Next Article in Journal
Linear and Nonlinear Reduced Order Models for Sloshing for Aeroelastic Stability and Response Predictions
Previous Article in Journal
A Quasi-Static Motion Prediction Model of a Multi-Hull Navigation Vessel in Dynamic Positioning Mode
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Applied Sciences
Volume 12
Issue 17
10.3390/app12178735
applsci-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Antimicrobial Resistance Distribution and Quorum-Sensing Regulation of Enterococcal Strains, Isolated from Hospitalized Patients

by
Rozalina Yordanova
1,
Zvezdelina Yaneva
2,
Deyana Gencheva
3 and
Georgi Beev
4,*
1
Department of Health Care, Faculty of Medicine, Trakia University, 6000 Stara Zagora, Bulgaria
2
Chemistry Unit, Department of Pharmacology, Animal Physiology and Physiological Chemistry, Faculty of Veterinary Medicine, Trakia University, 6000 Stara Zagora, Bulgaria
3
Department of Genetics, Animal Breeding and Reproduction, Agricultural Faculty, Trakia University, 6000 Stara Zagora, Bulgaria
4
Department of Biochemistry, Microbiology and Physics, Agricultural Faculty, Trakia University, 6000 Stara Zagora, Bulgaria
*
Author to whom correspondence should be addressed.
Appl. Sci. 2022, 12(17), 8735; https://doi.org/10.3390/app12178735
Submission received: 20 July 2022 / Revised: 25 August 2022 / Accepted: 30 August 2022 / Published: 31 August 2022
(This article belongs to the Section Applied Biosciences and Bioengineering)
Review Reports Versions Notes

Abstract

:
Background: Enterococci are intrinsically resistant/tolerant to various antimicrobial agents and can also acquire and combine different mechanisms of resistance, including quorum-sensing regulation, to most active compounds, which makes enterococcal infection treatment even more challenging. The aim of this study was to evaluate the pattern of antimicrobial resistance and to analyze the frequency of quorum-sensing asa1 and esp genes in clinical isolates representing the genus Enterococcus. Methods: Multiplex PCR assays were performed for the identification of 110 enterococcal isolates and the determination of their antibiotic susceptibility and the presence of asa1/esp genes. Additionally, the antibiotic resistance of the isolates was tested by the Kirby–Bauer disk diffusion method. Results: 90% of the isolates were identified as Enterococcus faecalis and 10% as Enterococcus faecium. Quorum-sensing regulation genes were present in 109 isolates. Aminoglycoside (aac(6′)/aph(2″)-, quinolone (emeA)-, β-lactams (TEM)-, and vancomycin (vanA)-resistance genes were detected in 108 isolates. All of the isolates tested were vanB negative. According to the Kirby–Bauer method, 39% of the isolates expressed multidrug resistance (MDR) and 33% of the MDR E. faecium were vancomycin-resistant. Conclusion: The large percentage of MDR enterococci possessing asa1/esp genes indicated a possible connection between quorum-sensing regulation and drug resistance. Therefore, the regular monitoring of the antimicrobial resistance of Enterococcus spp., and the identification of virulence factors are needed. It is also important to prevent host colonization through the elimination of factors leading to the expression of quorum-sensing genes.

1. Introduction

In recent years, the medical importance of Gram-positive bacteria, including Enterococcus spp., has increased [1]. This is due to the variety of resistance mechanisms acquired under the wide antibiotic pressure in the medicine and agricultural sectors [2]. Therefore, the spread of these microorganisms results in extremely limited treatment options for infections, prolonged hospital stays, increased treatment costs, and, in many cases, inadequate treatment and increased death rates [2,3]. Although Enterococcus is a normal flora of the gastrointestinal and urogenital systems, the bacteria can nevertheless lead to serious infections such as bacteremia, endocarditis, urinary tract infections, and wounds [2,4]. The relative share of enterococcal nosocomial infections, as well as therapeutic failure due to their enhanced antimicrobial resistance and virulence potential, has increased significantly [3]. Currently, infections caused by multidrug-resistant enterococci (MDRE) represent a serious challenge to the recommended treatment options [2,4,5].
Enterococci possess many genes encoding virulence factors that enable them to survive not only in harsh conditions but also in a hospital environment, which allows them to maintain infection in vulnerable hosts. Such virulence factors are, for example, enterococcal surface protein and aggregation substance, coding from the esp and asa1 genes, respectively. They are involved in the adherence of enterococci to host cells and/or in biofilm formation on abiotic surfaces in a hospital environment [5,6,7]. Biofilm production plays an important role in the pathogenesis of enterococcal infections and provides a survival advantage to the microbial community. It also favors the prolongation of the infection because of the limited penetration of antimicrobial agents [5].
The aim of this study was to evaluate the pattern of antimicrobial resistance and to analyze the frequency of quorum-sensing asa1 and esp genes in clinical isolates representing the genus Enterococcus.

2. Materials and Methods

2.1. Sample Collection, Isolation, and Identification

A total of 110 Enterococcus spp. isolates were obtained from two of the largest Bulgarian university hospitals—in Stara Zagora (50 isolates: 45 E. faecalis and 5 E. faecium) and Plovdiv (60 isolates: 49 E. faecalis and 11 E. faecium). The committee members of the Ethics Committee of the Faculty of Medicine, Trakia University, Stara Zagora, approved our research (Approval Code: 12; Approval Date: 8 October 2019).
The enterococcal isolates were collected from patients with clinical signs of bacterial infections. The different strains isolated in pure culture from samples included urine, urinary catheters, blood, skin, and wound samples, as well as body fluids, vaginal secretions, and respiratory system samples. In all cases, enterococci were recognized as causative agents of particular infections.
All samples were processed according to standard microbiological methods. They were plated on ready-to-use blood agar petri dishes (HiMedia Laboratories, Mumbai, India), followed by incubation for 24 h at 37 °C. The colonies with typical enterococcal morphological characteristics were first identified based on Gram staining and standard biochemical tests [8,9,10]. The suspected colonies from the preliminary study were subcultured on HiCrome Enterococcus faecium Agar Base (HiMedia Laboratories, Mumbai, India) to obtain pure cultures. Species-specific multiplex polymerase chain reaction (PCR) was performed for molecular identification. The amplified sodA gene was identified based on the fragment size presented in Table 1.

