loss, is a dermatological disorder with a global distribution. Alopecia has many causes, including genetic factors, androgenic alopecia, stress, nutritional deficiencies, aging, and chronic inflammatory dermatological diseases. The hair growth cycle moves through several phases, including degeneration (catagen phase), rest (telogen phase), and regeneration (anagen phase) in adult hair follicles (HF) for extended periods [1,2,3,4]. Because HFs are composed of dermal papilla cells (DPCs) and skin sheaths of human hair, they have an essential function of controlling hair growth throughout pathogenesis of specific conditions, including hair loss, as well as during the normal hair cycle [5]. The size and number of DPCs are closely related to the hair cycle, and the number of DPCs is relatively high in the regeneration phase [6]. Hair loss is often caused by a chronic scalp inflammation reaction and, as a result, the anagen phase of HF is shortened [7], and all or part of the hair of the head or body may be lost [8]. Currently, androgen receptor antagonists, androgen-independent hair growth stimulants, and 5α-reductase inhibitors, among others, are used as therapeutic agents for preventing hair loss and promoting hair growth [9]. However, due to unpredictable effects and side effects such as decreased sexual desire, their use may be restricted or made only temporarily available [10,11,12,13]. Therefore, research into new drugs to promote hair growth is necessary. Lespedeza bicolor is a legume that grows wild throughout Asia and has recently been cultivated for ornamental and medicinal purposes [14]. Lespedeza bicolor has been used in folk medicine to treat nephritis, azotemia, hyperpigmentation, diuresis, diabetes, and inflammation [14,15,16,17,18]. Additionally, L. bicolor ethanol extract possesses antioxidant, anti-inflammatory, estrogenic, antityrosinase, antifungal, and antimicrobial activities [14,17,19]. Lespedeza bicolor contains isoflavones such as genistein and daidzein, flavonoids such as catechin, quercetin, rutin, luteolin, and naringin, and flavonoid-based metabolites such as protocatechuic acid (PCA) [15]. PCA is one of the most effective components of many natural products and is the main metabolite of anthocyanins. PCA has been reported to have various pharmacological functions such as antioxidant, anti-inflammatory, antiviral, antiaging, and antiosteoporosis effects, as well as being involved in stem cell proliferation and differentiation [20,21,22]. In this study, the effects of LBE on DPC proliferation and cell cycle were investigated. Additionally, hair regeneration promotion effects by LBE were observed in C57BL/6 mice.

2. Materials and Methods

2.1. Materials and Reagents

Lespedeza bicolor was obtained from Ongbok Mountain, Chungbuk, Korea. A voucher specimen (BMRI-18) was deposited in the laboratory of one of the corresponding authors (S.C. Kang). The dried Lespedeza bicolor leaves (100 g) were extracted with 80% ethanol or water (1:10 ratio) at room temperature for 24 h, consecutively. The solvent extract was filtered using a vacuum filter and concentrated using a vacuum evaporator. A total of 19 g of residue was obtained and stored at −20 °C until use. Minoxidil, MTT, and PCA were purchased from Sigma Aldrich (St. Louis, MO, USA).

2.2. Cells

DPC was purchased as primary cells from ScienCell (Carlsbad, CA, USA). Mesenchymal stem cell medium (MSCM), mesangial cell growth factor supplement (MCGS), and fetal bovine serum (FBS) were purchased from ScienCell. DPCs were cultured using MSCM with 2.5% FBS, 1% MCGS, and 1% penicillin/streptomycin in a 5% CO₂ incubator at 37 °C.

2.3. Cell Viability and Proliferation Assay

DPCs (1 × 10⁴ cells/mL) were divided into 96-well plates and incubated at 37 °C overnight. LBE was treated with various concentrations (0.8, 4, 20, 100, and 500 μg/mL), cultured for 24 h or 72 h, and then cultured for 3 h after adding MTT solution (5 mg/mL) to each well. The formazan was dissolved in dimethyl sulfoxide to measure absorbance at 540 nm using a plate reader (Tecan, Switzerland).

2.4. Western Blot Analysis

Each sample-treated DPC was lysed with Pierce RIPA lysis and extraction buffer (Thermo Fisher Scientific, Whaltham, MA, USA) at room temperature for 20 min. Protein was quantified to 30 μg using a bovine serum albumin (BSA) assay. Proteins of the same concentration were decomposed into 12% SDS-PAGE. The membrane was blocked for 1.5 h at room temperature using skim milk buffer and was incubated with appropriate dilutions of primary antibody. Next, the secondary antibody was reacted at room temperature for 1 h. Protein was detected using EZ-western Lumi Pico reagents (DoGenBio, Seoul, Korea). The detected band was quantified using an image analyzing program (Java, Santa Clara, CA, USA).