2.2. Antimicrobial Susceptibility Testing

The antimicrobial susceptibility profile of the enterococcal clinical isolates was determined by the Kirby–Bauer disk diffusion method [11] on Muller Hinton agar (HiMedia Laboratories, Mumbai, India) with the following antimicrobial agents: ampicillin (2 µg), gentamicin (30 µg) (HLAR—high-level aminoglycoside-resistance), vancomycin (5 µg), teicoplanin (30 µg), norfloxacin (10 µg), imipenem (10 µg), and tigecycline (15 µg). The inhibition zones were interpreted according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST) guidelines [12,13]. Multidrug-resistance (MDR) was defined as resistance to three or more different classes of antibiotics [14].

2.3. Molecular Assays

Genomic DNA from pure cultures was extracted using a DNA extraction kit (GenneMATRIX Gram Plus & Yeast Genomic DNA Purification Kit, Poland), according to the manufacturer’s instructions, and was stored at −80 °C until use. The concentration and purity of the DNA samples were measured by a Nano Vue Plus Spectrophotometer (GE Healthcare, Chicago, IL, USA) at 260/280 nm.
For the species-specific identification of Enterococcus spp. antimicrobial resistance and quorum-sensing regulation genes, a multiplex PCR assay was performed. The sequence of specific primers (Microsynth, Balgach, Switzerland) used are listed in Table 1.
The amplifications were accomplished using a thermal cycler Doppio (2x48) (VWR®, Darmstadt, Germany) in a final reaction volume of 20 μL that included: 2xRedTaq DNA Polymerase Master Mix (VWR, Leuven, Belgium), 100 ng DNA template, and 0.8 μL each of primer and nuclease-free water (ddH2O). The reactions were performed under the following cycling conditions: a preliminary denaturation at 94 °C/5 min, followed by 35 cycles at 94 °C/35 s; primer annealing for 35s at the appropriate temperature, according to Table 1; extension at 72 °C/1 min; final extension at 72 °C/7 min; and storing at 4 °C/∞. The obtained PCR products were stained with fluorescent nucleic acid dye GelRed® (Biotium, Landing Pkwy, Fremont, CA, USA) and separated on 2% agarose gel. The visualization of the generated banding patterns was performed using an Electrophoresis Gel Imaging Analysis System (Bio-Imaging System, Tel Aviv, Israel). The amplified genes were identified based on the fragment size presented in Table 1.
Table
Table 1. Oligonucleotides used as amplification primers for the species-specific identification of Enterococcus spp. antimicrobial resistance and quorum-sensing regulation genes.
Table 1. Oligonucleotides used as amplification primers for the species-specific identification of Enterococcus spp. antimicrobial resistance and quorum-sensing regulation genes.
Target GeneMarker NamePrimer Sequences F/RProduct Size (bp)Annealing TemperatureReferences
sodA of E. faecalisFL1
FL2		ACTTATGTGACTAACTTAACC
TAATGGTGAATCTTGGTTTGG		36053 °C[15]
sodA of E. faeciumFM1
FM2		GAAAAAACAATAGAAGAATTAT
TGCTTTTTTGAATTCTTCTTTA		21553 °C[15]
TEMTEM1
TEM2		AGGAAGAGTATGATTCAACA
CTCGTCGTTTGGTATGGC		53555 °C[16]
aac(6′)/aph(2″)aac(6′)/aph(2″)1
aac(6′)/aph(2″)2		CCAAGAGCAATAAGGGCATA
CACTATCATAACCACTACCG		22055 °C[16]
vanAvanA1
vanA2		GGGAAAACGACAATTGC
GTACAATGCGGCCGTTA		73251 °C[16]
vanBvanB1
vanB2		CATCGCCGTCCCCGAATTTCAAA
GATGCGGAAGATACCGTGGCT		29763.9 °C[16]
emeAemeA1
emeA2		GTGACAGCCTTTGTGGCAGAT
TAGTCCGTTGATGGTTCCTTG		68760 °C[16]
asa1ASA 11
ASA 12		GCACGCTATTACGAACTATGA
TAAGAAAGAACATCACCACGA		37555 °C[17]
espESP 14F
ESP 12R		AGATTTCATCTTTGATTCTTGG
AATTGATTCTTTAGCATCTGG		51055 °C[17]

2.4. Statistical Analysis

The statistical data processing was performed using Statistical Package Statistics 12 (StatSoft Inc., Tulsa, OK, USA), with a Chi-square test used for categorical variables and p-value < 0.05 considered significant.

3. Results

3.1. Molecular Identification

The results of the species identification obtained by conventional biochemical methods were compared to the results of a multiplex PCR assay. Seven discrepancies were reported. Five strains identified as E. faecium by the biochemical tests were identified as E. faecalis by the molecular genetic method, and two strains morphologically identified as E. faecalis were confirmed as E. faecium using the multiplex PCR. Due to the previously reported higher specificity of the PCR assay, the results obtained with this method were used for subsequent analysis [18].
According to the results performed by molecular method, 99 clinical isolates (90%) were identified as E. faecalis and 11 isolates (10%) as E. faecium. Most of the isolates were from urine (37 E. faecalis and 5 E. faecium) and wound secretions (36 E. faecalis and 2 E. faecium) (Table 2).

3.2. Antimicrobial Resistance and Prevalence of Antimicrobial Resistance Genes among Enterococcus spp. Isolates

The antimicrobial resistance of tested isolates is presented in Table 3. The majority of the enterococci were resistant to β-lactams (59% E. faecalis, 100% E. faecium), quinolones (51% E. faecalis, 100% E. faecium), and aminoglycosides (54% E. faecalis, 91% E. faecium).
Regarding the genes of antimicrobial resistance, high-level aminoglycoside (aac(6′)/aph(2″))- and quinolone-resistance (emeA) genes were absent in only two (single isolates from urine and haemoculture) of all of the 110 enterococcal isolates tested. The presence of the TEM gene was detected in six isolates (5%), even though four of them were susceptible to ampicillin, based on the disc diffusion method. The VanA gene was detected in 19 (17%) Enterococcus spp. but only three strains of E. faecium were resistant to vancomycin on the basis of the disc diffusion method, and a single one was both vancomycin- and teicoplanin-resistant. None of the studied isolates expressed the VanB genotype.
The prevalence of antimicrobial resistance genes among MDR Enterococcus spp. clinical isolates is shown in Table 4. The highest rate was found for the aac(6′)/aph(2″) + emeA pattern (78%, n = 86).

3.3. Prevalence of the Quorum-Sensing Regulation Genes asa1 and esp of Enterococcus spp.

The multiplex PCR and the data concerning quorum-sensing regulation genes asa1 and esp are presented in Table 5. The Asa1 gene was the most prevalent one. It was detected in 85% of the tested enterococcal isolates. A single isolate E. faecalis from wound secretion was negative for both genes. No statistical significance was found between esp-/asa1-positive E. faecalis and E. faecium and the same species in which the genes were not present.

3.4. Multidrug Resistance and esp/asa1 Gene Prevalence among Enterococcus spp. Isolates

Among 110 clinical isolates tested, we found 63 (57%) Enterococcus spp. strains (E. faecalis, 53% and E. faecium, 100%) resistant to at least two groups of antibiotics using the disk diffusion method. The highest number of Enterococcus spp. isolates were in the high-level aminoglycoside-resistance group (HLAR) and, at the same time, exhibited resistance to penicillins (ampicillin) and quinolones (ciprofloxacin), which correlates with molecular-genetic analysis.
Multidrug resistance was detected in 43 (39%) of the isolates (E. faecalis, 32% and E. faecium, 100%) (Table 6). Various resistance patterns were observed, of which A–CP–G (HLAR) (ampicillin–ciprofloxacin–high-level gentamicin) was more common (79%). The largest number of isolates that possessed this particular antimicrobial resistance pattern harbored the quorum-sensing regulation asa1 (n = 21, 81%) and esp (n = 5, 19%) genes. Four (33%) of the E. faecium (a single isolate from urine and three isolates from haemocultures) exhibited vancomycin resistance.
Statistical difference was not established between MDR E. faecalis and E. faecium isolates and the same species resistant to one or two antibiotic groups (p = 0.606) (Table 7). However, a statistically significant difference was found between enterococcal isolates positive for the asa1 or esp gene or both the asa1 and esp genes and those that possessed the antimicrobial resistance emeA, TEM, aac(6’)/aph(2’), or vanA genes (p < 0.0001 and p < 0.001, respectively) (Table 8).

4. Discussion

In the present study, among the 110 clinical isolates tested, 90% were identified as E. faecalis and 10% as E. faecium. The species distribution is similar in North and Latin America (57–77% E. faecalis, 5–19% E. faecium) [19] and in some European (75–83% E. faecalis, 16–25% E. faecium) [20,21] and Asian countries (92% E. faecalis, 8% E. faecium) [22]. In contrast, a higher prevalence of E. faecium from various clinical samples compared to E. faecalis has been reported in Turkey (55% E. faecium, 45% E. faecalis) and China (59% E. faecium, 33% E. faecalis) [23].
Most of the enterococcal isolates tested in our study (41%) were collected from urine (E. faecalis, n = 40, E. faecium, n = 5), followed by wound secretions (33%, n = 36; E. faecalis, n = 34, E. faecium, n = 2 respectively). Previous reports from Iran and Saudi Arabia have also indicated the prevalence of urinary tract infections, followed by wound infections [24,25,26]. These data support the statement that isolation rate variation depends on the geographical area and the type of clinical samples in the particular study.
The present study revealed a higher incidence of the quorum-sensing regulation genes (asa1 and esp) encoding the virulence factors involved in biofilm formation. The esp gene was more frequently found in E. faecium (27%) than in E. faecalis isolates (12%), which confirms the findings of authors from Italy and Iran (72%/60% and 66%/47%, respectively) [27,28]. However, in some studies, the esp gene was more prevalent among E. faecalis [29,30] or was not found in E. faecium at all [31,32]. The data obtained revealed a wider distribution of the esp gene among the non-invasive enterococcal isolates from urine samples (80%) compared to invasive ones (20%). This reaffirms the important role of esp as a colonizing factor in urinary tract infections. The results are similar to those reported in Italy [33]. Concerning asa1, it was the most prevalent virulence gene studied (89%), which corresponds to Iranian authors [26]. In contrast to the esp gene, asa1 predominates in E. faecalis isolates, similar to results from Hällgren et al. and Sharifi et al. [28,29].
Enterococci exhibit significant antibiotic resistance, which increases the difficulty in their treatment. The high-level resistance to aminoglycosides (gentamicin) due to aminoglycoside-modifying enzymes undermines the efficacy of the therapy used to treat serious enterococcal infections, since it eliminates synergy with cell wall active antibiotics. Among the many aminoglycoside-modifying enzymes identified, the bifunctional 6’-aminoglycoside acetyltransferase enzyme encoded by the aac(6′)/aph(2″) gene is the most common [34]. Several authors report that the distribution rate of the HLAR enterococci varies from 1–89% in different regions, with a markedly a rising trend [22,35,36,37,38,39]. Therefore, those antimicrobial agents should be used as a last resort. Ninety-eight percentage of the enterococcal isolates we studied carried the aac(6′)/aph(2″) gene, which confirmed the above-mentioned tendency. However, just 58% exhibited a high-level aminoglycoside resistance with the disc diffusion method. In this regard, we can note that, since each PCR assay has inherent limitations, a negative result may not always indicate the absence of a particular gene, and a positive result, in the absence of correlated disc diffusion method results, may not always indicate the presence of an entire gene. For example, a single mutation in the gene region responsible for primer annealing may remarkably reduce the annealing efficiency and produce less or no PCR product. In addition, mutations in regions outside the PCR product that may inactivate the gene would not be found [40].
The efflux pump gene (emeA) was detected in 100% of the ciprofloxacin-resistant enterococci in our study, suggesting that the drug efflux is the main mechanism involved in the resistance of enterococci to the fluoroquinolones. However, the emeA gene was harbored in 43% of ciprofloxacin-susceptible enterococci, indicating the lack of expression of the emeA gene in some isolates. Regarding ciprofloxacin-resistant enterococci, Chinese authors reported a much higher rate (86%) compared to our results (48%) and revealed that a lower rate of ciprofloxacin-resistant isolates possessed the emeA gene, suggesting the involvement of other mechanisms in enterococcal fluoroquinolones resistance, in addition to drug efflux [16].
The resistance of enterococci to β-lactams is due to the production of β-lactamase encoded by the TEM gene or modification in penicillin-binding proteins (PBPs) [41,42]. In terms of ampicillin resistance, 100% and 98%, respectively, of the tested clinical isolates were reported as resistant in Egypt and India [22,38], while the percentage of ampicillin-resistant enterococci in our study was much lower (62%). The TEM gene was detected in only six of our isolates (four E. faecalis and two E. faecium, respectively).
Multidrug-resistant and, in particular, vancomycin-resistant enterococci (VRE) are serious issues that considerably reduce the treatment options of infections caused by these microorganisms [43]. A number of studies have found that VRE-caused infections are associated with higher mortality and economic burden compared to the glycopeptide-sensitive strains [44]. Therefore, vancomycin-resistant enterococci might be expected to be a major issue in the coming years. Variable rates of vancomycin resistance among enterococci were detected worldwide. A lower frequency was reported in Europe and Canada (4%–6%) [45,46], similar to our results (vancomycin-resistant E. faecium, n = 4). However, the studies of enterococcal antimicrobial susceptibility across the world have confirmed an increase in multidrug resistance, especially to vancomycin [26,47,48]. All of the vancomycin-resistant E. faecium in our study showed multidrug resistance, similar to data from American authors [49,50].
In the present study, the vanA gene was detected in 17% (n = 19) of the tested isolates, while all of the four vancomycin-resistant enterococci carried the gene. Similar results, 17% and 15%, respectively, were reported in Iran [51,52]. Although 19 isolates expressed the vanA gene, they were all susceptible to teicoplanin. the VanB gene was not detected in any of the enterococcal isolates tested in our study, which agrees with Jahansepas et al. [26]. The van genotypes determined in this study by multiplex PCR were not fully compatible with the vancomycin-/teicoplanin-resistance phenotypes, but such discrepancies have also been reported previously [53,54,55].
Reports of esp prevalence among VRE isolates vary according to region and population [31,35]. Three of the four vanA-positive MDR E. faecium in our study possessed the esp gene, which is similar to previous results [31,56]. The esp gene in E. faecium is a marker of a pathogenic island that can be transmitted through conjugation to other isolates, and the vanA gene is often found on plasmids [57,58]. Therefore, the identification of isolates positive for both esp and vanA genes must be truly accurate in order to emphasize the infection control strategies and prevent the spread of quorum-sensing regulation genes and antimicrobial-resistance genes to other cells.
In recent decades, an increasing incidence of enterococci with high rates of resistance to various antimicrobial agents has been reported, and the reason for this is thought to be horizontal gene transfer, as plasmids and transposable elements typically carry resistance determinants to more than one class of antimicrobial agents. Multidrug resistance was observed in 43 (39%) of the enterococcal strains tested in our study, with the A–CP–G (HLAR) multiple-resistance profile being prevalent (60%). According to the available information, the extent of MDR among clinical enterococcal isolates varies between 32% and 100% in parts of Asia and Africa [22,35,37,59,60,61], and this phenomenon can be explained by the overuse of antimicrobial agents and selective pressure. In contrast with our results, a much higher rate of multidrug-resistant enterococci was reported in China, India, and Egypt (60%, 63%, and 88%, respectively) [22,38]. This situation necessitates the implementation of an effective infection control program and the regular monitoring of the antimicrobial resistance of Enterococcus spp., in order to establish a rational antibiotic policy for the better management of enterococcal infections.
Considering the alarming and increasing development of multidrug-resistant enteococci responsible for several infections that are difficult to treat due to the inefficaciousness of conventional antibiotics, this study is interesting, relevant, and of high importance for the design of protocols (surveillance, diagnostic, treatment) aimed at overcoming this emergency problem.