2.5. In Vivo Experiments

Six-week-old male C57BL/6 mice (a total of 40 mice) were purchased from SLC (Shizuoka, Japan) and were fed a commercial pellet diet and fresh water ad libitum. Mice were housed in a controlled environment with humidity (55 ± 5%), ambient temperature (22 ± 2 °C), and a 12 h light–dark cycle. Animal testing was performed in accordance with Semyung University’s current Code of Ethics for Animal Care and Use (SMECAE 091101). At autopsy, mice were anesthetized by intraperitoneal injection with a mixture of zoletil (Virbac, Carros, France) and rumpun (Bayer, Leverkusen, Germany). The back hairs of mice were removed using a wax–rosin mixture according to Chase’s method (1954) [23], and the mice were divided into 4 groups of 10 individuals: normal control (vehicle control), 5% minoxidil, LBE 1 mg/mL, and LBE 10 mg/mL. All experimental groups were treated with 100 μL of each test substance daily for 18 days on the dorsal skin. The mice’s back and hairs were observed on the 1, 4, 7, 14, and 18th days and separated to investigate histological features. Individual skin tissues were manufactured to a thickness of 4 μm using a Leica ASP300 tissue processor (Leica Microsystems, Wetzlar, Germany) and then stained with hematoxylin & eosin. Afterward, histological morphologies were observed using optical microscopy (Olympus CX 31; Tokyo, Japan).

2.6. HPLC Analysis

To characterize the extract, the content of PCA, a major component of L. bicolor, was measured in the LBE using HPLC (Shimadzu, LC-20AD, PDA detector equipped with Skypack 5 μm C₁₈ column (150 $\times$ 4.6 mm)). Quantitative analysis was performed for 10 min using an isocratic elution (acetonitrile/0.1% trifluoroacetic acid in water = 70:30) with PDA detection (280 nm). The flow rate was 1 mL/min, and 10-μL aliquots of samples were injected for analysis.

2.7. Cell Cycle Analysis

Cell cycles were analyzed using a Tali^® image-based cytometer (Thermo Fisher Scientific) according to the manufacturer’s protocol. DPCs were harvested after treating with LBE, PCA, and minoxidil for 60 h. The harvested DPCs were immobilized overnight with cold 70% ethanol at −20 °C. Next, the DPCs were washed with cold PBS and reacted with the Tali^® Cell Cycle Solution at room temperature for 30 min while the light was blocked.

2.8. Quantitative RT-PCR

Total RNA was purified using RNAisoPlus reagent (Takara, Kusatsu, Japan). Purified total RNA (1 μg) was synthesized using the PrimeScript II first strand cDNA synthesis kit (Takara, Kusatsu, Japan), and the assays were run using SYBR Premix Ex Taq II (Takara, Kusatsu, Japan) for quantitative real-time PCR. Briefly, the reaction mixture (total volume 20 µL) consisted of 10 µL 2× master mix solution, 8 µL DEPC water, 1 µL cDNA template, and 1 µL primers (forward/reverse), followed by heat cycling, preincubation at 95 °C (20 min), 40 cycles were run at 95 °C (20 s), and 58–61 °C (40 s). Quantitative real-time PCR was performed with a QuantStudioTM 5 Real-Time PCR system (Thermo Fisher Scientific) using the primers summarized in

Table 1. Nucleotide sequence of primers and expected size of PCR products.

Target Gene	Sequences		Accession No.
Bax-α	Forward	TGATGGACGGGTCCGGG	NM_138763.4
	Reverse	CAAAGGGCCCCTGTCTTCA
Bcl-2	Forward	CGGAGGCTGGGATGCCTTTGT	NM_000633.3
	Reverse	CAAGCTCCCACCAGGGCCAAA
ERK1	Forward	ACTCCAAAGCCCTTGACCTG	NM_002746.3
	Reverse	CTTCAGCCGCTCCTTAGGTA
ERK2	Forward	CCCGTCTTGGCTTATCCACT	NM_002745.5
	Reverse	TACATACTGCCGCAGGTCAC
p21	Forward	TCACTGTCTTGTACCCTTGTGC	NM_001220777.2
	Reverse	GGCGTTTGGAGTGGTAGAAA
p27	Forward	CTTGCCCGAGTTCTACTACAGAC	NM_004064.5
	Reverse	CAAATGCGTGTCCTCAGAGTTAG
p38	Forward	TATGCGTCTGACAGGAACAC	NM_001315.3
	Reverse	GATCGGCCACTGGTTCATCA
p53	Forward	CGTGTGGAGTATTTGGATGAC	NM_000546.6
	Reverse	TTGTAGTGGATGGTGGTACAGTC
p57	Forward	GATTTCTTCGCCAAGCGCAA	NM_000076.2
	Reverse	GGGGCTCTTTGGGCTCTAAAT
CCNB1 (Cyclin B1)	Forward	TCCAGTTATGCAGCACCTGGCTA	NM_031966.4
	Reverse	TGCCACAGCCTTGGCTAAATCTT
β-actin	Forward	GGACTTCGAGCAAGAGATGG	NM_001199954.1
	Reverse	TGTGTTGGGGTACAGGTCTTTG

.

2.9. Statistical Analysis

Results are presented as the mean ± standard deviation (SD) of three independent experiments. Statistical analysis was performed using GraphPad Prism 5.0 software (GraphPad, San Diego, CA, USA). Data were analyzed through Duncan’s multiple comparison tests following a one-way analysis of variance (ANOVA). Statistical significance was accepted for p values < 0.05.

3. Results

3.1. Effects of LBE on Human Hair Dermal Cell Proliferation

Although cytotoxicity was observed in DPCs treated with high concentrations of LBE, this treatment did not induce any morphological changes. LBE treatment (0.8 to 20 µg/mL) significantly increased the cell proliferation rate of DPCs (7.5–29.8%) compared with the control group (Figure 1). The highest cell proliferation was reached at the 20-µg/mL treatment level.

3.2. Effects of LBE on Protein Expressions in DPCs

LBE treatment increased the expression of Bcl-2, ERK, and p38 in a dose-dependent manner in DPCs (Figure 2); however, LBE did not affect Bax expression in DPCs. These results indicate that LBE could promote HF proliferation and hair growth in vitro.

3.3. Effects of LBE on Hair Regeneration from In Vivo

The effects of LBE administered subcutaneously during the anagen phase after depilation were evaluated. The hair growth cycle of the C57BL/6 mouse is temporally synchronized. The skin of degenerated mice in the telogen phase is pink, but at the beginning of the anagen phase, the skin turns gray [13].

As shown in Figure 3A, both the LBE and minoxidil groups showed light gray skin from day seven after depilation. In particular, 14 days after depilation, 10 mg/mL of LBE treatment induced darker skin than did the 1 mg/mL LBE treatment. Furthermore, the 10 mg/mL LBE treatment yielded more hair shafts than the minoxidil treatment. However, the skin color of the control group remained pink until the 9th day and turned gray on the 10th day. The hair shaft of the control group was first observed on the 11th day. A mature anagen phase was observed on the 18th day after depilation in all mice (Figure 3B). Additionally, hair weight was more than doubled in the 10 mg/mL LBE group on day 18 compared with the normal and positive control groups. Skin tissue samples for histological analysis were collected on the 18th day after depilation. The 10 mg/mL LBE treatment induced longer and larger HFs than the minoxidil treatment; however, both treatments had catagen-like HF morphology (Figure 3C). These results indicated that LBE might stimulate hair growth via early telogen to mature anagen conversion of HFs (Figure 3).

3.4. HPLC Analysis

PCA has already been reported to inhibit oxidative damage, so it was speculated that it could also prevent hair loss by preventing oxidative damage to hair follicle cells. Additionally, it has long been known to inhibit oxidative damage of L. bicolor water extract. Therefore, we tried to compare the PCA content of L. bicolor water extract and LBE. It was confirmed that LBE contained 14 times as much as L. bicolor water extract as PCA (Figure 4). PCA was selected as an indicator component of LBE.

3.5. Effects of LBE on Cell Cycle Phase in DPCs

Cell proliferation efficacy over time was measured using LBE, PCA, and minoxidil as a positive control. Overall cell proliferation capacity increased at 60 h rather than 36 h after treatment with LBE and PCA. However, minoxidil, a positive control, increased the proliferation capacity of DPCs at 36 h and decreased cell proliferation capacity at 60 h (Figure 5A). Therefore, the optimal times for controlling cell proliferation with LBE and minoxidil were different.

To determine how LBE and PCA affect the cell cycle, we investigated the effects of LBE and PCA on the cell cycle using a Tali cell cycle kit. As displayed in Figure 5B, LBE and PCA arrested cell growth. When DPCs were treated with LBE at a concentration of 6.25 μg/mL, the G0/G1 phase increased by 11% compared with the normal control group. These results showed that LBE treatment increased the number of organelles of DPCs and regulated cell growth, resulting in an increase in the G1 phase. Additionally, because cell proliferation has already progressed after cell division by LBE and the G1 phase has increased, the actual cell proliferation phase, the G2/M phase, decreased compared with the normal control.