5. Conclusions

Antibiotic resistance among enterococci is a worldwide problem. The topic is not only limited to hospitals but also involves the dentistry and veterinary fields. The increased prevalence of multidrug-resistant enterococci with isolates resistant to all antibiotics tested reported in the literature and their capacity to survive in the hospital environment poses a serious therapeutic challenge. This situation requires the complex use of microbiological and molecular genetic methods in the diagnosis of enterococcal infections, the implementation of an effective infection control program, the regular monitoring of the antimicrobial resistance of Enterococcus spp., and the accurate identification of virulence factors associated with the severity and persistence of the infection, in order to establish a rational antibiotic policy for the better management of enterococcal infections.

Author Contributions

Conceptualization, R.Y. and G.B.; methodology, R.Y. and D.G.; software, Z.Y.; formal analysis, R.Y. and G.B.; investigation, R.Y.; resources, R.Y.; writing—original draft preparation, R.Y.; writing—review and editing, G.B.; supervision, G.B. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

The research meets all applicable standards with regard to the ethics of experimentation and research integrity, and the following is being certified/declared true. All subjects gave their informed consent for inclusion before they participated in the study. The study was conducted in accordance with the Declaration of Helsinki, and the protocol was approved by the Ethics Committee of Faculty of Medicine, Trakia University: Approval Code: 12 Approval Date: 8 October 2019.

Informed Consent Statement

Informed consent was obtained from all subjects involved in the study.

Data Availability Statement

Not applicable.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Rice, L.B. Antimicrobial Resistance in Gram-Positive Bacteria. Am. J. Med. 2006, 119 (Suppl. 1), S11–S19. [Google Scholar] [CrossRef] [PubMed]
  2. Orsi, G.B.; Falcone, M.; Venditti, M. Surveillance and management of multidrug-resistant microorganisms. Expert Rev. Anti-Infective Ther. 2011, 9, 653–679. [Google Scholar] [CrossRef] [PubMed]
  3. Salgado, C.D. The risk of developing a vancomycin-resistant Enterococcus bloodstream infection for colonized patients. Am. J. Infect. Control 2008, 36, S175.e5–S175.e8. [Google Scholar] [CrossRef] [PubMed]
  4. Fisher, K.; Phillips, C. The ecology, epidemiology and virulence of Enterococcus. Microbiology 2009, 155 Pt 6, 1749–1757. [Google Scholar] [CrossRef]
  5. Di Rosa, R.; Creti, R.; Venditti, M.; D’Amelio, R.; Arciola, C.R.; Montanaro, L.; Baldassarri, L. Relationship between biofilm formation, the enterococcal surface protein (Esp) and gelatinase in clinical isolates of Enterococcus faecalis and Enterococcus faecium. FEMS Microbiol. Lett. 2006, 256, 145–150. [Google Scholar] [CrossRef]
  6. Oli, A.; Rajeshwari, R.; Chandrakanth, N. Biofilm formation by Multidrug resistant E. faecalis (MDEF) originated from clinical samples. J. Microbiol. Biotechnol. Res. 2012, 2, 284–288. [Google Scholar]
  7. Biswas, P.P.; Dey, S.; Sen, A.; Adhikari, L. Virulence markers of vancomycin resistant enterococci isolated from infected and colonized patients. J. Glob. Infect. Dis. 2014, 6, 157–163. [Google Scholar] [CrossRef]
  8. Fackland, R.; Sham, D.A.; Teixeira, L.M. Enterococcus. In Manual of Clinical Microbiology, 7th ed.; Murray, P.R., Baron, E.J., Pfaller, M.A., Tenover, F.C., Yolken, R.H., Eds.; American Society of Microbiology: Washington, DC, USA, 1999; pp. 297–305. [Google Scholar]
  9. Facklam, R.R.; Carvalho, M.G.S.; Teixeira, L.M. History, Taxonomy, Biochemical Characteristics, and Antibiotic Susceptibility Testing of Enterococci. In The Enterococci: Pathogenesis, Molecular Biology, and Antibiotic Resistance; Gilmore, M.S., Clewell, D.B., Courvalin, P., Dunny, G.M., Murray, B.E., Rice, L.B., Eds.; ASM Press: Washington, DC, USA, 2002; pp. 1–54. [Google Scholar]
  10. Mahon, A.R.; Horton, D.J.; Learman, D.R.; Nathan, L.R.; Jerde, C.L. Investigating diversity of pathogenic microbes in commercial bait trade water. PeerJ 2018, 6, e5468. [Google Scholar] [CrossRef]
  11. Bauer, A.W.; Kirby, W.M.; Sherris, J.C.; Turck, M. Antibiotic susceptibility testing by a standardized single disk method. Am. J. Clin. Pathol. 1966, 45, 493–496. [Google Scholar] [CrossRef]
  12. European Committee on Antimicrobial Susceptibility Testing. Breakpoint Tables for Interpretation of MICs and Zone Diameters, Version 7.1; Valid from 10 March 2017. Available online: https://www.eucast.org/fileadmin/src/media/PDFs/EUCAST_files/Breakpoint_tables/v_7.1_Breakpoint_Tables.pdf (accessed on 15 May 2022).
  13. European Committee on Antimicrobial Susceptibility Testing. Breakpoint Tables for Interpretation of MICs and Zone Diameters, Version 8.1; Valid from 15 May 2018. Available online: https://www.eucast.org/fileadmin/src/media/PDFs/EUCAST_files/Breakpoint_tables/v_8.1_Breakpoint_Tables.pdf (accessed on 15 May 2022).
  14. Magiorakos, A.-P.; Srinivasan, A.; Carey, R.B.; Carmeli, Y.; Falagas, M.E.; Giske, C.G.; Harbarth, S.; Hindler, J.F.; Kahlmeter, G.; Olsson-Liljequist, B.; et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: An international expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect. 2012, 18, 268–281. [Google Scholar] [CrossRef]
  15. Jackson, C.R.; Fedorka-Cray, P.J.; Barrett, J.B. Use of a Genus- and Species-Specific Multiplex PCR for Identification of Enterococci. J. Clin. Microbiol. 2004, 42, 3558–3565. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  16. Jia, W.; Li, G.; Wang, W. Prevalence and Antimicrobial Resistance of Enterococcus Species: A Hospital-Based Study in China. Int. J. Environ. Res. Public Health 2014, 11, 3424–3442. [Google Scholar] [CrossRef] [PubMed]
  17. Vankerckhoven, V.; Van Autgaerden, T.; Vael, C.; Lammens, C.; Chapelle, S.; Rossi, R.; Jabes, D.; Goossens, H. Development of a multiplex PCR for the detection of asa1, gelE, cylA, esp, and hyl genes in enterococci and survey for virulence determinants among European hospital isolates of Enterococcus faecium. J. Clin. Microbiol. 2004, 42, 4473–4479. [Google Scholar] [CrossRef] [PubMed]
  18. Layton, B.; Walters, S.; Lam, L.; Boehm, A. Enterococcus species distribution among human and animal hosts using multiplex PCR. J. Appl. Microbiol. 2010, 109, 539–547. [Google Scholar] [CrossRef] [PubMed]
  19. Low, D.E.; Keller, N.; Barth, A.; Jones, R.N. Clinical Prevalence, Antimicrobial Susceptibility, and Geographic Resistance Patterns of Enterococci: Results from the SENTRY Antimicrobial Surveillance Program, 1997–1999. Clin. Infect. Dis. 2001, 32 (Suppl. 2), S133–S145. [Google Scholar] [CrossRef]
  20. Simonsen, G.S.; Smеbrekke, L.; Monnet, D.L.; Sшrensen, T.L.; Mшller, J.K.; Kristinsson, K.G.; Lagerqvist-Widh, A.; Torell, E.; Digranes, A.; Harthug, S.; et al. Prevalence of resistance to ampicillin, gentamicin and vancomycin in Enterococcus faecalis and Enterococcus faecium isolates from clinical specimens and use of antimicrobials in five Nordic hospitals. J. Antimicrob. Chem. 2003, 51, 323–331. [Google Scholar] [CrossRef]