3.6. Effects of LBE on Cell Cycle Related Biomarkers in DPCs

To determine how LBE and PCA affect cell cycle-related biomarkers, we investigated the effects of LBE and PCA using quantitative real-time PCR. As displayed in Figure 6, LBE increased expression of Bcl-2, Bax-α, CCNB1, p38, ERK1, ERK2, and p21 and decreased expression of p53 and p57. PCA decreased all biomarker gene expression, minoxidil increased expression of Bax-α, ERK2, p21, and p53 and suppressed CCNB1 expression. Therefore, p21, p38, and ERK were regulated in the proliferation of DPCs due to the regulation of cell cycle arrest by LBE because they are genes related to cell cycle arrest.

4. Discussion

Alopecia, which has various causes or interactions, including aging, endocrine imbalances, and genetic factors, is a common hair disease, especially in adult males [2]. It is not clear whether the proliferation rate or apoptotic change of DPCs increase could affect alopecia. For example, the front of patients with androgenetic alopecia (bald) has a low proliferation rate, inducing HF miniaturization, which could be caused by an increase in DNA damage and imbalance in the cell’s recovery capacity [24]. HF growth cycles include three consecutive phases, namely, growth, regression, and relative quiescence. HFs are mini organs with complex structures and uncertain functions that develop in dynamic and alternately changing environments of various molecular signals.

Minoxidil, which is widely used as a treatment for alopecia, has been used for more than 30 years to promote hair growth, but it has side effects such as decreased sexual function. Additionally, minoxidil has a concentration-dependent effect on the differentiation and proliferation of normal human keratinocytes [25] and induces significant DPC proliferation [26].

This study clearly demonstrates that LBE can induce DPC proliferation and promote hair regrowth in C57BL/6 mice. The results showed that LBE treatment enhanced the proliferation rate of DPCs at 0.8–20 μg/mL, whereas its cytotoxic effects on DPCs appeared at higher concentrations (100–500 μg/mL), indicating its high safety profile. Therefore, the results of this study suggest that 0.8–20 µg/mL of LBE may stimulate DPC proliferation and may be safe for subcutaneous use, especially for the scalp, which has anti-inflammatory properties and for the increase in DPCs [27]. Cytotoxicity to human DPCs appeared at high concentrations (100–500 µg/mL), confirming that the safety margin was high. Therefore, the results of this study demonstrated that LBE can stimulate DPC proliferation and may be safe for subcutaneous use, especially on the scalp. The function of DPCs is regulated by the altered shape of hair in the anagen and telogen phases. According to Muller-Rover et al. [28], in mouse experiments, on day nine after hair removal, all HF entered the final stage of the growth phase of the hair cycle. After hair loss, spontaneous regression begins to appear around the 17th day and enters the resting phase (telogen) around the 20th day. HF circulation in young mice follows a rather precise time scale [29]. Therefore, the hair growth-promoting effect of LBE was observed using 6-week-old mice. A similar pattern to that of hair circulation due to hair loss was identified. Topical application of 10 mg/mL LBE can control the early anagen phase and extend the mature anagen phase better than minoxidil as a positive control.

Our previous study showed that ginseng berry increased DPCs by regulating the expression of Bcl-2, p38, and ERK, which was strongly correlated with promoting hair regeneration in vivo [30]. Previous studies showed that topical administration of LBE could act as a potent hair cycle regulator by promoting DPC proliferation. In this study, the G1 phase increased, and the S and G2/M phases decreased after LBE treatment for 60 h, regardless of whether LBE treatment affected the cell cycle of human hair DPC. These results indicate the potential for cell cycle arrest regulation by LBE. Thereafter, cell cycle-related gene expression regulation was confirmed through LBE, and LBE regulated the expression of p21, p38, and ERK genes involved in cell cycle arrest. Therefore, LBE is thought to increase the G1 phase and regulate DPC proliferation by regulating the expression of p38 and ERK at the mRNA and protein levels.

5. Conclusions

In this study, LBE and its active ingredient, PCA, were used to investigate the potential use of LBE as a hair growth promotion agent. Our results provide useful information on a previously unexplored aspect to demonstrate the practical importance of LBE for treating alopecia. Although this study is limited to nonclinical observations, it shows that LBE promotes hair growth by increasing the duration of the G1 phase in DPCs. Nevertheless, it is necessary to determine whether LBE can be used as a therapeutic agent through clinical trials.