  21. Zarrilli, R.; Tripodi, M.F.; Di Popolo, A.; Fortunato, R.; Bagattini, M.; Crispino, M.; Florio, A.; Triassi, M.; Utili, R. Molecular epidemiology of high-level aminoglycoside-resistant enterococci isolated from patients in a university hospital in southern Italy. J. Antimicrob. Chemother. 2005, 56, 827–835. [Google Scholar] [CrossRef]
  22. El-Mahdy, R.; Mostafa, A.; El-Kannishy, G. High level aminoglycoside resistant enterococci in hospital-acquired urinary tract infections in Mansoura, Egypt. Germs 2018, 8, 186–190. [Google Scholar] [CrossRef]
  23. Gök, Ş.M.; Türk Dağı, H.; Kara, F.; Arslan, U.; Fındık, D. Investigation of Antibiotic Resistance and Virulence Factors of Enterococcus faecium and Enterococcus faecalis Strains Isolated from Clinical Samples. Mikrobiyol. Bul. 2020, 54, 26–39. [Google Scholar] [CrossRef]
  24. Arshadi, M.; Douraghi, M.; Shokoohizadeh, L.; Moosavian, S.M.; Pourmand, M.R. High prevalence of diverse vancomycin resistance Enterococcus faecium isolates in clinical and environmental sources in ICU wards in southwest of Iran. Microb. Pathog. 2017, 111, 212–217. [Google Scholar] [CrossRef]
  25. Somily, A.M.; Al-Mohizea, M.M.; Absar, M.M.; Fatani, A.J.; Ridha, A.M.; Al-Ahdal, M.N.; Senok, A.C.; Al-Qahtani, A.A. Molecular epidemiology of vancomycin resistant enterococci in a tertiary care hospital in Saudi Arabia. Microb. Pathog. 2016, 97, 79–83. [Google Scholar] [CrossRef] [PubMed]
  26. Jahansepas, A.; Aghazadeh, M.; Rezaee, M.A.; Hasani, A.; Sharifi, Y.; Aghazadeh, T.; Mardaneh, J. Occurrence of Enterococcus faecalis and Enterococcus faecium in Various Clinical Infections: Detection of Their Drug Resistance and Virulence Determinants. Microb. Drug Resist. 2018, 24, 76–82. [Google Scholar] [CrossRef] [PubMed]
  27. Duprи, I.; Zanetti, S.; Schito, A.M.; Fadda, G.; Sechi, L.A. Incidence of virulence determinants in clinical Enterococcus faecium and Enterococcus faecalis isolates collected in Sardinia (Italy). J. Med. Microbiol. 2003, 52 Pt 6, 491–498. [Google Scholar] [CrossRef]
  28. Sharifi, Y.; Hasani, A.; Ghotaslou, R.; Aghazadeh, M.; Milani, M.; Bazmany, A. Virulence and antimicrobial resistance in Enterococci isolated from urinary tract infections. Adv. Pharm. Bull. 2013, 3, 197–201. [Google Scholar]
  29. Hдllgren, A.; Claesson, C.; Saeedi, B.; Monstein, H.J.; Hanberger, H.; Nilsson, L.E. Molecular detection of aggregation substance, enterococcal surface protein, and cytolysin genes and in vitro adhesion to urinary catheters of Enterococcus faecalis and E. faecium of clinical origin. Int. J. Med. Microbiol. 2009, 299, 323–332. [Google Scholar] [CrossRef]
  30. Strateva, T.; Atanasova, D.; Savov, E.; Petrova, G.; Mitov, I. Incidence of virulence determinants in clinical Enterococcus faecalis and Enterococcus faecium isolates collected in Bulgaria. Braz. J. Infect. Dis. 2016, 20, 127–133. [Google Scholar] [CrossRef] [PubMed]
  31. Shankar, V.; Baghdayan, A.S.; Huycke, M.M.; Lindahl, G.; Gilmore, M.S. Infection-derived Enterococcus faecalis strains are enriched in esp, a gene encoding a novel surface protein. Infect. Immun. 1999, 67, 193–200. [Google Scholar] [CrossRef]
  32. Moniri, R.; Ghasemi, A.; Moosavi, S.G.A.; Dastehgoli, K.; Rezaei, M. Virulence Gene’s Relationship with Biofilm Formation and Detection of aac (6′)/aph (2″) in Enterococcus faecalis Isolated From Patients with Urinary Tract Infection. Jundishapur J. Microbiol. 2013, 6, e94137. [Google Scholar] [CrossRef]
  33. Creti, R.; Imperi, M.; Bertuccini, L.; Fabretti, F.; Orefici, G.; Di Rosa, R.; Baldassarri, L. Survey for virulence determinants among Enterococcus faecalis isolated from different sources. J. Med. Microbiol. 2004, 53 Pt 1, 13–20. [Google Scholar] [CrossRef]
  34. Daigle, D.M.; Hughes, D.W.; Wright, G. Prodigious substrate specificity of AAC(6′)-APH(2′’), an aminoglycoside antibiotic resistance determinant in enterococci and staphylococci. Chem. Biol. 1999, 6, 99–110. [Google Scholar] [CrossRef]
  35. Kapoor, L.; Randhawa, V.S.; Deb, M. Antimicrobial resistance of enterococcal blood isolates at a pediatric care hospital in India. Jpn. J. Infect. Dis. 2005, 58, 101–103. [Google Scholar] [PubMed]
  36. Jabalameli, F.; Emaneini, M.; Shahsavan, S.; Sedaghat, H.; Abdolmaliki, Z.; Aligholi, M. Evaluation of Antimicrobial Susceptibility Patterns of Enterococci Isolated from Patients in Tehran University of Medical Sciences Teaching Hospitals. Acta Med. Iran. 2009, 47, 325–328. [Google Scholar]
  37. Fernandes, S.C.; Dhanashree, B. Drug resistance & virulence determinants in clinical isolates of Enterococcus species. Indian J. Med. Res. 2013, 137, 981–985. [Google Scholar]
  38. Bhatt, P.; Patel, A.; Sahni, A.; Praharaj, A.; Grover, N.; Chaudhari, C.; Das, N.K.; Kulkarni, M. Emergence of multidrug resistant enterococci at a tertiary care centre. Med. J. Armed Forces India 2015, 71, 139–144. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  39. Khani, M.; Fatollahzade, M.; Pajavand, H.; Bakhtiari, S.; Abiri, R. Increasing Prevalence of Aminoglycoside-Resistant Enterococcus faecalis Isolates Due to the aac(6’)-aph(2") Gene: A Therapeutic Problem in Kermanshah, Iran. Jundishapur. J. Microbiol. 2016, 9, e28923. [Google Scholar] [CrossRef]
  40. Vakulenko, S.B.; Donabedian, S.M.; Voskresenskiy, A.M.; Zervos, M.J.; Lerner, S.A.; Chow, J.W. Multiplex PCR for detection of aminoglycoside resistance genes in enterococci. Antimicrob. Agents. Chemother. 2003, 47, 1423–1426. [Google Scholar] [CrossRef]
  41. Wilke, M.S.; Lovering, A.L.; Strynadka, N.C. β-Lactam antibiotic resistance: A current structural perspective. Curr. Opin. Microbiol. 2005, 8, 525–533. [Google Scholar] [CrossRef]
  42. Zapun, A.; Contreras-Martel, C.; Vernet, T. Penicillin-binding proteins and β-lactam resistance. FEMS Microbiol. Rev. 2008, 32, 361–385. [Google Scholar] [CrossRef]
  43. Cetinkaya, Y.; Falk, P.; Mayhall, C.G. Vancomycin-Resistant Enterococci. Clin. Microbiol. Rev. 2000, 13, 686–707. [Google Scholar] [CrossRef]
  44. Hautemaniиre, A.; Hunter, P.R.; Diguio, N.; Albuisson, E.; Hartemann, P. A prospective study of the impact of colonization following hospital admission by glycopeptide-resistant Enterococci on mortality during a hospital outbreak. Am. J. Infect. Control 2009, 37, 746–752. [Google Scholar] [CrossRef]
  45. Sievert, D.; Ricks, P.; Edwards, J.; Schneider, A.; Patel, J.; Srinivasan, A.; Kallen, A.; Limbago, B.; Fridkin, S.; National Healthcare Safety Network (NHSN) Team and Participating NHSN Facilities. Antimicrobial resistant pathogens associated with healthcare-associated infections: Summary of data reported to the National Healthcare Safety Network at the Centers for Disease Control and Prevention, 2009–2010. Infect. Control. Hosp. Epidemiol. 2013, 34, 1–14. [Google Scholar] [CrossRef] [PubMed]
  46. Zhanel, G.G.; Adam, H.J.; Baxter, M.R.; Fuller, J.; Nichol, K.A.; Denisuik, A.J.; Lagacй-Wiens, P.R.; Walkty, A.; Karlowsky, J.A.; Schweizer, F.; et al. Antimicrobial susceptibility of 22746 pathogens from Canadian hospitals: Results of the CANWARD 2007-11 study. J. Antimicrob. Chemother. 2013, 68 (Suppl. 1), i7–i22. [Google Scholar] [CrossRef]
  47. Goossens, H.; Jabes, D.; Rossi, R.; Lammens, C.; Privitera, G.; Courvalin, P. European survey of vancomycin-resistant enterococci in at-risk hospital wards and in vitro susceptibility testing of ramoplanin against these isolates. J. Antimicrob. Chemother. 2003, 51 (Suppl. 3), iii5–iii12. [Google Scholar] [CrossRef] [PubMed]
  48. Said, H.S.; Abdelmegeed, E.S. Emergence of multidrug resistance and extensive drug resistance among enterococcal clinical isolates in Egypt. Infect. Drug Resist. 2019, 12, 1113–1125. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  49. Dunne, W.M.; Wang, W. Clonal dissemination and colony morphotype variation of vancomycin-resistant Enterococcus faecium isolates in metropolitan Detroit, Michigan. J. Clin. Microbiol. 1997, 35, 388–392. [Google Scholar] [CrossRef]
  50. Zhanel, G.G.; Laing, N.M.; Nichol, K.A.; Palatnick, L.P.; Noreddin, A.; Hisanaga, T.; Johnson, J.L.; Hoban, D.J.; NAVRESS Group. Antibiotic activity against urinary tract infection (UTI) isolates of vancomycin-resistant enterococci (VRE): Results from the 2002 North American Vancomycin Resistant Enterococci Susceptibility Study (NAVRESS). J. Antimicrob. Chemother. 2003, 52, 382–388. [Google Scholar] [CrossRef]
  51. Rafiei Tabatabaei, S.; Karimi, A.; Navidinia, M.; Fallah, F.; Tavakkoly Fard, A.; Rahbar, M. A study on prevalence of vancomycin-resistant enterococci carriers admitted in a children hospital in Iran. Ann. Biol. Res. 2012, 3, 5441–5445. [Google Scholar]
  52. Hoseinizadeh, A.; Abtahi, H.; ShojaPour, M.; Akbari, M.; Nazari, R.; Sofian, M. Prevalence and antimicrobial susceptibility pattern of vancomycin resistant enterococci isolated from clinical sample of educational hospitals in Arak. Arak. Med. Univ. J. 2012, 15, 11–16. [Google Scholar]
  53. Bell, J.M.; Paton, J.C.; Turnidge, J. Emergence of Vancomycin-Resistant Enterococci in Australia: Phenotypic and Genotypic Characteristics of Isolates. J. Clin. Microbiol. 1998, 36, 2187–2190. [Google Scholar] [CrossRef]
  54. Liassine, N.; Frei, R.; Jan, I.; Auckenthaler, R. Characterization of Glycopeptide-Resistant Enterococci from a Swiss Hospital. J. Clin. Microbiol. 1998, 36, 1853–1858. [Google Scholar] [CrossRef]
  55. Zhu, X.; Zheng, B.; Wang, S.; Willems, R.J.; Xue, F.; Cao, X.; Li, Y.; Bo, S.; Liu, J. Molecular characterisation of outbreak-related strains of vancomycin-resistant Enterococcus faecium from an intensive care unit in Beijing, China. J. Hosp. Infect. 2009, 72, 147–154. [Google Scholar] [CrossRef] [PubMed]
  56. Akpaka, P.E.; Kissoon, S.; Jayaratne, P. Molecular Analysis of Vancomycin-Resistant Enterococci Isolated from Regional Hospitals in Trinidad and Tobago. Adv. Med. 2016, 2016, 8762691. [Google Scholar] [CrossRef] [PubMed]
  57. Top, J.; Willems, R.; van der Velden, S.; Asbroek, M.; Bonten, M. Emergence of clonal complex 17 Enterococcus faecium in The Netherlands. J. Clin. Microbiol. 2008, 46, 214–219. [Google Scholar] [CrossRef] [PubMed]
  58. Rosvoll, T.C.; Lindstad, B.L.; Lunde, T.M.; Hegstad, K.; Aasnжs, B.; Hammerum, A.M.; Lester, C.H.; Simonsen, G.S.; Sundsfjord, A.; Pedersen, T. Increased high-level gentamicin resistance in invasive Enterococcus faecium is associated with aac(6′)Ie-aph(2″)Ia-encoding transferable megaplasmids hosted by major hospital-adapted lineages. FEMS Immunol. Med. Microbiol. 2012, 66, 166–176. [Google Scholar] [CrossRef]
  59. Seno, Y.; Kariyama, R.; Mitsuhata, R.; Monden, K.; Kumon, H. Clinical implications of biofilm formation by Enterococcus faecalis in the urinary tract. Acta Med. Okayama 2005, 59, 79–87. [Google Scholar] [CrossRef]
  60. Hassan, A.; Usman, J.; Kaleem, F.; Omair, M.; Khalid, A.; Iqbal, M. Evaluation of different detection methods of biofilm formation in the clinical isolates. Braz. J. Infect. Dis. 2011, 15, 305–311. [Google Scholar] [CrossRef] [Green Version]
  61. Saffari, F.; Dalfardi, M.S.; Mansouri, S.; Ahmadrajabi, R. Survey for Correlation between Biofilm Formation and Virulence Determinants in a Collection of Pathogenic and Fecal Enterococcus faecalis Isolates. Infect. Chemother. 2017, 49, 176–183. [Google Scholar] [CrossRef]
Table
Table 2. Enterococcus spp. of clinical origin.
Table 2. Enterococcus spp. of clinical origin.
Enterococcus spp. (n = 110)
OriginE. faecalisE. faecium
Blood culture83
Urine375
Urinary catheter30
Wound secretion, abscesses362
Abdominal aspirates31
other 1120
1 Vagina swabs, bronchoalveolar lavage, transtracheal secretion, bulla secretion, navel secretion, skin wash.
Table
Table 3. Antimicrobial resistance of Enterococcus spp. clinical isolates according to the Kirby–Bauer disk diffusion method.
Table 3. Antimicrobial resistance of Enterococcus spp. clinical isolates according to the Kirby–Bauer disk diffusion method.
Antimicrobial AgentResistance (R)
E. faecalis
(n, %)		E. faecium
(n, %)		Total
(n, %)
ampicillin58 (59%)11 (100%)69 (63%)
ciprofloxacin50 (51%)11 (100%)61 (55%)
gentamycin (HLAR)53 (54%)10 (91%)63 (57%)
vancomycin0 (0%)4 (36%)4 (4%)
teicoplanin1 (1%)1 (9%)2 (2%)
tigecycline4 (4%)1 (9%)5 (5%)
imipenem8 (8%)1 (9%)9 (8%)
Table
Table 4. Prevalence and distribution of antimicrobial resistance genes among MDR Enterococcus spp. clinical isolates.
Table 4. Prevalence and distribution of antimicrobial resistance genes among MDR Enterococcus spp. clinical isolates.
Antimicrobial Resistance GenesE. faecalis
(n)		E. faecium
(n)		Total
n (%)
VanB000 (0%)
VanA101 (1%)
emeA101 (1%)
aac(6′)/aph(2″) + emeA80686 (78%)
aac(6′)/aph(2″) + emeA + VanA11314 (13%)
aac(6′)/aph(2″) + emeA + TEM213 (3%)
aac(6′)/aph(2″) + emeA + VanA + TEM213 (3%)
Table
Table 5. Distribution of asa1 and esp genes among Enterococcus spp. clinical isolates.
Table 5. Distribution of asa1 and esp genes among Enterococcus spp. clinical isolates.
Enterococcus spp.Quorum-Sensing Regulation Genes
asa1espasa1 + esp
E. faecalis
(n)		8684
E. faecium
(n)		830
Total
n (%)		94 (85%)11 (10%)4 (4%)
Chi-square Observed value/Critical value3367/38411930/3841
p-value 10.0670.165
1 E. faecalis vs E. faecium, p-value < 0.05 was considered statistically significant.
Table
Table 6. Multiple-antibiotic resistance and esp/asa1 gene prevalence among Enterococcus spp.
Table 6. Multiple-antibiotic resistance and esp/asa1 gene prevalence among Enterococcus spp.
Multidrug Resistance PatternE. faecalis (n)E. faecium (n)Enterococcus spp.
asa1 (+) (n)esp (+) (n)
A–CP–G (HLAR)215215
A–CP–TG1 1
A–CP–G–(HLAR), TG112
A–CP–G (HLAR)–IPM314
CP–G (HLAR)–TEC1 1
CP–G (HLAR)–IPM3 3
CP–G (HLAR)–TG1 1
G (HLAR)–TG–IPM1 1
A–CP–VA 11
A–CP–G (HLAR)–VA 211
A–CP–G (HLAR)–VA–TEC 11
Total3211376
A—ampicillin, CP—ciprofloxacin, GEN (HLAR)—high-level gentamicin resistance; TG—tigecycline, IPM—imipenem, TEC—teicoplanin, VA—vancomycin.
Table
Table 7. Correlation between non-MDR and MDR clinical isolates Enterococcus spp.
Table 7. Correlation between non-MDR and MDR clinical isolates Enterococcus spp.
Enterococcus spp.np-Value 1
Non-MDR540.606
MDR43
1 p-value < 0.05 was considered statistically significant.
Table
Table 8. Correlation between enterococcal isolates possessing asa1/esp genes and carrying antimicrobial resistance genes.
Table 8. Correlation between enterococcal isolates possessing asa1/esp genes and carrying antimicrobial resistance genes.
Quorum-Sensing Regulation GenesAntimicrobial Resistance Genes
emeATEMaac(6′)/aph(2″)VanA
Chi-Square Observed Value/Critical Valuep-Value 1
asa1314,544/12,592<0.0001
esp37,438/12,592<0.0001
asa1 + esp16,000/12,592<0.014
1p-value < 0.05 was considered statistically significant.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Yordanova, R.; Yaneva, Z.; Gencheva, D.; Beev, G. Antimicrobial Resistance Distribution and Quorum-Sensing Regulation of Enterococcal Strains, Isolated from Hospitalized Patients. Appl. Sci. 2022, 12, 8735. https://doi.org/10.3390/app12178735

AMA Style

Yordanova R, Yaneva Z, Gencheva D, Beev G. Antimicrobial Resistance Distribution and Quorum-Sensing Regulation of Enterococcal Strains, Isolated from Hospitalized Patients. Applied Sciences. 2022; 12(17):8735. https://doi.org/10.3390/app12178735

Chicago/Turabian Style

Yordanova, Rozalina, Zvezdelina Yaneva, Deyana Gencheva, and Georgi Beev. 2022. "Antimicrobial Resistance Distribution and Quorum-Sensing Regulation of Enterococcal Strains, Isolated from Hospitalized Patients" Applied Sciences 12, no. 17: 8735. https://doi.org/10.3390/app12178735

APA Style

Yordanova, R., Yaneva, Z., Gencheva, D., & Beev, G. (2022). Antimicrobial Resistance Distribution and Quorum-Sensing Regulation of Enterococcal Strains, Isolated from Hospitalized Patients. Applied Sciences, 12(17), 8735. https://doi.org/10.3390/app12178735

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop